cell_line	tissue	Hugo_Symbol	Chromosome	Start_Position	End_Position	Strand	Variant_Classification	cdna_change	amino_acid_change
22RV1	Prostate	ARID1A	1	27100176	27100176	1	Frame_Shift_Del	c.3972_3972delC	p.Y1324fs
22RV1	Prostate	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
22RV1	Prostate	PRDM16	1	3348678	3348678	1	Missense_Mutation	c.3670A>G	p.T1224A
22RV1	Prostate	TET1	10	70333863	70333863	1	Nonsense_Mutation	c.1768C>T	p.R590*
22RV1	Prostate	MEN1	11	64572093	64572093	-1	Frame_Shift_Del	c.1561_1561delC	p.R521fs
22RV1	Prostate	MEN1	11	64575049	64575049	-1	Missense_Mutation	c.773C>T	p.S258L
22RV1	Prostate	MEN1	11	64575128	64575128	-1	Missense_Mutation	c.694T>C	p.Y232H
22RV1	Prostate	KDM5A	12	438191	438191	-1	Missense_Mutation	c.1778C>T	p.P593L
22RV1	Prostate	CHD4	12	6691430	6691430	-1	Frame_Shift_Del	c.4463_4463delT	p.F1488fs
22RV1	Prostate	ZMYM2	13	20611023	20611023	1	Frame_Shift_Del	c.2266_2266delA	p.K756fs
22RV1	Prostate	MGA	15	42058427	42058427	1	Missense_Mutation	c.8147C>T	p.T2716M
22RV1	Prostate	TP53BP1	15	43730536	43730536	-1	Frame_Shift_Del	c.3177_3177delC	p.P1059fs
22RV1	Prostate	CREBBP	16	3900521	3900521	-1	Missense_Mutation	c.575A>G	p.N192S
22RV1	Prostate	CHD9	16	53276848	53276848	1	Nonsense_Mutation	c.2974C>T	p.R992*
22RV1	Prostate	CHD3	17	7798765	7798765	1	Frame_Shift_Del	c.1789_1789delC	p.P597fs
22RV1	Prostate	DNMT1	19	10267121	10267121	-1	Missense_Mutation	c.1345C>T	p.L449F
22RV1	Prostate	SP110	2	231033844	231033844	-1	Missense_Mutation	c.2138C>G	p.P713R
22RV1	Prostate	HDAC4	2	240002823	240002823	-1	Frame_Shift_Del	c.2703_2703delC	p.P901fs
22RV1	Prostate	HDAC4	2	240055992	240055992	-1	Nonsense_Mutation	c.1243C>T	p.Q415*
22RV1	Prostate	NCOA1	2	24905931	24905931	1	Missense_Mutation	c.466G>A	p.V156I
22RV1	Prostate	EP300	22	41574679	41574679	1	Frame_Shift_Del	c.6964_6964delC	p.P2322fs
22RV1	Prostate	WHSC1	4	1932446	1932446	1	Missense_Mutation	c.1504T>C	p.Y502H
22RV1	Prostate	CHD1	5	98206409	98206409	-1	Frame_Shift_Del	c.3960_3960delA	p.K1320fs
22RV1	Prostate	JARID2	6	15512487	15512487	1	Missense_Mutation	c.3001G>C	p.V1001L
22RV1	Prostate	PHF3	6	64422015	64422015	1	Missense_Mutation	c.4531G>T	p.D1511Y
22RV1	Prostate	KMT2C	7	151841853	151841853	-1	Missense_Mutation	c.14288G>A	p.R4763Q
22RV1	Prostate	KMT2C	7	151851177	151851177	-1	Missense_Mutation	c.12194C>T	p.A4065V
22RV1	Prostate	KMT2C	7	151866322	151866322	-1	Missense_Mutation	c.9466A>G	p.T3156A
22RV1	Prostate	KMT2C	7	151948036	151948036	-1	Missense_Mutation	c.1637T>C	p.M546T
22RV1	Prostate	ASH2L	8	37978556	37978556	1	Missense_Mutation	c.1054G>A	p.A352T
2313287	Stomach	ARID1A	1	27106630	27106633	1	Frame_Shift_Del	c.6241_6244delTGCC	p.C2081fs
2313287	Stomach	KMT2A	11	118342758	118342759	1	Frame_Shift_Ins	c.884_885insG	p.K295fs
2313287	Stomach	KMT2A	11	118375782	118375782	1	Missense_Mutation	c.9175C>A	p.P3059T
2313287	Stomach	CHD8	14	21853897	21853897	-1	Missense_Mutation	c.6784G>A	p.D2262N
2313287	Stomach	MGA	15	42003149	42003149	1	Nonsense_Mutation	c.2686C>T	p.R896*
2313287	Stomach	MGA	15	42054008	42054008	1	Frame_Shift_Del	c.7470_7470delA	p.R2490fs
2313287	Stomach	TP53BP1	15	43730536	43730536	-1	Frame_Shift_Del	c.3177_3177delC	p.P1059fs
2313287	Stomach	TP53BP1	15	43748660	43748661	-1	Frame_Shift_Ins	c.2145_2146insA	p.K715fs
2313287	Stomach	BRD4	19	15367022	15367022	-1	Missense_Mutation	c.1604A>G	p.K535R
2313287	Stomach	HDAC4	2	240024543	240024543	-1	Missense_Mutation	c.2147C>T	p.S716L
2313287	Stomach	NIPBL	5	36984865	36984865	1	Missense_Mutation	c.1583C>T	p.T528M
2313287	Stomach	HDAC2	6	114277195	114277195	-1	Missense_Mutation	c.761C>T	p.A254V
2313287	Stomach	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
2313287	Stomach	KMT2C	7	151874012	151874013	-1	Frame_Shift_Ins	c.8525_8526insA	p.N2842fs
2313287	Stomach	KMT2C	7	151874147	151874148	-1	Frame_Shift_Ins	c.8390_8391insA	p.K2797fs
2313287	Stomach	STK31	7	23776633	23776633	1	Missense_Mutation	c.953A>T	p.D318V
2313287	Stomach	TRRAP	7	98608789	98608789	1	Missense_Mutation	c.11011A>G	p.M3671V
2313287	Stomach	PSIP1	9	15468771	15468771	-1	Missense_Mutation	c.1277T>G	p.M426R
2313287	Stomach	TAF1L	9	32631851	32631851	-1	Missense_Mutation	c.3727C>T	p.R1243W
2313287	Stomach	TAF1L	9	32633584	32633584	-1	Frame_Shift_Del	c.1994_1994delA	p.K665fs
2313287	Stomach	TAF1L	9	32635390	32635390	-1	Missense_Mutation	c.188A>T	p.K63M
2313287	Stomach	HDAC6	X	48678572	48678572	1	Frame_Shift_Del	c.2247_2247delG	p.L749fs
253J	Urinary tract	KAT6B	10	76790331	76790331	1	Missense_Mutation	c.5749A>G	p.I1917V
253J	Urinary tract	SMARCB1	22	24143269	24143269	1	Splice_Site	c.474G>A	p.W158*
253J	Urinary tract	WHSC1	4	1959671	1959671	1	Missense_Mutation	c.2893G>C	p.A965P
253J	Urinary tract	NIPBL	5	37049381	37049381	1	Missense_Mutation	c.6932A>T	p.Q2311L
253J	Urinary tract	BAG6	6	31612922	31612923	-1	Frame_Shift_Ins	c.1187_1188insC	p.P396fs
253J	Urinary tract	BRD2	6	32947868	32947868	1	Missense_Mutation	c.2210A>G	p.Y737C
253J	Urinary tract	TRRAP	7	98535274	98535274	1	Missense_Mutation	c.4235T>G	p.F1412C
253JBV	Urinary tract	KAT6B	10	76790331	76790331	1	Missense_Mutation	c.5749A>G	p.I1917V
253JBV	Urinary tract	TDG	12	104373728	104373729	1	Frame_Shift_Ins	c.286_287insA	p.E96fs
253JBV	Urinary tract	SMARCB1	22	24143269	24143269	1	Splice_Site	c.474G>A	p.W158*
253JBV	Urinary tract	WHSC1	4	1959671	1959671	1	Missense_Mutation	c.2893G>C	p.A965P
253JBV	Urinary tract	NIPBL	5	37049381	37049381	1	Missense_Mutation	c.6932A>T	p.Q2311L
253JBV	Urinary tract	BRD2	6	32947868	32947868	1	Missense_Mutation	c.2210A>G	p.Y737C
253JBV	Urinary tract	TRRAP	7	98535274	98535274	1	Missense_Mutation	c.4235T>G	p.F1412C
253JBV	Urinary tract	ZBTB33	X	119387833	119387834	1	In_Frame_Ins	c.563_564insTGA	p.194_195insD
42MGBA	Central nervous system	BRDT	1	92470097	92470097	1	Missense_Mutation	c.2527A>G	p.K843E
42MGBA	Central nervous system	DAXX	6	33286824	33286824	-1	Missense_Mutation	c.2149C>T	p.R717W
5637	Urinary tract	KDM5A	12	475220	475220	-1	Nonsense_Mutation	c.417G>A	p.W139*
5637	Urinary tract	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
59M	Ovary	CREBBP	16	3823897	3823897	-1	Missense_Mutation	c.2318C>T	p.P773L
59M	Ovary	KDM6A	X	44922860	44922860	1	Missense_Mutation	c.1877C>A	p.A626E
59M	Ovary	ATRX	X	76776888	76776888	-1	Nonsense_Mutation	c.7064C>A	p.S2355*
639V	Urinary tract	ARID1A	1	27092965	27092965	1	Missense_Mutation	c.2896G>A	p.E966K
639V	Urinary tract	CHD5	1	6202288	6202288	-1	Missense_Mutation	c.2336C>T	p.T779I
639V	Urinary tract	MGA	15	42042060	42042060	1	Missense_Mutation	c.6255A>C	p.E2085D
639V	Urinary tract	CREBBP	16	3830754	3830754	-1	Missense_Mutation	c.1802G>A	p.R601Q
639V	Urinary tract	SMARCA4	19	11123687	11123687	1	Silent	c.2337C>T	p.D779D
639V	Urinary tract	SMARCA4	19	11144027	11144027	1	Missense_Mutation	c.3608G>A	p.R1203H
639V	Urinary tract	SMARCA4	19	11152145	11152145	1	Missense_Mutation	c.4429C>T	p.R1477W
639V	Urinary tract	LMNB2	19	2438510	2438510	-1	Missense_Mutation	c.421G>A	p.E141K
639V	Urinary tract	TRIM28	19	59059163	59059163	1	Missense_Mutation	c.844C>T	p.R282C
639V	Urinary tract	MSH6	2	48028293	48028293	1	Frame_Shift_Del	c.3171_3171delG	p.L1057fs
639V	Urinary tract	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
639V	Urinary tract	EP300	22	41545790	41545790	1	Missense_Mutation	c.2405C>T	p.P802L
639V	Urinary tract	EP300	22	41551019	41551019	1	Nonsense_Mutation	c.3163C>T	p.R1055*
639V	Urinary tract	EP300	22	41572404	41572404	1	Nonsense_Mutation	c.4933C>T	p.R1645*
639V	Urinary tract	BAP1	3	52437594	52437594	-1	Missense_Mutation	c.1567G>A	p.V523I
639V	Urinary tract	CHD1	5	98206408	98206409	-1	Frame_Shift_Ins	c.3960_3961insA	p.K1320fs
639V	Urinary tract	BAG6	6	31608032	31608032	-1	Missense_Mutation	c.3100C>T	p.P1034S
639V	Urinary tract	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
639V	Urinary tract	KMT2C	7	151878863	151878863	-1	Nonsense_Mutation	c.6082C>T	p.R2028*
639V	Urinary tract	TRRAP	7	98513428	98513428	1	Missense_Mutation	c.2282G>T	p.R761L
639V	Urinary tract	TRRAP	7	98562317	98562317	1	Missense_Mutation	c.6874G>A	p.V2292I
639V	Urinary tract	KAT6A	8	41834619	41834619	-1	Missense_Mutation	c.1270C>T	p.R424W
639V	Urinary tract	HDAC8	X	71792526	71792526	-1	Missense_Mutation	c.86A>T	p.D29V
647V	Urinary tract	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
647V	Urinary tract	BRD4	19	15355171	15355171	-1	Missense_Mutation	c.2452G>T	p.D818Y
647V	Urinary tract	EP300	22	41547996	41547996	1	Nonsense_Mutation	c.2977C>T	p.Q993*
647V	Urinary tract	KDM6A	X	44918683	44918683	1	Missense_Mutation	c.1166C>T	p.A389V
697	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
697	Haematopoietic and lymphoid tissue	TRRAP	7	98576522	98576522	1	Missense_Mutation	c.8608G>A	p.V2870M
769P	Kidney	BAP1	3	52443595	52443595	-1	Missense_Mutation	c.97T>G	p.Y33D
769P	Kidney	JARID2	6	15410577	15410577	1	Missense_Mutation	c.304G>A	p.E102K
769P	Kidney	TAF1	X	70613988	70613988	1	Missense_Mutation	c.3359A>C	p.E1120A
786O	Kidney	MGA	15	42041782	42041782	1	Missense_Mutation	c.5977G>T	p.V1993F
786O	Kidney	KMT2C	7	151853397	151853397	-1	Missense_Mutation	c.11705C>G	p.A3902G
8305C	Thyroid	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
8505C	Thyroid	RERE	1	8415622	8415622	-1	Frame_Shift_Del	c.4524_4524delA	p.P1508fs
8505C	Thyroid	MGA	15	42035044	42035044	1	Missense_Mutation	c.4886C>G	p.S1629C
8505C	Thyroid	CHD9	16	53190534	53190534	1	Missense_Mutation	c.533G>T	p.R178L
8505C	Thyroid	SMARCA4	19	11118658	11118658	1	Missense_Mutation	c.2082C>G	p.D694E
8MGBA	Central nervous system	KAT6B	10	76784912	76784913	1	Missense_Mutation	c.3569_3570GA>TG	p.R1190M
A101D	Skin	NIPBL	5	37064771	37064771	1	Missense_Mutation	c.8192C>G	p.T2731S
A101D	Skin	PHIP	6	79707988	79707988	-1	Missense_Mutation	c.2000C>T	p.T667I
A101D	Skin	SMARCA2	9	2039777	2039791	1	In_Frame_Del	c.667_681delCAGCAGCAGCAGCAG	p.QQQQQ233del
A172	Central nervous system	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
A172	Central nervous system	TAF1	X	70596911	70596911	1	Missense_Mutation	c.644C>T	p.P215L
A204	Soft tissue	SMARCB1	22	24145522	24145523	1	Frame_Shift_Del	c.568_569delTC	p.S190fs
A204	Soft tissue	TRRAP	7	98508145	98508145	1	Missense_Mutation	c.1727T>C	p.I576T
A204	Soft tissue	WHSC1L1	8	38205571	38205571	-1	Missense_Mutation	c.119T>C	p.I40T
A2058	Skin	CHD5	1	6186638	6186638	-1	Missense_Mutation	c.4072G>A	p.D1358N
A2058	Skin	TRIM24	7	138252253	138252253	1	Missense_Mutation	c.1558C>G	p.Q520E
A2058	Skin	TAF1L	9	32630874	32630874	-1	Missense_Mutation	c.4704T>A	p.D1568E
A253	Salivary gland	TRIM28	19	59060861	59060861	1	Missense_Mutation	c.1826A>G	p.E609G
A2780	Ovary	ARID1A	1	27101006	27101006	1	Nonsense_Mutation	c.4288C>T	p.Q1430*
A2780	Ovary	ARID1A	1	27105551	27105551	1	Frame_Shift_Del	c.5162_5162delG	p.R1721fs
A2780	Ovary	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
A2780	Ovary	SMARCA4	19	11132513	11132513	1	Missense_Mutation	c.2729C>T	p.T910M
A2780	Ovary	NIPBL	5	37059231	37059233	1	In_Frame_Del	c.7649_7651delAAC	p.Q2551del
A2780	Ovary	IKZF1	7	50467856	50467856	1	Missense_Mutation	c.1091C>T	p.S364L
A375	Skin	DNMT1	19	10259597	10259597	-1	Missense_Mutation	c.2683C>T	p.P895S
A375	Skin	CHD1	5	98215316	98215318	-1	In_Frame_Del	c.3175_3177delGAA	p.E1059del
A375	Skin	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
A375	Skin	TRRAP	7	98509802	98509803	1	Missense_Mutation	c.2165_2166CC>TT	p.S722F
A3KAW	Haematopoietic and lymphoid tissue	TRIM33	1	115005824	115005824	-1	Silent	c.825C>T	p.F275F
A3KAW	Haematopoietic and lymphoid tissue	ARID1A	1	27101691	27101691	1	Missense_Mutation	c.4973G>A	p.R1658Q
A3KAW	Haematopoietic and lymphoid tissue	KMT2A	11	118342520	118342520	1	Missense_Mutation	c.646A>G	p.K216E
A3KAW	Haematopoietic and lymphoid tissue	BAP1	3	52439923	52439923	-1	Missense_Mutation	c.789A>G	p.I263M
A3KAW	Haematopoietic and lymphoid tissue	PHF3	6	64394099	64394099	1	Missense_Mutation	c.476A>G	p.K159R
A498	Kidney	SMARCA4	19	11132551	11132551	1	Missense_Mutation	c.2767G>C	p.A923P
A498	Kidney	KMT2C	7	151873581	151873581	-1	Missense_Mutation	c.8957G>A	p.G2986D
A498	Kidney	TRRAP	7	98540574	98540574	1	Missense_Mutation	c.4407A>C	p.Q1469H
A4FUK	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
A549	Lung	SMARCA4	19	11121117	11121139	1	Frame_Shift_Del	c.2184_2206delGCAGTCCTACTATGCCGTGGCCC	p.L728fs
A549	Lung	BRD3	9	136905272	136905274	-1	In_Frame_Del	c.1525_1527delGAG	p.E509del
A704	Kidney	NCOA1	2	24962325	24962325	1	Missense_Mutation	c.3226A>G	p.I1076V
A704	Kidney	KMT2C	7	151949674	151949676	-1	In_Frame_Del	c.1424_1426delATC	p.H475del
A704	Kidney	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
ABC1	Lung	CHD9	16	53190695	53190695	1	Missense_Mutation	c.694T>G	p.S232A
ABC1	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
ABC1	Lung	NSD1	5	176638221	176638221	1	Missense_Mutation	c.2821C>T	p.R941C
ACCMESO1	Pleura	SETDB1	1	150902577	150902581	1	Frame_Shift_Del	c.395_399delTCCTC	p.V132fs
ACCMESO1	Pleura	SMARCA4	19	11143994	11143994	1	Missense_Mutation	c.3575G>A	p.R1192H
ACCMESO1	Pleura	EP300	22	41533700	41533700	1	Missense_Mutation	c.1666A>G	p.M556V
ACCS	Urinary tract	NCOA1	2	24964713	24964713	1	Nonsense_Mutation	c.3364C>T	p.R1122*
ACCS	Urinary tract	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
ACCS	Urinary tract	EP300	22	41556657	41556657	1	Missense_Mutation	c.3602G>A	p.C1201Y
ACCS	Urinary tract	KDM6A	X	44929583	44929583	1	Nonsense_Mutation	c.2839G>T	p.E947*
AGS	Stomach	CHD5	1	6219557	6219557	-1	Missense_Mutation	c.226T>G	p.S76A
AGS	Stomach	KAT6B	10	76784882	76784882	1	Missense_Mutation	c.3539T>C	p.V1180A
AGS	Stomach	EP300	22	41523633	41523633	1	Missense_Mutation	c.1049A>G	p.K350R
AGS	Stomach	EP300	22	41537100	41537100	1	Nonsense_Mutation	c.1927G>T	p.E643*
AGS	Stomach	EP300	22	41548285	41548285	1	Nonsense_Mutation	c.3073G>T	p.E1025*
AGS	Stomach	NIPBL	5	36984966	36984966	1	Missense_Mutation	c.1684G>A	p.D562N
AGS	Stomach	TRIM24	7	138252292	138252292	1	Missense_Mutation	c.1597C>T	p.P533S
AGS	Stomach	TRRAP	7	98592322	98592322	1	Missense_Mutation	c.10118A>G	p.K3373R
AGS	Stomach	KAT6A	8	41789763	41789763	-1	Missense_Mutation	c.5975T>C	p.V1992A
AGS	Stomach	ATRX	X	76909666	76909666	-1	Missense_Mutation	c.4239A>C	p.E1413D
ALEXANDERCELLS	Liver	CHD1	5	98194049	98194049	-1	Missense_Mutation	c.4622G>T	p.R1541M
ALEXANDERCELLS	Liver	TRRAP	7	98533278	98533278	1	Missense_Mutation	c.4091C>T	p.P1364L
ALLSIL	Haematopoietic and lymphoid tissue	MGA	15	42041738	42041738	1	Missense_Mutation	c.5933A>G	p.K1978R
ALLSIL	Haematopoietic and lymphoid tissue	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
ALLSIL	Haematopoietic and lymphoid tissue	TAF1L	9	32634031	32634031	-1	Missense_Mutation	c.1547C>A	p.P516H
AM38	Central nervous system	CHD5	1	6206431	6206431	-1	Missense_Mutation	c.1643T>C	p.M548T
AM38	Central nervous system	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
AML193	Haematopoietic and lymphoid tissue	EP400	12	132547088	132547093	1	In_Frame_Del	c.8176_8181delCAACAA	p.QQ2746del
AML193	Haematopoietic and lymphoid tissue	ZMYM2	13	20567258	20567258	1	Missense_Mutation	c.46C>A	p.P16T
AML193	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
AMO1	Haematopoietic and lymphoid tissue	MLLT10	10	22016809	22016809	1	Missense_Mutation	c.2063G>A	p.R688H
AMO1	Haematopoietic and lymphoid tissue	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
AMO1	Haematopoietic and lymphoid tissue	HDAC4	2	240098187	240098187	-1	Missense_Mutation	c.412C>T	p.R138C
AMO1	Haematopoietic and lymphoid tissue	TET2	4	106157485	106157485	1	Missense_Mutation	c.2449G>A	p.E817K
AN3CA	Endometrium	SETDB1	1	150936207	150936207	1	Missense_Mutation	c.3659G>A	p.R1220H
AN3CA	Endometrium	ARID1A	1	27105931	27105931	1	Frame_Shift_Del	c.5542_5542delG	p.G1848fs
AN3CA	Endometrium	PRDM16	1	3348661	3348661	1	Missense_Mutation	c.3653C>A	p.S1218Y
AN3CA	Endometrium	ERCC6	10	50701223	50701223	-1	Silent	c.1761G>A	p.T587T
AN3CA	Endometrium	HNF1A	12	121432117	121432118	1	Frame_Shift_Ins	c.864_865insC	p.G288fs
AN3CA	Endometrium	KDM5A	12	438011	438011	-1	Missense_Mutation	c.1958T>C	p.V653A
AN3CA	Endometrium	ING1	13	111367902	111367903	1	Frame_Shift_Ins	c.112_113insT	p.L38fs
AN3CA	Endometrium	CHD8	14	21869596	21869596	-1	Frame_Shift_Del	c.3302_3302delA	p.K1101fs
AN3CA	Endometrium	CREBBP	16	3817721	3817721	-1	Frame_Shift_Del	c.3250_3250delA	p.I1084fs
AN3CA	Endometrium	SMARCA4	19	11152179	11152179	1	Missense_Mutation	c.4463C>T	p.P1488L
AN3CA	Endometrium	HDAC4	2	239976501	239976501	-1	Missense_Mutation	c.3017A>G	p.Q1006R
AN3CA	Endometrium	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
AN3CA	Endometrium	DNMT3B	20	31389107	31389107	1	Missense_Mutation	c.2020G>A	p.E674K
AN3CA	Endometrium	LMNB1	5	126140539	126140539	1	Missense_Mutation	c.431C>T	p.S144L
AN3CA	Endometrium	NSD1	5	176638443	176638444	1	Frame_Shift_Del	c.3043_3044delTG	p.C1015fs
AN3CA	Endometrium	NIPBL	5	37020614	37020615	1	Frame_Shift_Ins	c.5064_5065insG	p.T1688fs
AN3CA	Endometrium	NIPBL	5	37052639	37052639	1	Missense_Mutation	c.7234T>C	p.S2412P
AN3CA	Endometrium	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
AN3CA	Endometrium	PHF3	6	64395352	64395352	1	Frame_Shift_Del	c.1729_1729delA	p.K577fs
AN3CA	Endometrium	IKZF1	7	50444257	50444257	1	Missense_Mutation	c.187A>G	p.S63G
AN3CA	Endometrium	TAF1L	9	32630221	32630221	-1	Missense_Mutation	c.5357T>C	p.F1786S
AN3CA	Endometrium	TAF1L	9	32633025	32633025	-1	Frame_Shift_Del	c.2553_2553delA	p.K851fs
ASPC1	Pancreas	KMT2A	11	118377223	118377223	1	Missense_Mutation	c.10616C>A	p.P3539H
ASPC1	Pancreas	CHD9	16	53337995	53337995	1	Missense_Mutation	c.6077C>T	p.S2026F
ASPC1	Pancreas	LMNB1	5	126146008	126146008	1	Missense_Mutation	c.779A>G	p.Y260C
AU565	Breast	MLLT10	10	22024150	22024150	1	Missense_Mutation	c.2989C>G	p.Q997E
AU565	Breast	SIRT1	10	69647274	69647274	1	Missense_Mutation	c.530C>T	p.T177I
AU565	Breast	KMT2C	7	151878785	151878785	-1	Missense_Mutation	c.6160C>G	p.Q2054E
BCP1	Haematopoietic and lymphoid tissue	MLLT10	10	22021936	22021936	1	Missense_Mutation	c.2375C>T	p.A792V
BCP1	Haematopoietic and lymphoid tissue	KAT6B	10	76744901	76744901	1	Missense_Mutation	c.2437G>A	p.D813N
BCP1	Haematopoietic and lymphoid tissue	KMT2A	11	118344011	118344011	1	Missense_Mutation	c.2137G>C	p.E713Q
BCP1	Haematopoietic and lymphoid tissue	CHD9	16	53190885	53190885	1	Missense_Mutation	c.884C>G	p.S295C
BCP1	Haematopoietic and lymphoid tissue	MLLT6	17	36872766	36872766	1	Missense_Mutation	c.1183G>A	p.E395K
BCP1	Haematopoietic and lymphoid tissue	TFPT	19	54610359	54610359	-1	Nonstop_Mutation	c.760T>G	p.*254G
BCP1	Haematopoietic and lymphoid tissue	WHSC1	4	1953864	1953864	1	Silent	c.2043C>G	p.L681L
BCP1	Haematopoietic and lymphoid tissue	NSD1	5	176720929	176720929	1	Missense_Mutation	c.6560G>C	p.R2187P
BCP1	Haematopoietic and lymphoid tissue	CHD1	5	98224804	98224804	-1	Missense_Mutation	c.2319C>G	p.F773L
BCP1	Haematopoietic and lymphoid tissue	TAF1L	9	32635013	32635013	-1	Missense_Mutation	c.565A>G	p.I189V
BCP1	Haematopoietic and lymphoid tissue	KDM6A	X	44894228	44894228	1	Missense_Mutation	c.617A>C	p.E206A
BDCM	Haematopoietic and lymphoid tissue	ARID1A	1	27059203	27059203	1	Missense_Mutation	c.1840T>G	p.S614A
BDCM	Haematopoietic and lymphoid tissue	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
BDCM	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
BECKER	Central nervous system	HDAC6	X	48678567	48678567	1	Missense_Mutation	c.2242C>A	p.P748T
BEN	Lung	BRDT	1	92467624	92467624	1	Nonsense_Mutation	c.2318C>G	p.S773*
BEN	Lung	SP140	2	231101922	231101922	1	Missense_Mutation	c.184C>T	p.P62S
BEN	Lung	NCOA3	20	46279861	46279866	1	In_Frame_Del	c.3787_3792delCAGCAA	p.QQ1275del
BFTC905	Urinary tract	KAT6B	10	76788267	76788267	1	Missense_Mutation	c.3685A>G	p.S1229G
BFTC905	Urinary tract	TRRAP	7	98548581	98548581	1	Missense_Mutation	c.5396C>T	p.P1799L
BFTC905	Urinary tract	TRRAP	7	98559082	98559082	1	Missense_Mutation	c.6667T>C	p.F2223L
BFTC905	Urinary tract	ATRX	X	76938923	76938923	-1	Missense_Mutation	c.1825C>G	p.P609A
BFTC909	Kidney	CHD9	16	53321898	53321898	1	Missense_Mutation	c.5219C>T	p.A1740V
BHY	Upper aerodigestive tract	TRIM33	1	114949567	114949567	-1	Missense_Mutation	c.2414G>A	p.C805Y
BHY	Upper aerodigestive tract	KAT6B	10	76788645	76788647	1	In_Frame_Del	c.4063_4065delGAG	p.E1368del
BICR16	Upper aerodigestive tract	KAT6A	8	41832242	41832242	-1	Missense_Mutation	c.1462A>G	p.I488V
BICR18	Upper aerodigestive tract	TRIM33	1	114940395	114940395	-1	Missense_Mutation	c.3259G>A	p.A1087T
BICR18	Upper aerodigestive tract	TRIM33	1	114940464	114940464	-1	Missense_Mutation	c.3190C>A	p.Q1064K
BICR18	Upper aerodigestive tract	TRIM33	1	114970505	114970505	-1	Silent	c.1167G>A	p.K389K
BICR18	Upper aerodigestive tract	TRIM33	1	114973432	114973432	-1	Silent	c.1143A>G	p.L381L
BICR18	Upper aerodigestive tract	TRIM33	1	114973477	114973477	-1	Silent	c.1098T>C	p.I366I
BICR18	Upper aerodigestive tract	TRIM33	1	114973504	114973504	-1	Silent	c.1071A>T	p.R357R
BICR18	Upper aerodigestive tract	TRIM33	1	115006140	115006140	-1	Silent	c.684C>T	p.G228G
BICR18	Upper aerodigestive tract	TRIM33	1	115006158	115006158	-1	Silent	c.666C>T	p.D222D
BICR18	Upper aerodigestive tract	ARID1A	1	27099396	27099396	1	Silent	c.3633T>C	p.Y1211Y
BICR18	Upper aerodigestive tract	ARID1A	1	27101164	27101164	1	Silent	c.4446C>T	p.G1482G
BICR18	Upper aerodigestive tract	ARID1A	1	27101167	27101167	1	Silent	c.4449C>G	p.G1483G
BICR18	Upper aerodigestive tract	ARID1A	1	27101200	27101200	1	Silent	c.4482A>G	p.Q1494Q
BICR18	Upper aerodigestive tract	ARID1A	1	27101236	27101236	1	Silent	c.4518T>C	p.Y1506Y
BICR18	Upper aerodigestive tract	ARID1A	1	27101454	27101454	1	Missense_Mutation	c.4736A>C	p.Q1579P
BICR18	Upper aerodigestive tract	ARID1A	1	27106518	27106519	1	Missense_Mutation	c.6129_6130CA>TG	p.N2044D
BICR18	Upper aerodigestive tract	HDAC1	1	32768253	32768253	1	Silent	c.81C>G	p.G27G
BICR18	Upper aerodigestive tract	HDAC1	1	32768259	32768259	1	Silent	c.87A>C	p.P29P
BICR18	Upper aerodigestive tract	MLLT10	10	21884267	21884267	1	Silent	c.303C>T	p.A101A
BICR18	Upper aerodigestive tract	MLLT10	10	21884285	21884285	1	Silent	c.321G>C	p.L107L
BICR18	Upper aerodigestive tract	MLLT10	10	21901304	21901304	1	Silent	c.433A>C	p.R145R
BICR18	Upper aerodigestive tract	MLLT10	10	21906076	21906076	1	Missense_Mutation	c.639T>G	p.D213E
BICR18	Upper aerodigestive tract	MLLT10	10	21906091	21906091	1	Silent	c.654T>C	p.D218D
BICR18	Upper aerodigestive tract	MLLT10	10	21906115	21906115	1	Silent	c.678A>G	p.K226K
BICR18	Upper aerodigestive tract	MLLT10	10	21959404	21959404	1	Silent	c.822T>C	p.S274S
BICR18	Upper aerodigestive tract	MLLT10	10	21959479	21959479	1	Silent	c.897A>C	p.A299A
BICR18	Upper aerodigestive tract	MLLT10	10	21959482	21959482	1	Silent	c.900C>T	p.H300H
BICR18	Upper aerodigestive tract	MLLT10	10	21959572	21959572	1	Silent	c.990A>G	p.R330R
BICR18	Upper aerodigestive tract	COMMD3-BMI1	10	22615363	22615363	1	Silent	c.414T>C	p.I138I
BICR18	Upper aerodigestive tract	ERCC6	10	50708598	50708598	-1	Silent	c.1671T>C	p.R557R
BICR18	Upper aerodigestive tract	ERCC6	10	50708673	50708673	-1	Silent	c.1596T>C	p.D532D
BICR18	Upper aerodigestive tract	KAT6B	10	76735186	76735186	1	Missense_Mutation	c.1091A>G	p.N364S
BICR18	Upper aerodigestive tract	KAT6B	10	76735236	76735236	1	Missense_Mutation	c.1141T>A	p.C381S
BICR18	Upper aerodigestive tract	KAT6B	10	76735275	76735275	1	Missense_Mutation	c.1180G>C	p.D394H
BICR18	Upper aerodigestive tract	KAT6B	10	76735341	76735341	1	Missense_Mutation	c.1246A>T	p.T416S
BICR18	Upper aerodigestive tract	KAT6B	10	76790713	76790713	1	Missense_Mutation	c.6131G>C	p.G2044A
BICR18	Upper aerodigestive tract	KMT2A	11	118339498	118339498	1	Silent	c.441A>G	p.Q147Q
BICR18	Upper aerodigestive tract	KMT2A	11	118339540	118339540	1	Silent	c.483T>C	p.S161S
BICR18	Upper aerodigestive tract	KMT2A	11	118339546	118339546	1	Silent	c.489A>C	p.T163T
BICR18	Upper aerodigestive tract	KDM5A	12	394762	394763	-1	Missense_Mutation	c.4932_4933TC>CG	p.P1645A
BICR18	Upper aerodigestive tract	ZMYM2	13	20600820	20600820	1	Silent	c.1653T>C	p.C551C
BICR18	Upper aerodigestive tract	ZMYM2	13	20600865	20600865	1	Silent	c.1698T>C	p.C566C
BICR18	Upper aerodigestive tract	ZMYM2	13	20601422	20601422	1	Silent	c.1815C>T	p.Y605Y
BICR18	Upper aerodigestive tract	CHD8	14	21859762	21859762	-1	Missense_Mutation	c.6088G>C	p.V2030L
BICR18	Upper aerodigestive tract	CHD8	14	21897368	21897368	-1	Silent	c.133C>T	p.L45L
BICR18	Upper aerodigestive tract	CHD8	14	21897375	21897375	-1	Silent	c.126G>A	p.L42L
BICR18	Upper aerodigestive tract	CHD8	14	21897419	21897419	-1	Silent	c.82C>T	p.L28L
BICR18	Upper aerodigestive tract	CHD9	16	53269180	53269180	1	Silent	c.2595G>A	p.L865L
BICR18	Upper aerodigestive tract	KAT7	17	47869250	47869250	1	Splice_Region	c.18G>A	p.R6R
BICR18	Upper aerodigestive tract	KAT7	17	47869310	47869310	1	Silent	c.78C>T	p.H26H
BICR18	Upper aerodigestive tract	KAT7	17	47875715	47875715	1	Silent	c.375G>A	p.P125P
BICR18	Upper aerodigestive tract	KAT7	17	47875730	47875730	1	Silent	c.390T>C	p.T130T
BICR18	Upper aerodigestive tract	KAT7	17	47875739	47875739	1	Silent	c.399G>A	p.A133A
BICR18	Upper aerodigestive tract	KAT7	17	47875778	47875778	1	Silent	c.438T>C	p.N146N
BICR18	Upper aerodigestive tract	KAT7	17	47875781	47875781	1	Silent	c.441A>G	p.V147V
BICR18	Upper aerodigestive tract	KAT7	17	47875787	47875787	1	Silent	c.447C>T	p.H149H
BICR18	Upper aerodigestive tract	KAT7	17	47895196	47895196	1	Silent	c.978G>T	p.L326L
BICR18	Upper aerodigestive tract	ATF2	2	175979483	175979483	-1	Silent	c.561G>A	p.Q187Q
BICR18	Upper aerodigestive tract	ATF2	2	175979486	175979486	-1	Silent	c.558G>A	p.Q186Q
BICR18	Upper aerodigestive tract	ATF2	2	175979516	175979516	-1	Silent	c.528T>C	p.L176L
BICR18	Upper aerodigestive tract	ATF2	2	175979555	175979555	-1	Silent	c.489T>C	p.I163I
BICR18	Upper aerodigestive tract	ATF2	2	175982760	175982760	-1	Silent	c.405T>C	p.D135D
BICR18	Upper aerodigestive tract	ATF2	2	175982814	175982814	-1	Silent	c.351T>C	p.P117P
BICR18	Upper aerodigestive tract	ATF2	2	175982832	175982832	-1	Silent	c.333A>G	p.L111L
BICR18	Upper aerodigestive tract	NCOA1	2	24991098	24991098	1	Silent	c.4164A>G	p.Q1388Q
BICR18	Upper aerodigestive tract	SMARCB1	22	24133957	24133957	1	Silent	c.108C>G	p.L36L
BICR18	Upper aerodigestive tract	WHSC1	4	1957836	1957836	1	Silent	c.2802G>A	p.A934A
BICR18	Upper aerodigestive tract	LMNB1	5	126141337	126141337	1	Silent	c.591T>C	p.R197R
BICR18	Upper aerodigestive tract	NIPBL	5	37064739	37064739	1	Silent	c.8160T>C	p.D2720D
BICR18	Upper aerodigestive tract	NIPBL	5	37064748	37064748	1	Silent	c.8169A>G	p.Q2723Q
BICR18	Upper aerodigestive tract	JARID2	6	15452270	15452270	1	Silent	c.357G>A	p.Q119Q
BICR18	Upper aerodigestive tract	JARID2	6	15452381	15452381	1	Silent	c.468T>C	p.D156D
BICR18	Upper aerodigestive tract	KMT2C	7	151833944	151833944	-1	Silent	c.14709T>G	p.A4903A
BICR18	Upper aerodigestive tract	WHSC1L1	8	38139045	38139045	-1	Missense_Mutation	c.3558G>C	p.L1186F
BICR18	Upper aerodigestive tract	KDM6A	X	44820543	44820543	1	Silent	c.240T>C	p.Y80Y
BICR18	Upper aerodigestive tract	KDM6A	X	44820570	44820570	1	Silent	c.267A>G	p.G89G
BICR18	Upper aerodigestive tract	KDM6A	X	44922835	44922835	1	Missense_Mutation	c.1852C>A	p.P618T
BICR18	Upper aerodigestive tract	HDAC8	X	71715100	71715100	-1	Silent	c.456T>C	p.F152F
BICR18	Upper aerodigestive tract	ATRX	X	76949332	76949332	-1	Missense_Mutation	c.465A>C	p.E155D
BICR18	Upper aerodigestive tract	ATRX	X	76949337	76949337	-1	Missense_Mutation	c.460A>G	p.T154A
BICR18	Upper aerodigestive tract	ATRX	X	76949410	76949410	-1	Silent	c.387G>A	p.Q129Q
BICR31	Upper aerodigestive tract	NCOA3	20	46267940	46267940	1	Missense_Mutation	c.2701A>C	p.S901R
BICR31	Upper aerodigestive tract	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
BICR56	Upper aerodigestive tract	ARID1A	1	27107035	27107035	1	Missense_Mutation	c.6646C>T	p.L2216F
BICR56	Upper aerodigestive tract	CREBBP	16	3779266	3779266	-1	Missense_Mutation	c.5782C>G	p.Q1928E
BICR56	Upper aerodigestive tract	CREBBP	16	3779766	3779766	-1	Nonsense_Mutation	c.5282C>G	p.S1761*
BICR56	Upper aerodigestive tract	NCOA1	2	24930003	24930003	1	Missense_Mutation	c.1664C>G	p.S555C
BICR56	Upper aerodigestive tract	STK31	7	23825148	23825148	1	Missense_Mutation	c.2200G>A	p.E734K
BICR56	Upper aerodigestive tract	ATRX	X	76938713	76938713	-1	Missense_Mutation	c.2035G>A	p.E679K
BICR6	Upper aerodigestive tract	TFPT	19	54610461	54610461	-1	Missense_Mutation	c.658G>A	p.D220N
BICR6	Upper aerodigestive tract	KDM6A	X	44928924	44928924	1	Missense_Mutation	c.2180G>A	p.G727D
BL41	Haematopoietic and lymphoid tissue	ARID1A	1	27101662	27101663	1	Frame_Shift_Ins	c.4944_4945insA	p.A1648fs
BL41	Haematopoietic and lymphoid tissue	ERCC6	10	50732547	50732547	-1	Frame_Shift_Del	c.929_929delA	p.N310fs
BL41	Haematopoietic and lymphoid tissue	TET1	10	70450669	70450669	1	Missense_Mutation	c.5509G>T	p.A1837S
BL70	Haematopoietic and lymphoid tissue	KMT2C	7	151873490	151873490	-1	Missense_Mutation	c.9048A>C	p.Q3016H
BT20	Breast	KAT6B	10	76781837	76781848	1	In_Frame_Del	c.3220_3231delGAGGAGGAGGAC	p.EEED1074del
BT20	Breast	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
BT20	Breast	NSD1	5	176637954	176637954	1	Missense_Mutation	c.2554A>T	p.I852L
BT474	Breast	CHD5	1	6196675	6196675	-1	Nonsense_Mutation	c.2598C>G	p.Y866*
BT474	Breast	BRDT	1	92445267	92445267	1	Missense_Mutation	c.1252G>A	p.D418N
BT474	Breast	ERCC6	10	50732376	50732376	-1	Missense_Mutation	c.1100C>G	p.S367C
BT474	Breast	KMT2A	11	118365018	118365018	1	Missense_Mutation	c.5194G>A	p.D1732N
BT474	Breast	HNF1A	12	121435450	121435450	1	Nonsense_Mutation	c.1483C>T	p.Q495*
BT474	Breast	MGA	15	42041743	42041743	1	Missense_Mutation	c.5938G>A	p.E1980K
BT474	Breast	NSD1	5	176684147	176684147	1	Missense_Mutation	c.4961C>G	p.S1654C
BT474	Breast	NSD1	5	176715855	176715855	1	Missense_Mutation	c.6187C>G	p.L2063V
BT474	Breast	NIPBL	5	37006526	37006526	1	Missense_Mutation	c.3923C>T	p.A1308V
BT483	Breast	SETDB1	1	150902484	150902484	1	Missense_Mutation	c.302C>G	p.S101C
BT483	Breast	EP400	12	132547088	132547093	1	In_Frame_Del	c.8176_8181delCAACAA	p.QQ2746del
BT483	Breast	TP53BP1	15	43738627	43738627	-1	Missense_Mutation	c.2998G>C	p.E1000Q
BT483	Breast	CHD9	16	53308207	53308207	1	Missense_Mutation	c.4960G>C	p.D1654H
BT483	Breast	TRRAP	7	98608810	98608810	1	Missense_Mutation	c.11032C>G	p.L3678V
BT483	Breast	SMARCA2	9	2039777	2039791	1	In_Frame_Del	c.667_681delCAGCAGCAGCAGCAG	p.QQQQQ233del
BT549	Breast	NCOA4	10	51584821	51584821	1	Missense_Mutation	c.968C>T	p.T323I
BT549	Breast	LMNB1	5	126145987	126145987	1	Missense_Mutation	c.758A>G	p.H253R
BV173	Haematopoietic and lymphoid tissue	CREBBP	16	3781794	3781794	-1	Missense_Mutation	c.4873A>T	p.M1625L
BV173	Haematopoietic and lymphoid tissue	CHD9	16	53358056	53358056	1	Missense_Mutation	c.7943C>T	p.A2648V
BXPC3	Pancreas	ERCC6	10	50732212	50732212	-1	Missense_Mutation	c.1264A>T	p.I422F
BXPC3	Pancreas	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
BXPC3	Pancreas	EP300	22	41525914	41525914	1	Nonsense_Mutation	c.1189C>T	p.R397*
BXPC3	Pancreas	JARID2	6	15487585	15487585	1	Missense_Mutation	c.718A>G	p.K240E
C2BBE1	Large intestine	WHSC1	4	1940181	1940181	1	Missense_Mutation	c.1678G>C	p.D560H
C2BBE1	Large intestine	KMT2C	7	151874802	151874802	-1	Missense_Mutation	c.7736G>A	p.G2579D
C32	Skin	KMT2A	11	118392112	118392112	1	Missense_Mutation	c.11623G>A	p.E3875K
C32	Skin	KAT7	17	47899068	47899068	1	Missense_Mutation	c.1302A>T	p.L434F
C32	Skin	STK31	7	23823257	23823257	1	Missense_Mutation	c.2123C>T	p.P708L
C3A	Liver	NIPBL	5	37057297	37057297	1	Missense_Mutation	c.7273G>A	p.V2425M
CA46	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CADOES1	Bone	HDAC4	2	239976487	239976487	-1	Missense_Mutation	c.3031G>A	p.A1011T
CADOES1	Bone	NCOA2	8	71069365	71069365	-1	Missense_Mutation	c.1235A>C	p.N412T
CAKI1	Kidney	TET1	10	70426807	70426807	1	Frame_Shift_Del	c.4467_4467delA	p.L1489fs
CAKI1	Kidney	KMT2C	7	151932996	151932996	-1	Missense_Mutation	c.2675G>A	p.G892E
CAKI2	Kidney	MSH6	2	48026201	48026201	1	Missense_Mutation	c.1079G>T	p.S360I
CAKI2	Kidney	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CAKI2	Kidney	NIPBL	5	37006495	37006495	1	Missense_Mutation	c.3892G>A	p.D1298N
CAKI2	Kidney	STK31	7	23810729	23810729	1	Nonsense_Mutation	c.1819A>T	p.K607*
CAL120	Breast	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
CAL120	Breast	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CAL120	Breast	DAXX	6	33289532	33289532	-1	Silent	c.207A>G	p.K69K
CAL120	Breast	KDM6A	X	44929343	44929343	1	Missense_Mutation	c.2599G>T	p.V867F
CAL12T	Lung	ERCC6	10	50740688	50740688	-1	Missense_Mutation	c.323G>C	p.G108A
CAL12T	Lung	ERCC6	10	50740784	50740784	-1	Missense_Mutation	c.227A>T	p.D76V
CAL12T	Lung	KMT2A	11	118392673	118392673	1	Missense_Mutation	c.11705G>T	p.G3902V
CAL12T	Lung	SMARCA4	19	11144114	11144114	1	Missense_Mutation	c.3695G>A	p.G1232D
CAL12T	Lung	HDAC4	2	240036970	240036970	-1	Nonsense_Mutation	c.1555G>T	p.E519*
CAL12T	Lung	WHSC1L1	8	38157060	38157060	-1	Missense_Mutation	c.2660A>G	p.Y887C
CAL148	Breast	BMI1	10	22616947	22616947	1	Missense_Mutation	c.814G>C	p.E272Q
CAL148	Breast	TP53BP1	15	43748849	43748849	-1	Missense_Mutation	c.1957A>G	p.M653V
CAL148	Breast	SMARCA4	19	11129645	11129645	1	Missense_Mutation	c.2451C>G	p.N817K
CAL148	Breast	BRD4	19	15383805	15383805	-1	Nonsense_Mutation	c.106C>T	p.Q36*
CAL148	Breast	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CAL148	Breast	TRIM24	7	138268662	138268662	1	Missense_Mutation	c.2861A>G	p.E954G
CAL27	Upper aerodigestive tract	CREBBP	16	3777879	3777879	-1	Missense_Mutation	c.7169C>A	p.T2390N
CAL27	Upper aerodigestive tract	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
CAL27	Upper aerodigestive tract	SUZ12	17	30325688	30325688	1	Missense_Mutation	c.1886A>T	p.D629V
CAL27	Upper aerodigestive tract	KDM6A	X	44942724	44942724	1	Missense_Mutation	c.3460G>A	p.E1154K
CAL27	Upper aerodigestive tract	ATRX	X	76939219	76939219	-1	Missense_Mutation	c.1529C>T	p.S510F
CAL29	Urinary tract	ERCC6	10	50684278	50684278	-1	Missense_Mutation	c.2365C>G	p.L789V
CAL29	Urinary tract	KAT6B	10	76790131	76790131	1	Missense_Mutation	c.5549C>T	p.S1850F
CAL29	Urinary tract	NSD1	5	176707611	176707611	1	Missense_Mutation	c.5668T>C	p.S1890P
CAL29	Urinary tract	KMT2C	7	151891543	151891543	-1	Missense_Mutation	c.4489G>C	p.D1497H
CAL29	Urinary tract	KMT2C	7	151900059	151900059	-1	Missense_Mutation	c.4052G>T	p.R1351M
CAL29	Urinary tract	TAF1L	9	32634836	32634836	-1	Missense_Mutation	c.742G>A	p.E248K
CAL29	Urinary tract	KDM6A	X	44942724	44942724	1	Missense_Mutation	c.3460G>A	p.E1154K
CAL33	Upper aerodigestive tract	MLLT10	10	22016857	22016857	1	Frame_Shift_Del	c.2111_2111delG	p.R704fs
CAL33	Upper aerodigestive tract	KMT2A	11	118352653	118352653	1	Silent	c.3858C>T	p.A1286A
CAL33	Upper aerodigestive tract	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CAL51	Breast	ARID1A	1	27099947	27099947	1	Nonsense_Mutation	c.3826C>T	p.R1276*
CAL51	Breast	ARID1A	1	27105931	27105931	1	Frame_Shift_Del	c.5542_5542delG	p.G1848fs
CAL51	Breast	PRDM16	1	3329348	3329348	1	Missense_Mutation	c.2587A>G	p.M863V
CAL51	Breast	BMI1	10	22618193	22618193	1	Missense_Mutation	c.1132A>G	p.K378E
CAL51	Breast	KAT6B	10	76788304	76788304	1	Missense_Mutation	c.3722C>A	p.P1241H
CAL51	Breast	CHD8	14	21859633	21859633	-1	Frame_Shift_Del	c.6217_6217delC	p.R2073fs
CAL51	Breast	HDAC4	2	240011806	240011806	-1	Missense_Mutation	c.2272A>G	p.S758G
CAL51	Breast	NSD1	5	176638344	176638344	1	Frame_Shift_Del	c.2944_2944delG	p.G982fs
CAL51	Breast	NSD1	5	176720964	176720964	1	Missense_Mutation	c.6595C>T	p.R2199C
CAL51	Breast	TAF1	X	70597654	70597654	1	Missense_Mutation	c.976T>C	p.C326R
CAL51	Breast	TAF1	X	70612803	70612803	1	Missense_Mutation	c.3070G>A	p.A1024T
CAL54	Kidney	SMARCA4	19	11144113	11144113	1	Missense_Mutation	c.3694G>A	p.G1232S
CAL54	Kidney	TRIM28	19	59059061	59059061	1	Missense_Mutation	c.820A>G	p.T274A
CAL54	Kidney	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CAL54	Kidney	KMT2C	7	151860283	151860283	-1	Missense_Mutation	c.10379G>T	p.C3460F
CAL54	Kidney	ASH2L	8	37978523	37978523	1	Missense_Mutation	c.1021T>C	p.Y341H
CAL62	Thyroid	MLLT10	10	21940644	21940644	1	Nonsense_Mutation	c.742C>T	p.Q248*
CAL62	Thyroid	MGA	15	42003059	42003059	1	Nonsense_Mutation	c.2596C>T	p.R866*
CAL62	Thyroid	CREBBP	16	3786144	3786144	-1	Nonsense_Mutation	c.4621G>T	p.E1541*
CAL62	Thyroid	EP300	22	41568504	41568504	1	Frame_Shift_Del	c.4454_4454delA	p.D1485fs
CAL78	Bone	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CALU1	Lung	HNF1A	12	121426790	121426790	1	Missense_Mutation	c.481G>A	p.A161T
CALU1	Lung	KAT7	17	47875810	47875810	1	Missense_Mutation	c.470T>C	p.M157T
CALU1	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CALU1	Lung	TAF1L	9	32630469	32630469	-1	Missense_Mutation	c.5109G>C	p.Q1703H
CALU3	Lung	KAT6A	8	41790070	41790070	-1	Missense_Mutation	c.5668G>T	p.A1890S
CALU3	Lung	NCOA2	8	71039244	71039244	-1	Missense_Mutation	c.3720G>T	p.R1240S
CALU6	Lung	DNMT1	19	10250731	10250731	-1	Missense_Mutation	c.3797C>T	p.S1266F
CALU6	Lung	NCOA1	2	24949571	24949571	1	Missense_Mutation	c.2713G>A	p.E905K
CALU6	Lung	BAP1	3	52437626	52437626	-1	Missense_Mutation	c.1535G>T	p.R512L
CAMA1	Breast	ERCC6	10	50667228	50667228	-1	Missense_Mutation	c.4115G>A	p.G1372E
CAMA1	Breast	BRD4	19	15355093	15355093	-1	Missense_Mutation	c.2530G>C	p.E844Q
CAMA1	Breast	SP140	2	231155181	231155181	1	Missense_Mutation	c.1727G>A	p.R576K
CAMA1	Breast	EP300	22	41565521	41565521	1	Missense_Mutation	c.4187C>G	p.S1396C
CAMA1	Breast	KAT6A	8	41790562	41790562	-1	Missense_Mutation	c.5176A>C	p.T1726P
CAPAN1	Pancreas	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
CAPAN1	Pancreas	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CAPAN1	Pancreas	IKZF1	7	50468261	50468262	1	Missense_Mutation	c.1496_1497GC>CT	p.S499T
CAPAN2	Pancreas	ZMYND8	20	45867566	45867567	-1	In_Frame_Ins	c.2621_2622insGCA	p.874_874Q>QQ
CAS1	Central nervous system	KAT6B	10	76781905	76781906	1	In_Frame_Ins	c.3288_3289insGAA	p.1104_1105insE
CAS1	Central nervous system	SET	9	131456053	131456053	1	Missense_Mutation	c.668A>T	p.D223V
CCFSTTG1	Central nervous system	ARID1A	1	27099014	27099014	1	Missense_Mutation	c.3430C>A	p.P1144T
CCFSTTG1	Central nervous system	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CCK81	Large intestine	TRIM33	1	115053195	115053195	-1	Frame_Shift_Del	c.503_503delG	p.G168fs
CCK81	Large intestine	LMNA	1	156084890	156084890	1	Missense_Mutation	c.181C>A	p.L61I
CCK81	Large intestine	MLLT10	10	22021981	22021981	1	Missense_Mutation	c.2420C>T	p.P807L
CCK81	Large intestine	ERCC6	10	50678332	50678332	-1	Missense_Mutation	c.3674T>C	p.L1225P
CCK81	Large intestine	ERCC6	10	50732085	50732085	-1	Missense_Mutation	c.1391G>A	p.R464Q
CCK81	Large intestine	ERCC6	10	50736555	50736555	-1	Frame_Shift_Del	c.560_560delA	p.K187fs
CCK81	Large intestine	KMT2A	11	118392010	118392010	1	Missense_Mutation	c.11521A>G	p.I3841V
CCK81	Large intestine	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
CCK81	Large intestine	ZMYM2	13	20657094	20657094	1	Frame_Shift_Del	c.3742_3742delA	p.K1248fs
CCK81	Large intestine	CREBBP	16	3832813	3832813	-1	Missense_Mutation	c.1445A>G	p.Q482R
CCK81	Large intestine	CREBBP	16	3929878	3929878	-1	Frame_Shift_Del	c.40_40delA	p.R14fs
CCK81	Large intestine	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
CCK81	Large intestine	BAP1	3	52439792	52439792	-1	Missense_Mutation	c.920G>A	p.G307D
CCK81	Large intestine	TET2	4	106157182	106157182	1	Missense_Mutation	c.2146A>G	p.M716V
CCK81	Large intestine	NSD1	5	176637828	176637828	1	Missense_Mutation	c.2428T>C	p.C810R
CCK81	Large intestine	PHF3	6	64394982	64394987	1	In_Frame_Del	c.1359_1364delTATAGA	p.IE454del
CCK81	Large intestine	KMT2C	7	151945442	151945442	-1	Missense_Mutation	c.2077A>G	p.T693A
CCK81	Large intestine	KAT6A	8	41836178	41836178	-1	Missense_Mutation	c.1025T>C	p.L342S
CCK81	Large intestine	NCOA2	8	71039246	71039246	-1	Missense_Mutation	c.3718A>G	p.R1240G
CCK81	Large intestine	TAF1L	9	32633025	32633025	-1	Frame_Shift_Del	c.2553_2553delA	p.K851fs
CCK81	Large intestine	TAF1L	9	32634836	32634836	-1	Missense_Mutation	c.742G>A	p.E248K
CCK81	Large intestine	HDAC6	X	48663889	48663889	1	Missense_Mutation	c.356T>C	p.L119P
CCK81	Large intestine	ATRX	X	76764047	76764047	-1	Nonsense_Mutation	c.7261C>T	p.Q2421*
CCK81	Large intestine	ATRX	X	76778824	76778824	-1	Missense_Mutation	c.6755A>G	p.H2252R
CFPAC1	Pancreas	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
CFPAC1	Pancreas	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
CFPAC1	Pancreas	NCOA2	8	71050534	71050534	-1	Missense_Mutation	c.3062C>T	p.P1021L
CGTHW1	Thyroid	CHD9	16	53358095	53358095	1	Missense_Mutation	c.7982A>G	p.N2661S
CGTHW1	Thyroid	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CGTHW1	Thyroid	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
CGTHW1	Thyroid	PHF3	6	64422589	64422589	1	Missense_Mutation	c.5105G>A	p.C1702Y
CHAGOK1	Lung	ARID1A	1	27087476	27087476	1	Missense_Mutation	c.2050C>G	p.H684D
CHL1	Skin	MEN1	11	64571843	64571843	-1	Missense_Mutation	c.1811C>T	p.T604I
CHL1	Skin	ZMYM2	13	20625598	20625598	1	Missense_Mutation	c.2318C>T	p.S773F
CHL1	Skin	CREBBP	16	3824634	3824634	-1	Missense_Mutation	c.2219G>A	p.G740E
CHL1	Skin	MSH6	2	48032823	48032823	1	Missense_Mutation	c.3623C>T	p.S1208F
CHL1	Skin	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
CHL1	Skin	NCOA3	20	46264731	46264731	1	Missense_Mutation	c.1601G>A	p.G534E
CHL1	Skin	PHF3	6	64423260	64423260	1	Missense_Mutation	c.5776G>T	p.D1926Y
CHL1	Skin	KMT2C	7	151859288	151859288	-1	Nonsense_Mutation	c.11374C>T	p.Q3792*
CHL1	Skin	TAF1	X	70587415	70587415	1	Missense_Mutation	c.247G>A	p.A83T
CHP212	Autonomic ganglia	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
CI1	Haematopoietic and lymphoid tissue	KMT2A	11	118344260	118344260	1	Missense_Mutation	c.2386T>G	p.F796V
CI1	Haematopoietic and lymphoid tissue	TP53BP1	15	43724520	43724520	-1	Missense_Mutation	c.3547T>A	p.C1183S
CI1	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
CI1	Haematopoietic and lymphoid tissue	TET2	4	106158503	106158503	1	Missense_Mutation	c.3467G>A	p.C1156Y
CJM	Skin	ERCC6	10	50686482	50686482	-1	Missense_Mutation	c.2204G>T	p.R735L
CJM	Skin	ARID1B	6	157100024	157100026	1	In_Frame_Del	c.787_789delGGA	p.G270del
CJM	Skin	KAT6A	8	41792190	41792190	-1	Missense_Mutation	c.3548C>G	p.S1183C
CJM	Skin	NCOA2	8	71128938	71128938	-1	Missense_Mutation	c.43G>A	p.E15K
CL14	Large intestine	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
CL14	Large intestine	CHD9	16	53190096	53190096	1	Missense_Mutation	c.95C>T	p.P32L
CL14	Large intestine	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
CL14	Large intestine	CHD1	5	98215311	98215311	-1	Missense_Mutation	c.3182A>G	p.Q1061R
CL14	Large intestine	WHSC1L1	8	38133960	38133961	-1	Frame_Shift_Ins	c.3925_3926insAAGA	p.R1309fs
CL34	Large intestine	HDAC1	1	32797794	32797794	1	Missense_Mutation	c.1323G>T	p.K441N
CL34	Large intestine	TET1	10	70432758	70432758	1	Missense_Mutation	c.4780C>T	p.P1594S
CL34	Large intestine	HNF1A	12	121434094	121434094	1	Missense_Mutation	c.985G>C	p.E329Q
CL34	Large intestine	TP53BP1	15	43749408	43749408	-1	Frame_Shift_Del	c.1398_1398delT	p.F466fs
CL34	Large intestine	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CL34	Large intestine	BAG6	6	31612923	31612923	-1	Frame_Shift_Del	c.1187_1187delC	p.P396fs
CL34	Large intestine	KMT2C	7	151855979	151855979	-1	Missense_Mutation	c.11639C>A	p.S3880Y
CL34	Large intestine	TAF1	X	70643034	70643034	1	Missense_Mutation	c.4580C>T	p.A1527V
CL34	Large intestine	ATRX	X	76909629	76909629	-1	Nonsense_Mutation	c.4276C>T	p.R1426*
CL40	Large intestine	PRDM16	1	3342623	3342623	1	Missense_Mutation	c.3118C>A	p.H1040N
CL40	Large intestine	DNMT3B	20	31386409	31386409	1	Missense_Mutation	c.1634G>A	p.R545H
CL40	Large intestine	NCOA2	8	71040719	71040719	-1	Missense_Mutation	c.3630C>G	p.I1210M
CMK115	Haematopoietic and lymphoid tissue	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
CMK115	Haematopoietic and lymphoid tissue	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
CMK	Haematopoietic and lymphoid tissue	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
CMK	Haematopoietic and lymphoid tissue	ASH2L	8	37963121	37963121	1	Missense_Mutation	c.53C>T	p.P18L
CMLT1	Haematopoietic and lymphoid tissue	SETDB1	1	150921732	150921733	1	Frame_Shift_Ins	c.1402_1403insC	p.S468fs
CMLT1	Haematopoietic and lymphoid tissue	ARID1A	1	27105923	27105923	1	Missense_Mutation	c.5534G>A	p.R1845Q
CMLT1	Haematopoietic and lymphoid tissue	HDAC1	1	32796437	32796437	1	Missense_Mutation	c.907T>C	p.Y303H
CMLT1	Haematopoietic and lymphoid tissue	ERCC6	10	50666913	50666913	-1	Missense_Mutation	c.4430A>G	p.H1477R
CMLT1	Haematopoietic and lymphoid tissue	TET1	10	70451287	70451287	1	Missense_Mutation	c.6127C>T	p.R2043C
CMLT1	Haematopoietic and lymphoid tissue	KMT2A	11	118343805	118343805	1	Missense_Mutation	c.1931G>A	p.R644H
CMLT1	Haematopoietic and lymphoid tissue	KDM5A	12	404894	404894	-1	Missense_Mutation	c.4300G>A	p.V1434M
CMLT1	Haematopoietic and lymphoid tissue	TP53BP1	15	43748661	43748661	-1	Frame_Shift_Del	c.2145_2145delA	p.K715fs
CMLT1	Haematopoietic and lymphoid tissue	CREBBP	16	3830743	3830743	-1	Missense_Mutation	c.1813G>A	p.V605M
CMLT1	Haematopoietic and lymphoid tissue	CHD9	16	53289675	53289675	1	Missense_Mutation	c.4193G>T	p.G1398V
CMLT1	Haematopoietic and lymphoid tissue	SMARCA4	19	11170478	11170478	1	Missense_Mutation	c.4781A>G	p.Q1594R
CMLT1	Haematopoietic and lymphoid tissue	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
CMLT1	Haematopoietic and lymphoid tissue	TRRAP	7	98574140	98574140	1	Missense_Mutation	c.7973G>A	p.S2658N
CMLT1	Haematopoietic and lymphoid tissue	NCOA2	8	71126156	71126156	-1	Missense_Mutation	c.241C>T	p.R81C
COLO201	Large intestine	SETDB1	1	150915450	150915450	1	Missense_Mutation	c.796G>A	p.A266T
COLO201	Large intestine	DNMT3B	20	31393148	31393148	1	Missense_Mutation	c.2236G>A	p.V746M
COLO205	Large intestine	SETDB1	1	150915450	150915450	1	Missense_Mutation	c.796G>A	p.A266T
COLO205	Large intestine	DNMT3B	20	31393148	31393148	1	Missense_Mutation	c.2236G>A	p.V746M
COLO668	Lung	CHD9	16	53283946	53283946	1	Missense_Mutation	c.3829G>T	p.D1277Y
COLO668	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
COLO668	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
COLO668	Lung	KMT2C	7	151932945	151932945	-1	Missense_Mutation	c.2726G>T	p.R909M
COLO668	Lung	TAF1L	9	32632961	32632961	-1	Missense_Mutation	c.2617C>T	p.R873C
COLO668	Lung	KDM6A	X	44937658	44937658	1	Missense_Mutation	c.3002G>T	p.R1001L
COLO679	Skin	SP140	2	231155250	231155250	1	Missense_Mutation	c.1796G>A	p.G599E
COLO679	Skin	PHF3	6	64421527	64421527	1	Missense_Mutation	c.4043G>A	p.R1348H
COLO679	Skin	HDAC6	X	48676718	48676718	1	Missense_Mutation	c.2086G>A	p.G696S
COLO680N	Oesophagus	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
COLO680N	Oesophagus	CHD9	16	53260317	53260317	1	Missense_Mutation	c.1936G>A	p.A646T
COLO680N	Oesophagus	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
COLO680N	Oesophagus	CHD1	5	98229175	98229175	-1	Missense_Mutation	c.1936C>G	p.L646V
COLO680N	Oesophagus	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
COLO684	Endometrium	MEN1	11	64575491	64575491	-1	Missense_Mutation	c.541G>A	p.A181T
COLO684	Endometrium	HNF1A	12	121432115	121432115	1	Frame_Shift_Del	c.862_862delG	p.G288fs
COLO684	Endometrium	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
COLO684	Endometrium	MGA	15	42059448	42059448	1	Frame_Shift_Del	c.9168_9168delG	p.S3056fs
COLO684	Endometrium	SMARCA4	19	11123684	11123684	1	Silent	c.2334C>T	p.A778A
COLO684	Endometrium	EP300	22	41523549	41523549	1	Missense_Mutation	c.965G>T	p.G322V
COLO684	Endometrium	EP300	22	41566525	41566525	1	Frame_Shift_Del	c.4402_4402delA	p.K1468fs
COLO684	Endometrium	BAG6	6	31612923	31612923	-1	Frame_Shift_Del	c.1187_1187delC	p.P396fs
COLO684	Endometrium	PHF3	6	64415959	64415959	1	Missense_Mutation	c.3408A>C	p.K1136N
COLO684	Endometrium	PHF3	6	64423096	64423097	1	Frame_Shift_Del	c.5612_5613delCT	p.P1871fs
COLO684	Endometrium	ASH2L	8	37964636	37964636	1	Missense_Mutation	c.353G>T	p.G118V
COLO699	Lung	TRRAP	7	98601873	98601873	1	Missense_Mutation	c.10328A>G	p.K3443R
COLO699	Lung	TAF1	X	70618424	70618424	1	Missense_Mutation	c.3683G>A	p.R1228Q
COLO704	Ovary	MEN1	11	64575491	64575491	-1	Missense_Mutation	c.541G>A	p.A181T
COLO704	Ovary	HNF1A	12	121432115	121432115	1	Frame_Shift_Del	c.862_862delG	p.G288fs
COLO704	Ovary	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
COLO704	Ovary	MGA	15	42059448	42059448	1	Frame_Shift_Del	c.9168_9168delG	p.S3056fs
COLO704	Ovary	SMARCA4	19	11123684	11123684	1	Silent	c.2334C>T	p.A778A
COLO704	Ovary	EP300	22	41523549	41523549	1	Missense_Mutation	c.965G>T	p.G322V
COLO704	Ovary	EP300	22	41566525	41566525	1	Frame_Shift_Del	c.4402_4402delA	p.K1468fs
COLO704	Ovary	BAG6	6	31612923	31612923	-1	Frame_Shift_Del	c.1187_1187delC	p.P396fs
COLO704	Ovary	PHF3	6	64415959	64415959	1	Missense_Mutation	c.3408A>C	p.K1136N
COLO704	Ovary	PHF3	6	64423096	64423097	1	Frame_Shift_Del	c.5612_5613delCT	p.P1871fs
COLO704	Ovary	ASH2L	8	37964636	37964636	1	Missense_Mutation	c.353G>T	p.G118V
COLO741	Skin	PRDM16	1	3329031	3329031	1	Missense_Mutation	c.2270C>T	p.S757L
COLO741	Skin	NCOA3	20	46256416	46256416	1	Missense_Mutation	c.644C>T	p.P215L
COLO741	Skin	LMNB1	5	126154683	126154683	1	Missense_Mutation	c.1009C>T	p.R337C
COLO741	Skin	TAF1L	9	32634818	32634818	-1	Nonsense_Mutation	c.760C>T	p.R254*
COLO775	Haematopoietic and lymphoid tissue	ZMYM2	13	20626428	20626428	1	Missense_Mutation	c.2470C>G	p.Q824E
COLO775	Haematopoietic and lymphoid tissue	WHSC1L1	8	38205093	38205093	-1	Missense_Mutation	c.597A>C	p.K199N
COLO775	Haematopoietic and lymphoid tissue	TAF1L	9	32631253	32631253	-1	Missense_Mutation	c.4325G>A	p.R1442Q
COLO775	Haematopoietic and lymphoid tissue	KDM6A	X	44920663	44920663	1	Missense_Mutation	c.1580A>C	p.Q527P
COLO783	Skin	PRDM16	1	3334549	3334549	1	Missense_Mutation	c.2849G>A	p.R950Q
COLO783	Skin	CHD8	14	21861316	21861317	-1	Missense_Mutation	c.5579_5580CC>TT	p.T1860I
COLO783	Skin	NIPBL	5	36976034	36976034	1	Missense_Mutation	c.1025C>A	p.A342E
COLO783	Skin	KMT2C	7	151948046	151948046	-1	Missense_Mutation	c.1627A>G	p.N543D
COLO783	Skin	ATRX	X	76938965	76938965	-1	Missense_Mutation	c.1783C>T	p.L595F
COLO792	Skin	ARID1A	1	27088682	27088682	1	Missense_Mutation	c.2291C>T	p.S764F
COLO792	Skin	CHD5	1	6181588	6181588	-1	Missense_Mutation	c.4745G>A	p.G1582E
COLO792	Skin	KAT6B	10	76781903	76781903	1	Missense_Mutation	c.3286G>A	p.E1096K
COLO792	Skin	KDM5A	12	394695	394695	-1	Missense_Mutation	c.5000C>T	p.P1667L
COLO792	Skin	CREBBP	16	3832912	3832912	-1	Missense_Mutation	c.1346C>T	p.P449L
COLO792	Skin	EP300	22	41573279	41573279	1	Missense_Mutation	c.5564C>T	p.P1855L
COLO792	Skin	STK31	7	23826517	23826517	1	Nonsense_Mutation	c.2461C>T	p.Q821*
COLO792	Skin	TAF1L	9	32633336	32633336	-1	Missense_Mutation	c.2242C>T	p.P748S
COLO818	Skin	CHD5	1	6202271	6202271	-1	Missense_Mutation	c.2353G>A	p.E785K
COLO818	Skin	TET1	10	70406541	70406541	1	Missense_Mutation	c.4055C>G	p.T1352S
COLO818	Skin	HDAC4	2	239990239	239990239	-1	Missense_Mutation	c.2800G>A	p.D934N
COLO818	Skin	WHSC1	4	1962837	1962837	1	Missense_Mutation	c.3331G>A	p.E1111K
COLO818	Skin	TAF1L	9	32632730	32632730	-1	Missense_Mutation	c.2848C>T	p.P950S
COLO829	Skin	MSH6	2	48027520	48027520	1	Missense_Mutation	c.2398G>C	p.V800L
COLO829	Skin	HDAC2	6	114264668	114264668	-1	Nonsense_Mutation	c.1507C>T	p.R503*
COLO829	Skin	KMT2C	7	151935860	151935860	-1	Missense_Mutation	c.2584A>C	p.I862L
COLO829	Skin	TNRC18	7	5352636	5352641	-1	In_Frame_Del	c.7881_7886delCTCCTC	p.2627_2629SSS>S
CORL23	Lung	TRIM33	1	114949641	114949641	-1	Silent	c.2340G>T	p.G780G
CORL23	Lung	ARID1A	1	27105609	27105609	1	Silent	c.5220A>T	p.G1740G
CORL23	Lung	ERCC6	10	50736484	50736484	-1	Missense_Mutation	c.631G>T	p.A211S
CORL23	Lung	SMARCA4	19	11118633	11118635	1	In_Frame_Del	c.2057_2059delAGA	p.K689del
CORL23	Lung	LMNB2	19	2438512	2438512	-1	Missense_Mutation	c.419G>A	p.G140D
CORL23	Lung	PHF3	6	64394527	64394527	1	Missense_Mutation	c.904G>T	p.G302C
CORL23	Lung	ATRX	X	76952186	76952186	-1	Silent	c.249T>G	p.P83P
CORL24	Lung	PHF3	6	64395670	64395670	1	Missense_Mutation	c.2047T>G	p.L683V
CORL279	Lung	MGA	15	42005421	42005421	1	Nonsense_Mutation	c.3157C>T	p.R1053*
CORL279	Lung	HDAC2	6	114292209	114292209	-1	5'UTR	c.146C>T	p.P49L
CORL47	Lung	MGA	15	42041908	42041908	1	Nonsense_Mutation	c.6103G>T	p.E2035*
CORL47	Lung	CREBBP	16	3781867	3781867	-1	Missense_Mutation	c.4800C>G	p.I1600M
CORL47	Lung	TAF1L	9	32635020	32635020	-1	Missense_Mutation	c.558G>T	p.L186F
CORL51	Lung	ERCC6	10	50736480	50736480	-1	Missense_Mutation	c.635G>T	p.S212I
CORL51	Lung	KDM5A	12	438193	438193	-1	Missense_Mutation	c.1776G>C	p.L592F
CORL51	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CORL88	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
CORL88	Lung	NIPBL	5	36985963	36985963	1	Missense_Mutation	c.2681G>A	p.R894H
CORL88	Lung	TRRAP	7	98609112	98609112	1	Missense_Mutation	c.11249C>T	p.A3750V
CORL95	Lung	LMNA	1	156108881	156108881	1	Missense_Mutation	c.1979A>T	p.N660I
CORL95	Lung	CHD5	1	6171893	6171893	-1	Missense_Mutation	c.5191A>C	p.K1731Q
CORL95	Lung	BRDT	1	92470809	92470809	1	Missense_Mutation	c.2740C>A	p.R914S
CORL95	Lung	MGA	15	42041587	42041587	1	Missense_Mutation	c.5782G>A	p.G1928R
CORL95	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
CORL95	Lung	DAXX	6	33288915	33288915	-1	Missense_Mutation	c.673T>C	p.S225P
CORL95	Lung	KDM6A	X	44913124	44913124	1	Missense_Mutation	c.799A>T	p.S267C
COV318	Ovary	CHD9	16	53358263	53358263	1	Missense_Mutation	c.8150G>T	p.G2717V
COV318	Ovary	SP140	2	231134258	231134258	1	Missense_Mutation	c.1252C>G	p.L418V
COV318	Ovary	HDAC2	6	114292110	114292112	-1	5'UTR	c.243_245delCAG	p.S81del
COV434	Ovary	ARID1A	1	27099885	27099885	1	Missense_Mutation	c.3764G>A	p.G1255E
COV434	Ovary	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
COV434	Ovary	HDAC6	X	48681646	48681646	1	Missense_Mutation	c.2837C>G	p.A946G
COV644	Ovary	ZMYM2	13	20637004	20637004	1	Missense_Mutation	c.2930A>C	p.D977A
COV644	Ovary	MGA	15	41961999	41961999	1	Missense_Mutation	c.907C>A	p.Q303K
COV644	Ovary	NCOA2	8	71078953	71078953	-1	Missense_Mutation	c.578G>A	p.R193Q
CPCN	Lung	MGA	15	42059210	42059210	1	Missense_Mutation	c.8930A>C	p.N2977T
CPCN	Lung	TRRAP	7	98508805	98508805	1	Missense_Mutation	c.1918A>C	p.T640P
CW2	Large intestine	CHD5	1	6171872	6171872	-1	Missense_Mutation	c.5212C>T	p.R1738W
CW2	Large intestine	CHD5	1	6189106	6189106	-1	Silent	c.3411C>T	p.I1137I
CW2	Large intestine	ERCC6	10	50667064	50667064	-1	Missense_Mutation	c.4279C>T	p.L1427F
CW2	Large intestine	ERCC6	10	50682233	50682234	-1	Frame_Shift_Ins	c.2437_2438insT	p.S813fs
CW2	Large intestine	ERCC6	10	50690758	50690758	-1	Frame_Shift_Del	c.2144_2144delG	p.G715fs
CW2	Large intestine	ERCC6	10	50732820	50732820	-1	Missense_Mutation	c.656C>T	p.P219L
CW2	Large intestine	NCOA4	10	51585223	51585223	1	Missense_Mutation	c.1370G>T	p.G457V
CW2	Large intestine	TET1	10	70332337	70332337	1	Missense_Mutation	c.242G>A	p.R81H
CW2	Large intestine	KAT6B	10	76790509	76790509	1	Missense_Mutation	c.5927C>T	p.A1976V
CW2	Large intestine	KMT2A	11	118344954	118344955	1	Frame_Shift_Ins	c.3080_3081insA	p.L1027fs
CW2	Large intestine	KMT2A	11	118376022	118376022	1	Missense_Mutation	c.9415A>G	p.N3139D
CW2	Large intestine	KMT2A	11	118376235	118376235	1	Missense_Mutation	c.9628C>A	p.L3210I
CW2	Large intestine	HNF1A	12	121432118	121432118	1	Frame_Shift_Del	c.865_865delC	p.P289fs
CW2	Large intestine	ZMYM5	13	20426143	20426145	-1	In_Frame_Del	c.176_178delATG	p.D59del
CW2	Large intestine	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
CW2	Large intestine	CHD8	14	21883895	21883895	-1	Nonsense_Mutation	c.1051C>T	p.Q351*
CW2	Large intestine	MGA	15	42019546	42019546	1	Missense_Mutation	c.3599G>A	p.G1200D
CW2	Large intestine	MGA	15	42019595	42019596	1	Frame_Shift_Ins	c.3648_3649insA	p.P1216fs
CW2	Large intestine	TP53BP1	15	43720290	43720290	-1	Missense_Mutation	c.3752T>C	p.V1251A
CW2	Large intestine	TP53BP1	15	43748661	43748661	-1	Frame_Shift_Del	c.2145_2145delA	p.K715fs
CW2	Large intestine	CREBBP	16	3929877	3929878	-1	Frame_Shift_Ins	c.40_41insA	p.R14fs
CW2	Large intestine	CHD9	16	53262999	53263000	1	Frame_Shift_Ins	c.2273_2274insT	p.H758fs
CW2	Large intestine	CHD9	16	53265649	53265649	1	Nonsense_Mutation	c.2464G>T	p.E822*
CW2	Large intestine	CHD9	16	53330961	53330961	1	Missense_Mutation	c.5604A>C	p.K1868N
CW2	Large intestine	CHD9	16	53341841	53341841	1	Missense_Mutation	c.7029G>T	p.K2343N
CW2	Large intestine	CHD9	16	53358308	53358308	1	Missense_Mutation	c.8195C>T	p.T2732I
CW2	Large intestine	KAT7	17	47899087	47899087	1	Missense_Mutation	c.1321T>G	p.F441V
CW2	Large intestine	SMARCA4	19	11095992	11095992	1	Missense_Mutation	c.266G>A	p.R89H
CW2	Large intestine	SMARCA4	19	11144114	11144114	1	Missense_Mutation	c.3695G>A	p.G1232D
CW2	Large intestine	HDAC4	2	240024540	240024540	-1	Missense_Mutation	c.2150A>G	p.E717G
CW2	Large intestine	NCOA1	2	24980851	24980851	1	Missense_Mutation	c.3891T>A	p.S1297R
CW2	Large intestine	MSH6	2	48025895	48025895	1	Missense_Mutation	c.773T>C	p.I258T
CW2	Large intestine	DNMT3B	20	31384650	31384651	1	Frame_Shift_Ins	c.1352_1353insGG	p.E451fs
CW2	Large intestine	NCOA3	20	46264652	46264652	1	Missense_Mutation	c.1522G>A	p.A508T
CW2	Large intestine	NCOA3	20	46270958	46270958	1	Missense_Mutation	c.3082C>T	p.P1028S
CW2	Large intestine	EP300	22	41573033	41573033	1	Missense_Mutation	c.5318G>A	p.R1773Q
CW2	Large intestine	EP300	22	41574190	41574190	1	Nonsense_Mutation	c.6475G>T	p.G2159*
CW2	Large intestine	BAP1	3	52437639	52437639	-1	Missense_Mutation	c.1522C>T	p.R508C
CW2	Large intestine	BAP1	3	52440881	52440881	-1	Missense_Mutation	c.623G>A	p.R208Q
CW2	Large intestine	WHSC1	4	1955060	1955060	1	Nonsense_Mutation	c.2147C>A	p.S716*
CW2	Large intestine	WHSC1	4	1980422	1980422	1	Missense_Mutation	c.3884T>G	p.F1295C
CW2	Large intestine	LMNB1	5	126141299	126141299	1	Missense_Mutation	c.553G>A	p.A185T
CW2	Large intestine	HDAC3	5	141005780	141005780	-1	Nonsense_Mutation	c.901C>T	p.R301*
CW2	Large intestine	NSD1	5	176638251	176638251	1	Nonsense_Mutation	c.2851G>T	p.G951*
CW2	Large intestine	NSD1	5	176721649	176721649	1	Missense_Mutation	c.7280C>T	p.A2427V
CW2	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
CW2	Large intestine	NIPBL	5	36985884	36985884	1	Nonsense_Mutation	c.2602C>T	p.R868*
CW2	Large intestine	NIPBL	5	37064057	37064057	1	Missense_Mutation	c.8026G>A	p.D2676N
CW2	Large intestine	CHD1	5	98195690	98195691	-1	Frame_Shift_Ins	c.4509_4510insA	p.K1503fs
CW2	Large intestine	CHD1	5	98217719	98217719	-1	Missense_Mutation	c.2827A>T	p.T943S
CW2	Large intestine	BAG6	6	31612922	31612923	-1	Frame_Shift_Ins	c.1187_1188insC	p.P396fs
CW2	Large intestine	PHF3	6	64395275	64395276	1	Frame_Shift_Del	c.1652_1653delAA	p.Q551fs
CW2	Large intestine	PHF3	6	64423008	64423008	1	Missense_Mutation	c.5524C>A	p.P1842T
CW2	Large intestine	TRIM24	7	138235821	138235821	1	Missense_Mutation	c.1157T>C	p.L386S
CW2	Large intestine	TRIM24	7	138239616	138239616	1	Missense_Mutation	c.1435G>T	p.A479S
CW2	Large intestine	TRIM24	7	138239629	138239629	1	Missense_Mutation	c.1448A>G	p.Q483R
CW2	Large intestine	KMT2C	7	151845200	151845202	-1	In_Frame_Del	c.13810_13812delGAG	p.E4604del
CW2	Large intestine	KMT2C	7	151856064	151856064	-1	Missense_Mutation	c.11554A>G	p.K3852E
CW2	Large intestine	KMT2C	7	151891638	151891638	-1	Missense_Mutation	c.4394C>T	p.T1465I
CW2	Large intestine	TRRAP	7	98567840	98567840	1	Missense_Mutation	c.7597C>T	p.R2533C
CW2	Large intestine	KAT6A	8	41812842	41812842	-1	Missense_Mutation	c.1570T>C	p.S524P
CW2	Large intestine	NCOA2	8	71056907	71056907	-1	Missense_Mutation	c.2782A>G	p.N928D
CW2	Large intestine	BRD3	9	136901399	136901399	-1	Missense_Mutation	c.1691A>G	p.E564G
CW2	Large intestine	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
CW2	Large intestine	KDM6A	X	44942757	44942757	1	Missense_Mutation	c.3493G>A	p.V1165I
CW2	Large intestine	TAF1	X	70612823	70612823	1	Missense_Mutation	c.3090A>C	p.K1030N
CW2	Large intestine	TAF1	X	70641208	70641208	1	Silent	c.4494T>C	p.C1498C
CW2	Large intestine	TAF1	X	70679481	70679481	1	Missense_Mutation	c.5204A>C	p.E1735A
CW2	Large intestine	ATRX	X	76776330	76776330	-1	Missense_Mutation	c.7136G>A	p.S2379N
CW2	Large intestine	ATRX	X	76938973	76938973	-1	Missense_Mutation	c.1775C>A	p.P592H
D341MED	Central nervous system	LMNA	1	156084896	156084896	1	Missense_Mutation	c.187A>C	p.I63L
DANG	Pancreas	CHD5	1	6202291	6202291	-1	Missense_Mutation	c.2333T>C	p.V778A
DANG	Pancreas	MGA	15	42040895	42040895	1	Missense_Mutation	c.5273C>G	p.A1758G
DANG	Pancreas	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
DANG	Pancreas	WHSC1L1	8	38187068	38187068	-1	Missense_Mutation	c.1409G>C	p.W470S
DAOY	Central nervous system	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
DAOY	Central nervous system	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
DAOY	Central nervous system	ATRX	X	76907782	76907784	-1	In_Frame_Del	c.4377_4379delGGA	p.1459_1460EE>E
DAUDI	Haematopoietic and lymphoid tissue	PRDM16	1	3334509	3334509	1	Missense_Mutation	c.2809C>A	p.P937T
DAUDI	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
DAUDI	Haematopoietic and lymphoid tissue	TET2	4	106157768	106157768	1	Missense_Mutation	c.2732C>T	p.S911L
DBTRG05MG	Central nervous system	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
DBTRG05MG	Central nervous system	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
DBTRG05MG	Central nervous system	CHD1	5	98210806	98210806	-1	Missense_Mutation	c.3410G>T	p.S1137I
DBTRG05MG	Central nervous system	NCOA2	8	71126243	71126243	-1	Missense_Mutation	c.154T>A	p.L52M
DEL	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
DETROIT562	Upper aerodigestive tract	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
DKMG	Central nervous system	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
DKMG	Central nervous system	JARID2	6	15520382	15520382	1	Missense_Mutation	c.3641C>G	p.P1214R
DM3	Pleura	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
DM3	Pleura	TAF1L	9	32631814	32631814	-1	Missense_Mutation	c.3764G>A	p.R1255Q
DM3	Pleura	TAF1L	9	32632664	32632664	-1	Missense_Mutation	c.2914G>T	p.V972L
DMS114	Lung	NCOA4	10	51585424	51585424	1	Missense_Mutation	c.1571C>T	p.P524L
DMS114	Lung	NIPBL	5	36985130	36985130	1	Missense_Mutation	c.1848T>G	p.S616R
DMS114	Lung	HDAC8	X	71787769	71787769	-1	Missense_Mutation	c.407A>G	p.N136S
DMS153	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
DMS153	Lung	ATRX	X	76890094	76890094	-1	Missense_Mutation	c.4800G>C	p.K1600N
DMS273	Lung	TRIM28	19	59058827	59058827	1	Missense_Mutation	c.671G>A	p.C224Y
DMS273	Lung	SP140	2	231157400	231157400	1	Missense_Mutation	c.1865G>T	p.W622L
DMS454	Lung	NCOA1	2	24929469	24929469	1	Missense_Mutation	c.1130C>A	p.T377N
DMS454	Lung	TET2	4	106156384	106156384	1	Missense_Mutation	c.1348G>A	p.G450R
DMS454	Lung	NIPBL	5	36953836	36953836	1	Missense_Mutation	c.38T>G	p.L13R
DMS454	Lung	NIPBL	5	37052561	37052561	1	Missense_Mutation	c.7156G>C	p.E2386Q
DMS454	Lung	KMT2C	7	151962246	151962246	-1	Nonsense_Mutation	c.1061T>A	p.L354*
DMS454	Lung	TRRAP	7	98547352	98547352	1	Nonsense_Mutation	c.5002C>T	p.R1668*
DMS454	Lung	ASH2L	8	37976851	37976851	1	Missense_Mutation	c.917G>C	p.G306A
DMS454	Lung	KAT6A	8	41798855	41798855	-1	Missense_Mutation	c.2544A>T	p.K848N
DMS454	Lung	ATRX	X	76937221	76937221	-1	Missense_Mutation	c.3527A>T	p.K1176M
DMS53	Lung	TET1	10	70333869	70333870	1	Missense_Mutation	c.1774_1775GG>TT	p.G592L
DMS53	Lung	TET1	10	70432753	70432753	1	Missense_Mutation	c.4775G>T	p.R1592I
DMS53	Lung	KAT6B	10	76788586	76788586	1	Missense_Mutation	c.4004C>G	p.P1335R
DMS53	Lung	SMARCA4	19	11152064	11152064	1	Missense_Mutation	c.4348G>T	p.D1450Y
DMS53	Lung	NCOA1	2	24952394	24952394	1	Missense_Mutation	c.2911G>C	p.E971Q
DMS53	Lung	HDAC3	5	141009612	141009612	-1	Missense_Mutation	c.362A>C	p.K121T
DMS53	Lung	NSD1	5	176671221	176671221	1	Missense_Mutation	c.4328A>G	p.N1443S
DMS53	Lung	STK31	7	23826463	23826463	1	Missense_Mutation	c.2407C>G	p.P803A
DMS53	Lung	TAF1L	9	32632213	32632213	-1	Missense_Mutation	c.3365A>G	p.N1122S
DMS79	Lung	ZMYM2	13	20657125	20657125	1	Missense_Mutation	c.3773C>T	p.A1258V
DMS79	Lung	IKZF1	7	50468158	50468158	1	Missense_Mutation	c.1393G>A	p.E465K
DMS79	Lung	TAF1L	9	32632589	32632589	-1	Missense_Mutation	c.2989G>C	p.D997H
DND41	Haematopoietic and lymphoid tissue	SETDB1	1	150913898	150913898	1	Missense_Mutation	c.541C>T	p.H181Y
DND41	Haematopoietic and lymphoid tissue	LMNA	1	156108460	156108460	1	Missense_Mutation	c.1880G>A	p.R627H
DND41	Haematopoietic and lymphoid tissue	PRDM16	1	3301810	3301810	1	Missense_Mutation	c.533G>T	p.C178F
DND41	Haematopoietic and lymphoid tissue	CHD5	1	6185262	6185262	-1	Missense_Mutation	c.4292C>T	p.A1431V
DND41	Haematopoietic and lymphoid tissue	CHD5	1	6202579	6202579	-1	Nonsense_Mutation	c.2130G>A	p.W710*
DND41	Haematopoietic and lymphoid tissue	CHD5	1	6240043	6240043	-1	Missense_Mutation	c.41T>C	p.L14P
DND41	Haematopoietic and lymphoid tissue	KMT2A	11	118367017	118367017	1	Frame_Shift_Del	c.5599_5599delC	p.P1867fs
DND41	Haematopoietic and lymphoid tissue	IDH1	2	209104683	209104683	-1	Missense_Mutation	c.895G>C	p.D299H
DND41	Haematopoietic and lymphoid tissue	EP300	22	41521973	41521973	1	Missense_Mutation	c.835G>A	p.V279I
DND41	Haematopoietic and lymphoid tissue	EP300	22	41521979	41521979	1	Missense_Mutation	c.841T>A	p.S281T
DND41	Haematopoietic and lymphoid tissue	EP300	22	41560131	41560131	1	Missense_Mutation	c.3803C>T	p.A1268V
DND41	Haematopoietic and lymphoid tissue	BAP1	3	52437851	52437851	-1	Missense_Mutation	c.1310T>C	p.L437P
DND41	Haematopoietic and lymphoid tissue	CHD1	5	98207832	98207832	-1	Silent	c.3784T>C	p.L1262L
DND41	Haematopoietic and lymphoid tissue	BRD2	6	32943904	32943904	1	Missense_Mutation	c.568A>G	p.T190A
DND41	Haematopoietic and lymphoid tissue	DAXX	6	33287529	33287529	-1	Missense_Mutation	c.1604A>G	p.N535S
DND41	Haematopoietic and lymphoid tissue	TRRAP	7	98519398	98519398	1	Missense_Mutation	c.2645A>G	p.N882S
DND41	Haematopoietic and lymphoid tissue	KAT6A	8	41791906	41791906	-1	Missense_Mutation	c.3832C>A	p.R1278S
DND41	Haematopoietic and lymphoid tissue	SET	9	131453502	131453502	1	Missense_Mutation	c.166G>A	p.D56N
DU145	Prostate	ERCC6	10	50667034	50667034	-1	Missense_Mutation	c.4309T>A	p.F1437I
DU145	Prostate	ERCC6	10	50684261	50684261	-1	Missense_Mutation	c.2382G>T	p.Q794H
DU145	Prostate	ZMYM2	13	20593699	20593699	1	Missense_Mutation	c.1525C>G	p.P509A
DU145	Prostate	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
DU145	Prostate	MSH6	2	48030586	48030586	1	Missense_Mutation	c.3200G>T	p.S1067I
DU145	Prostate	TET2	4	106155778	106155779	1	Frame_Shift_Ins	c.742_743insA	p.E248fs
DU145	Prostate	NIPBL	5	37064698	37064698	1	Missense_Mutation	c.8119G>T	p.V2707F
DU145	Prostate	PHF3	6	64415953	64415953	1	Frame_Shift_Del	c.3402_3402delA	p.P1134fs
DU145	Prostate	KMT2C	7	151845524	151845524	-1	Frame_Shift_Del	c.13488_13488delT	p.F4496fs
DU145	Prostate	STK31	7	23809350	23809350	1	Missense_Mutation	c.1688G>C	p.C563S
DU145	Prostate	TRRAP	7	98534832	98534832	1	Missense_Mutation	c.4165G>A	p.A1389T
DU145	Prostate	HDAC8	X	71708851	71708851	-1	Frame_Shift_Del	c.669_669delG	p.R223fs
DU4475	Breast	MLLT10	10	21962813	21962813	1	Missense_Mutation	c.1586A>G	p.Q529R
DU4475	Breast	NCOA4	10	51582908	51582908	1	Missense_Mutation	c.731T>G	p.L244R
DU4475	Breast	KMT2C	7	151948016	151948016	-1	Missense_Mutation	c.1657G>A	p.D553N
DU4475	Breast	NCOA2	8	71039063	71039063	-1	Missense_Mutation	c.3901T>G	p.F1301V
DV90	Lung	ARID1A	1	27105931	27105931	1	Frame_Shift_Del	c.5542_5542delG	p.G1848fs
DV90	Lung	SIRT1	10	69648852	69648852	1	Frame_Shift_Del	c.760_760delA	p.K254fs
DV90	Lung	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
DV90	Lung	KMT2D	12	49426973	49426973	-1	Frame_Shift_Del	c.11515_11515delC	p.Q3839fs
DV90	Lung	MGA	15	42052625	42052627	1	In_Frame_Del	c.7296_7298delGCG	p.R2436del
DV90	Lung	TP53BP1	15	43748661	43748661	-1	Frame_Shift_Del	c.2145_2145delA	p.K715fs
DV90	Lung	CREBBP	16	3843552	3843553	-1	Frame_Shift_Ins	c.1050_1051insA	p.K350fs
DV90	Lung	MLLT6	17	36876790	36876790	1	Missense_Mutation	c.2321C>A	p.P774H
DV90	Lung	KAT7	17	47875801	47875801	1	Missense_Mutation	c.461C>A	p.A154D
DV90	Lung	SMARCA4	19	11097617	11097617	1	Missense_Mutation	c.797C>T	p.S266L
DV90	Lung	LMNB2	19	2434495	2434495	-1	Missense_Mutation	c.1000C>T	p.R334C
DV90	Lung	SP110	2	231072717	231072718	-1	Frame_Shift_Ins	c.886_887insA	p.S296fs
DV90	Lung	SP140L	2	231266129	231266129	1	Frame_Shift_Del	c.1471_1471delT	p.F491fs
DV90	Lung	BAP1	3	52437662	52437662	-1	Missense_Mutation	c.1499G>A	p.G500D
DV90	Lung	WHSC1	4	1978310	1978310	1	Missense_Mutation	c.3730C>T	p.R1244C
DV90	Lung	NIPBL	5	36985208	36985209	1	Frame_Shift_Ins	c.1926_1927insA	p.T642fs
DV90	Lung	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
DV90	Lung	PHIP	6	79752586	79752586	-1	Missense_Mutation	c.574G>T	p.D192Y
DV90	Lung	KMT2C	7	151873773	151873773	-1	Missense_Mutation	c.8765T>G	p.L2922R
DV90	Lung	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
DV90	Lung	WHSC1L1	8	38178590	38178590	-1	Missense_Mutation	c.1809G>T	p.Q603H
DV90	Lung	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
DV90	Lung	PSIP1	9	15479597	15479597	-1	Missense_Mutation	c.545G>T	p.R182L
DV90	Lung	PSIP1	9	15479634	15479634	-1	Missense_Mutation	c.508G>A	p.A170T
EB2	Haematopoietic and lymphoid tissue	ARID1A	1	27057793	27057793	1	Nonsense_Mutation	c.1501C>T	p.Q501*
EB2	Haematopoietic and lymphoid tissue	ERCC6	10	50666881	50666881	-1	Missense_Mutation	c.4462C>T	p.L1488F
EB2	Haematopoietic and lymphoid tissue	KMT2A	11	118355656	118355656	1	Missense_Mutation	c.4298T>G	p.V1433G
EB2	Haematopoietic and lymphoid tissue	TP53BP1	15	43784550	43784550	-1	Missense_Mutation	c.124G>T	p.G42C
EB2	Haematopoietic and lymphoid tissue	TP53BP1	15	43784576	43784576	-1	Missense_Mutation	c.98A>C	p.E33A
EB2	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
EB2	Haematopoietic and lymphoid tissue	HDAC2	6	114292342	114292342	-1	5'UTR	c.13C>T	p.P5S
EB2	Haematopoietic and lymphoid tissue	KMT2C	7	151919745	151919745	-1	Missense_Mutation	c.3346A>T	p.N1116Y
EBC1	Lung	CHD5	1	6181191	6181191	-1	Missense_Mutation	c.4886C>T	p.P1629L
EBC1	Lung	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
EBC1	Lung	TET2	4	106155902	106155902	1	Nonsense_Mutation	c.866C>A	p.S289*
EBC1	Lung	KMT2C	7	151860506	151860506	-1	Missense_Mutation	c.10156G>T	p.D3386Y
ECC10	Stomach	MLLT6	17	36872749	36872749	1	Missense_Mutation	c.1166C>A	p.P389H
ECC10	Stomach	NCOA1	2	24952542	24952542	1	Missense_Mutation	c.3059C>A	p.T1020K
ECC10	Stomach	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
ECC10	Stomach	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
ECC12	Stomach	TP53BP1	15	43708548	43708548	-1	Missense_Mutation	c.4748G>C	p.R1583T
EFM19	Breast	ERCC6	10	50667127	50667127	-1	Missense_Mutation	c.4216G>A	p.E1406K
EFM19	Breast	HDAC4	2	240036991	240036991	-1	Missense_Mutation	c.1534A>C	p.S512R
EFM19	Breast	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
EFO21	Ovary	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
EFO27	Ovary	ARID1A	1	27023744	27023744	1	Frame_Shift_Del	c.850_850delG	p.G284fs
EFO27	Ovary	ARID1A	1	27099961	27099961	1	Silent	c.3840C>A	p.P1280P
EFO27	Ovary	ARID1A	1	27105553	27105553	1	Nonsense_Mutation	c.5164C>T	p.R1722*
EFO27	Ovary	CHD5	1	6195315	6195315	-1	Missense_Mutation	c.2845C>T	p.R949W
EFO27	Ovary	BRDT	1	92446564	92446564	1	Missense_Mutation	c.1591G>A	p.G531R
EFO27	Ovary	ERCC6	10	50701164	50701164	-1	Frame_Shift_Del	c.1820_1820delA	p.K607fs
EFO27	Ovary	TET1	10	70333081	70333081	1	Missense_Mutation	c.986T>G	p.F329C
EFO27	Ovary	KMT2A	11	118392804	118392804	1	Missense_Mutation	c.11836G>A	p.D3946N
EFO27	Ovary	ING1	13	111371750	111371750	1	Missense_Mutation	c.740G>A	p.R247Q
EFO27	Ovary	CHD8	14	21861876	21861881	-1	In_Frame_Del	c.5236_5241delAAGCTA	p.KL1746del
EFO27	Ovary	CREBBP	16	3779754	3779755	-1	Frame_Shift_Ins	c.5293_5294insC	p.Q1765fs
EFO27	Ovary	CREBBP	16	3900353	3900353	-1	Missense_Mutation	c.743C>T	p.P248L
EFO27	Ovary	TRIM28	19	59060451	59060451	1	Missense_Mutation	c.1506G>C	p.Q502H
EFO27	Ovary	MSH6	2	48025974	48025974	1	Silent	c.852T>C	p.D284D
EFO27	Ovary	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
EFO27	Ovary	EP300	22	41536166	41536166	1	Missense_Mutation	c.1783C>T	p.P595S
EFO27	Ovary	WHSC1	4	1980559	1980559	1	Frame_Shift_Del	c.4021_4021delC	p.P1341fs
EFO27	Ovary	CHD1	5	98192133	98192133	-1	Missense_Mutation	c.5084T>C	p.V1695A
EFO27	Ovary	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
EFO27	Ovary	TNRC18	7	5352772	5352772	-1	Frame_Shift_Del	c.7750_7750delG	p.E2584fs
EFO27	Ovary	BRD3	9	136898744	136898744	-1	Missense_Mutation	c.2149G>A	p.G717R
EFO27	Ovary	HDAC6	X	48675775	48675775	1	Missense_Mutation	c.1834G>A	p.A612T
EJM	Haematopoietic and lymphoid tissue	ARID1A	1	27059267	27059267	1	Missense_Mutation	c.1904G>A	p.R635K
EJM	Haematopoietic and lymphoid tissue	KMT2A	11	118373840	118373840	1	Missense_Mutation	c.7233C>A	p.S2411R
EJM	Haematopoietic and lymphoid tissue	HDAC4	2	240085518	240085518	-1	Missense_Mutation	c.592G>A	p.D198N
EJM	Haematopoietic and lymphoid tissue	TET2	4	106157521	106157521	1	Missense_Mutation	c.2485G>A	p.E829K
EJM	Haematopoietic and lymphoid tissue	STK31	7	23808627	23808627	1	Missense_Mutation	c.1430C>G	p.S477C
EM2	Haematopoietic and lymphoid tissue	CHD8	14	21896325	21896325	-1	Missense_Mutation	c.467G>T	p.S156I
EM2	Haematopoietic and lymphoid tissue	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
EM2	Haematopoietic and lymphoid tissue	BRD2	6	32943910	32943910	1	Missense_Mutation	c.574C>T	p.P192S
EN	Endometrium	ARID1A	1	27097688	27097688	1	Frame_Shift_Del	c.3277_3277delA	p.K1093fs
EN	Endometrium	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
EN	Endometrium	CHD5	1	6181558	6181558	-1	Missense_Mutation	c.4775T>C	p.V1592A
EN	Endometrium	MLLT10	10	21962351	21962351	1	Missense_Mutation	c.1124T>C	p.L375P
EN	Endometrium	ERCC6	10	50681033	50681033	-1	Frame_Shift_Del	c.2751_2751delC	p.G917fs
EN	Endometrium	TET1	10	70332161	70332162	1	Frame_Shift_Ins	c.66_67insA	p.K22fs
EN	Endometrium	TET1	10	70332439	70332439	1	Missense_Mutation	c.344T>C	p.L115P
EN	Endometrium	KAT6B	10	76788403	76788403	1	Missense_Mutation	c.3821A>G	p.Y1274C
EN	Endometrium	KAT6B	10	76790586	76790586	1	Missense_Mutation	c.6004A>G	p.M2002V
EN	Endometrium	KMT2A	11	118377280	118377280	1	Missense_Mutation	c.10673A>G	p.H3558R
EN	Endometrium	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
EN	Endometrium	EP400	12	132547136	132547138	1	In_Frame_Del	c.8224_8226delCAA	p.Q2748del
EN	Endometrium	KDM5A	12	402030	402031	-1	Frame_Shift_Ins	c.4760_4761insA	p.K1587fs
EN	Endometrium	KDM5A	12	461396	461396	-1	Missense_Mutation	c.1124C>G	p.S375C
EN	Endometrium	CHD4	12	6701671	6701672	-1	Frame_Shift_Ins	c.2826_2827insA	p.K942fs
EN	Endometrium	ZMYM2	13	20580534	20580535	1	Frame_Shift_Ins	c.1320_1321insA	p.F440fs
EN	Endometrium	ZMYM2	13	20659975	20659975	1	Missense_Mutation	c.3955A>G	p.N1319D
EN	Endometrium	CHD8	14	21853858	21853858	-1	Missense_Mutation	c.6823T>C	p.Y2275H
EN	Endometrium	CHD8	14	21860941	21860941	-1	Missense_Mutation	c.5659C>T	p.L1887F
EN	Endometrium	CHD8	14	21884030	21884031	-1	Frame_Shift_Ins	c.915_916insA	p.K305fs
EN	Endometrium	MGA	15	41991340	41991340	1	Missense_Mutation	c.2171A>G	p.H724R
EN	Endometrium	MGA	15	42000352	42000352	1	Missense_Mutation	c.2371A>G	p.K791E
EN	Endometrium	CREBBP	16	3786047	3786047	-1	Missense_Mutation	c.4718A>C	p.E1573A
EN	Endometrium	CHD9	16	53243678	53243679	1	Frame_Shift_Ins	c.1737_1738insA	p.S579fs
EN	Endometrium	SUZ12	17	30322704	30322704	1	Missense_Mutation	c.1717C>T	p.P573S
EN	Endometrium	LMNB2	19	2435075	2435075	-1	Missense_Mutation	c.779T>C	p.L260P
EN	Endometrium	TRIM28	19	59061771	59061771	1	Missense_Mutation	c.2359G>A	p.G787S
EN	Endometrium	IDH1	2	209116180	209116180	-1	Frame_Shift_Del	c.96_96delT	p.F32fs
EN	Endometrium	SP110	2	231042960	231042960	-1	Missense_Mutation	c.1360A>T	p.S454C
EN	Endometrium	MSH6	2	48027931	48027931	1	Missense_Mutation	c.2809T>C	p.Y937H
EN	Endometrium	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
EN	Endometrium	NCOA3	20	46262822	46262822	1	Missense_Mutation	c.995T>C	p.V332A
EN	Endometrium	TET2	4	106155274	106155274	1	Missense_Mutation	c.238A>G	p.S80G
EN	Endometrium	NIPBL	5	36976111	36976111	1	Missense_Mutation	c.1102T>C	p.S368P
EN	Endometrium	NIPBL	5	37044518	37044518	1	Missense_Mutation	c.6178C>T	p.H2060Y
EN	Endometrium	CHD1	5	98236919	98236920	-1	Frame_Shift_Ins	c.557_558insA	p.N186fs
EN	Endometrium	HDAC2	6	114265539	114265539	-1	Missense_Mutation	c.1409A>G	p.H470R
EN	Endometrium	BRD2	6	32948228	32948229	1	Frame_Shift_Ins	c.2361_2362insC	p.K787fs
EN	Endometrium	PHF3	6	64408416	64408417	1	Frame_Shift_Ins	c.2903_2904insT	p.S968fs
EN	Endometrium	PHF3	6	64412441	64412441	1	Missense_Mutation	c.3143G>A	p.R1048Q
EN	Endometrium	PHIP	6	79770278	79770278	-1	Missense_Mutation	c.356T>C	p.V119A
EN	Endometrium	TRIM24	7	138269596	138269596	1	Missense_Mutation	c.3053A>G	p.E1018G
EN	Endometrium	KMT2C	7	151859521	151859521	-1	Missense_Mutation	c.11141A>G	p.K3714R
EN	Endometrium	KMT2C	7	151874147	151874148	-1	Frame_Shift_Ins	c.8390_8391insA	p.K2797fs
EN	Endometrium	KMT2C	7	151932949	151932949	-1	Missense_Mutation	c.2722G>A	p.G908S
EN	Endometrium	TRRAP	7	98519473	98519473	1	Missense_Mutation	c.2720A>G	p.K907R
EN	Endometrium	WHSC1L1	8	38137084	38137084	-1	Missense_Mutation	c.3734T>C	p.L1245P
EN	Endometrium	WHSC1L1	8	38146944	38146945	-1	Frame_Shift_Ins	c.3197_3198insA	p.N1066fs
EN	Endometrium	NCOA2	8	71041064	71041064	-1	Missense_Mutation	c.3476T>C	p.M1159T
EN	Endometrium	TAF1L	9	32630806	32630806	-1	Missense_Mutation	c.4772T>C	p.V1591A
EN	Endometrium	TAF1L	9	32633583	32633584	-1	Frame_Shift_Ins	c.1994_1995insAA	p.K665fs
EN	Endometrium	TAF1L	9	32633599	32633599	-1	Missense_Mutation	c.1979A>G	p.K660R
EN	Endometrium	TAF1	X	70607310	70607310	1	Missense_Mutation	c.2486A>G	p.Q829R
EN	Endometrium	ATRX	X	76874315	76874316	-1	Frame_Shift_Ins	c.5406_5407insA	p.K1802fs
EN	Endometrium	ATRX	X	76918920	76918921	-1	Frame_Shift_Ins	c.4070_4071insA	p.K1357fs
EOL1	Haematopoietic and lymphoid tissue	NCOA1	2	24991199	24991199	1	Missense_Mutation	c.4265C>T	p.S1422L
EOL1	Haematopoietic and lymphoid tissue	PHF3	6	64395161	64395161	1	Missense_Mutation	c.1538A>C	p.K513T
EPLC272H	Lung	CHD8	14	21897266	21897266	-1	Missense_Mutation	c.235C>A	p.P79T
EPLC272H	Lung	CREBBP	16	3779654	3779654	-1	Missense_Mutation	c.5394G>A	p.M1798I
EPLC272H	Lung	CREBBP	16	3820689	3820689	-1	Missense_Mutation	c.2762C>T	p.A921V
EPLC272H	Lung	SMARCA4	19	11097622	11097622	1	Missense_Mutation	c.802G>A	p.V268M
EPLC272H	Lung	NIPBL	5	37026381	37026381	1	Missense_Mutation	c.5760C>G	p.H1920Q
ES2	Ovary	IDH1	2	209116182	209116182	-1	Missense_Mutation	c.94T>G	p.F32V
ES2	Ovary	TRRAP	7	98591358	98591358	1	Missense_Mutation	c.10003G>A	p.E3335K
ES2	Ovary	HDAC6	X	48663870	48663870	1	Missense_Mutation	c.337C>G	p.H113D
ES2	Ovary	ATRX	X	76937764	76937764	-1	Missense_Mutation	c.2984C>T	p.P995L
ESS1	Endometrium	CREBBP	16	3781875	3781875	-1	Missense_Mutation	c.4792A>G	p.S1598G
ESS1	Endometrium	EP300	22	41569760	41569760	1	Missense_Mutation	c.4751T>G	p.L1584R
ESS1	Endometrium	WHSC1	4	1978260	1978260	1	Missense_Mutation	c.3680G>A	p.R1227Q
ESS1	Endometrium	NIPBL	5	37000969	37000969	1	Nonsense_Mutation	c.3553G>T	p.E1185*
ESS1	Endometrium	NIPBL	5	37044823	37044823	1	Missense_Mutation	c.6335G>T	p.R2112I
ESS1	Endometrium	DAXX	6	33287521	33287521	-1	Missense_Mutation	c.1612C>T	p.R538C
ESS1	Endometrium	PHIP	6	79650915	79650915	-1	Missense_Mutation	c.4961T>G	p.I1654S
ESS1	Endometrium	KMT2C	7	151927365	151927365	-1	Missense_Mutation	c.2811A>C	p.E937D
ESS1	Endometrium	KDM6A	X	44820622	44820622	1	Missense_Mutation	c.319G>A	p.E107K
ESS1	Endometrium	TAF1	X	70595108	70595108	1	Missense_Mutation	c.504G>T	p.K168N
ESS1	Endometrium	TAF1	X	70608190	70608190	1	Missense_Mutation	c.2591G>A	p.R864Q
EVSAT	Breast	CHD5	1	6181224	6181224	-1	Missense_Mutation	c.4853G>C	p.R1618P
EVSAT	Breast	CREBBP	16	3820648	3820648	-1	Nonsense_Mutation	c.2803C>T	p.Q935*
EVSAT	Breast	KMT2C	7	151845478	151845478	-1	Missense_Mutation	c.13534C>A	p.H4512N
EVSAT	Breast	TRRAP	7	98493399	98493399	1	Missense_Mutation	c.463C>A	p.L155M
EVSAT	Breast	TAF1	X	70603911	70603911	1	Missense_Mutation	c.2107G>C	p.E703Q
EVSAT	Breast	TAF1	X	70613164	70613164	1	Missense_Mutation	c.3125C>G	p.S1042C
F36P	Haematopoietic and lymphoid tissue	KAT6B	10	76788267	76788267	1	Missense_Mutation	c.3685A>G	p.S1229G
F36P	Haematopoietic and lymphoid tissue	KMT2A	11	118344170	118344170	1	Missense_Mutation	c.2296G>C	p.E766Q
F36P	Haematopoietic and lymphoid tissue	WHSC1	4	1957007	1957007	1	Missense_Mutation	c.2458C>T	p.R820W
FADU	Upper aerodigestive tract	KDM5A	12	419036	419036	-1	Missense_Mutation	c.3311A>G	p.D1104G
FADU	Upper aerodigestive tract	TAF1L	9	32630403	32630403	-1	Missense_Mutation	c.5175T>G	p.D1725E
FTC133	Thyroid	CHD8	14	21854277	21854278	-1	Frame_Shift_Del	c.6403_6404delAG	p.S2135fs
FTC133	Thyroid	NCOA1	2	24914391	24914391	1	Missense_Mutation	c.574A>G	p.S192G
FTC133	Thyroid	MSH6	2	48028257	48028257	1	Frame_Shift_Del	c.3135_3135delG	p.K1045fs
FTC133	Thyroid	KMT2C	7	151878416	151878416	-1	Nonsense_Mutation	c.6529C>T	p.Q2177*
FTC133	Thyroid	TRRAP	7	98524941	98524941	1	Missense_Mutation	c.3127G>A	p.A1043T
FTC133	Thyroid	TRRAP	7	98569549	98569549	1	Missense_Mutation	c.7799A>G	p.D2600G
FTC133	Thyroid	TRRAP	7	98609103	98609103	1	Missense_Mutation	c.11240C>T	p.P3747L
FTC238	Thyroid	ARID1A	1	27056278	27056278	1	Missense_Mutation	c.1274A>G	p.Q425R
FTC238	Thyroid	CHD8	14	21854277	21854278	-1	Frame_Shift_Del	c.6403_6404delAG	p.S2135fs
FTC238	Thyroid	CHD9	16	53261342	53261342	1	Missense_Mutation	c.2078A>T	p.D693V
FTC238	Thyroid	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
FTC238	Thyroid	CHD9	16	53341632	53341632	1	Missense_Mutation	c.6820A>G	p.T2274A
FTC238	Thyroid	SMARCA4	19	11134252	11134252	1	Missense_Mutation	c.2918G>A	p.R973Q
FTC238	Thyroid	LMNB2	19	2435147	2435147	-1	Missense_Mutation	c.707G>A	p.R236Q
FTC238	Thyroid	SP140	2	231108517	231108517	1	Missense_Mutation	c.562T>C	p.C188R
FTC238	Thyroid	MSH6	2	48028257	48028257	1	Frame_Shift_Del	c.3135_3135delG	p.K1045fs
FTC238	Thyroid	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
FTC238	Thyroid	KMT2C	7	151879363	151879363	-1	Missense_Mutation	c.5582G>A	p.R1861Q
FTC238	Thyroid	KMT2C	7	152012262	152012263	-1	Frame_Shift_Ins	c.550_551insA	p.M184fs
FTC238	Thyroid	TRRAP	7	98609103	98609103	1	Missense_Mutation	c.11240C>T	p.P3747L
FTC238	Thyroid	KAT6A	8	41790813	41790813	-1	Missense_Mutation	c.4925G>T	p.R1642M
FTC238	Thyroid	KDM6A	X	44879975	44879975	1	Missense_Mutation	c.564G>C	p.K188N
FTC238	Thyroid	ATRX	X	76954064	76954064	-1	Missense_Mutation	c.187G>A	p.E63K
FU97	Stomach	MGA	15	42046647	42046647	1	Missense_Mutation	c.7021G>C	p.E2341Q
FU97	Stomach	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
FU97	Stomach	WHSC1L1	8	38178591	38178591	-1	Missense_Mutation	c.1808A>C	p.Q603P
FU97	Stomach	HDAC6	X	48661400	48661400	1	Silent	c.216A>G	p.Q72Q
FUOV1	Ovary	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
FUOV1	Ovary	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
G361	Skin	STK31	7	23766869	23766870	1	Missense_Mutation	c.259_260GG>AA	p.G87K
G401	Soft tissue	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
G401	Soft tissue	NSD1	5	176638964	176638964	1	Missense_Mutation	c.3564G>C	p.R1188S
G402	Soft tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
G402	Soft tissue	TNRC18	7	5352636	5352638	-1	In_Frame_Del	c.7884_7886delCTC	p.2628_2629SS>S
GAMG	Central nervous system	SMARCA4	19	11169001	11169001	1	Nonsense_Mutation	c.4591G>T	p.E1531*
GAMG	Central nervous system	HDAC4	2	240056036	240056036	-1	Missense_Mutation	c.1199C>T	p.S400L
GCIY	Stomach	MLLT10	10	22015191	22015191	1	Missense_Mutation	c.1945T>A	p.S649T
GCIY	Stomach	KDM5A	12	416960	416960	-1	Missense_Mutation	c.3590A>C	p.Q1197P
GCIY	Stomach	CHD9	16	53338225	53338225	1	Missense_Mutation	c.6307C>T	p.R2103C
GCIY	Stomach	KMT2C	7	151879433	151879433	-1	Missense_Mutation	c.5512C>T	p.P1838S
GCT	Soft tissue	TET1	10	70405872	70405872	1	Missense_Mutation	c.3386C>T	p.S1129L
GCT	Soft tissue	KMT2A	11	118377121	118377121	1	Missense_Mutation	c.10514C>T	p.S3505F
GCT	Soft tissue	CREBBP	16	3817756	3817756	-1	Missense_Mutation	c.3215C>T	p.S1072F
GCT	Soft tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
GDM1	Haematopoietic and lymphoid tissue	NCOA4	10	51582857	51582857	1	Missense_Mutation	c.680C>T	p.A227V
GI1	Central nervous system	CREBBP	16	3781324	3781326	-1	In_Frame_Del	c.5039_5041delCCT	p.S1680del
GI1	Central nervous system	PHIP	6	79735845	79735845	-1	Missense_Mutation	c.637G>T	p.D213Y
GMS10	Central nervous system	KMT2A	11	118374411	118374411	1	Missense_Mutation	c.7804A>G	p.M2602V
GMS10	Central nervous system	MGA	15	41989198	41989198	1	Missense_Mutation	c.1990C>T	p.L664F
GMS10	Central nervous system	EP300	22	41574341	41574352	1	In_Frame_Del	c.6626_6637delACCAGTTCCAGC	p.2209_2213NQFQQ>K
GMS10	Central nervous system	KMT2C	7	151860469	151860469	-1	Missense_Mutation	c.10193G>A	p.R3398Q
GOS3	Central nervous system	SP140	2	231174641	231174641	1	Missense_Mutation	c.2061G>A	p.M687I
GOS3	Central nervous system	KMT2C	7	151878792	151878793	-1	Missense_Mutation	c.6152_6153CA>GT	p.P2051R
GP2D	Large intestine	TRIM33	1	114948246	114948246	-1	Missense_Mutation	c.2554T>A	p.S852T
GP2D	Large intestine	SETDB1	1	150921995	150921995	1	Missense_Mutation	c.1574C>T	p.T525I
GP2D	Large intestine	SETDB1	1	150933382	150933382	1	Frame_Shift_Del	c.2844_2844delC	p.H948fs
GP2D	Large intestine	ARID1A	1	27097622	27097622	1	Frame_Shift_Del	c.3211_3211delA	p.K1071fs
GP2D	Large intestine	ARID1A	1	27105949	27105949	1	Missense_Mutation	c.5560C>T	p.H1854Y
GP2D	Large intestine	HDAC1	1	32782302	32782302	1	Missense_Mutation	c.199T>C	p.Y67H
GP2D	Large intestine	HDAC1	1	32798326	32798328	1	In_Frame_Del	c.1397_1399delAGG	p.E468del
GP2D	Large intestine	BRDT	1	92430236	92430236	1	Missense_Mutation	c.245G>A	p.R82H
GP2D	Large intestine	TET1	10	70333081	70333081	1	Missense_Mutation	c.986T>C	p.F329S
GP2D	Large intestine	KAT6B	10	76603087	76603087	1	Missense_Mutation	c.472C>T	p.R158C
GP2D	Large intestine	HNF1A	12	121416576	121416576	1	Missense_Mutation	c.5T>C	p.V2A
GP2D	Large intestine	HNF1A	12	121426700	121426700	1	Missense_Mutation	c.391C>T	p.R131W
GP2D	Large intestine	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
GP2D	Large intestine	ZMYM2	13	20657094	20657094	1	Frame_Shift_Del	c.3742_3742delA	p.K1248fs
GP2D	Large intestine	CHD8	14	21859176	21859176	-1	Frame_Shift_Del	c.6275_6275delA	p.N2092fs
GP2D	Large intestine	CHD8	14	21861700	21861702	-1	In_Frame_Del	c.5415_5417delTTC	p.1805_1806SS>S
GP2D	Large intestine	TP53BP1	15	43769812	43769812	-1	Missense_Mutation	c.934T>C	p.F312L
GP2D	Large intestine	IDH2	15	90628282	90628282	-1	Missense_Mutation	c.1129C>T	p.R377C
GP2D	Large intestine	CREBBP	16	3779638	3779638	-1	Missense_Mutation	c.5410C>T	p.H1804Y
GP2D	Large intestine	CREBBP	16	3820605	3820605	-1	Missense_Mutation	c.2846C>T	p.P949L
GP2D	Large intestine	CHD9	16	53296976	53296976	1	Missense_Mutation	c.4287G>T	p.K1429N
GP2D	Large intestine	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
GP2D	Large intestine	MLLT6	17	36876778	36876778	1	Missense_Mutation	c.2309C>T	p.A770V
GP2D	Large intestine	DNMT1	19	10254529	10254529	-1	Missense_Mutation	c.3029G>A	p.G1010D
GP2D	Large intestine	SMARCA4	19	11132419	11132419	1	Missense_Mutation	c.2635A>G	p.I879V
GP2D	Large intestine	TFPT	19	54611694	54611694	-1	Missense_Mutation	c.362T>C	p.M121T
GP2D	Large intestine	SP110	2	231048302	231048302	-1	Missense_Mutation	c.1334A>G	p.N445S
GP2D	Large intestine	HDAC4	2	240002823	240002823	-1	Frame_Shift_Del	c.2703_2703delC	p.P901fs
GP2D	Large intestine	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
GP2D	Large intestine	DNMT3B	20	31372607	31372607	1	Missense_Mutation	c.248A>G	p.D83G
GP2D	Large intestine	EP300	22	41525993	41525993	1	Missense_Mutation	c.1268A>C	p.K423T
GP2D	Large intestine	EP300	22	41572452	41572452	1	Nonsense_Mutation	c.4981C>T	p.Q1661*
GP2D	Large intestine	BAP1	3	52437716	52437716	-1	Missense_Mutation	c.1445C>T	p.S482L
GP2D	Large intestine	WHSC1	4	1956994	1956994	1	Silent	c.2445C>A	p.A815A
GP2D	Large intestine	NSD1	5	176683960	176683960	1	Missense_Mutation	c.4774A>G	p.T1592A
GP2D	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
GP2D	Large intestine	NIPBL	5	37051908	37051908	1	Missense_Mutation	c.6982A>G	p.T2328A
GP2D	Large intestine	CHD1	5	98215399	98215399	-1	Missense_Mutation	c.3094A>G	p.I1032V
GP2D	Large intestine	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
GP2D	Large intestine	BAG6	6	31608305	31608305	-1	Missense_Mutation	c.2905C>T	p.R969W
GP2D	Large intestine	PHF3	6	64356558	64356558	1	Silent	c.102T>C	p.F34F
GP2D	Large intestine	PHIP	6	79675770	79675770	-1	Missense_Mutation	c.3209A>G	p.D1070G
GP2D	Large intestine	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
GP2D	Large intestine	KMT2C	7	151949755	151949755	-1	Missense_Mutation	c.1345T>C	p.W449R
GP2D	Large intestine	IKZF1	7	50444381	50444381	1	Missense_Mutation	c.311T>C	p.L104S
GP2D	Large intestine	TRRAP	7	98528336	98528336	1	Frame_Shift_Del	c.3474_3474delG	p.L1158fs
GP2D	Large intestine	ASH2L	8	37996543	37996543	1	Missense_Mutation	c.1841T>C	p.V614A
GP2D	Large intestine	KAT6A	8	41905921	41905921	-1	Missense_Mutation	c.575C>T	p.S192F
GP2D	Large intestine	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
GP2D	Large intestine	TAF1L	9	32633534	32633534	-1	Missense_Mutation	c.2044T>C	p.F682L
GP2D	Large intestine	TAF1	X	70644055	70644055	1	Missense_Mutation	c.4780A>G	p.N1594D
GP2D	Large intestine	ATRX	X	76938192	76938192	-1	Missense_Mutation	c.2556T>A	p.D852E
GP2D	Large intestine	ATRX	X	76939674	76939674	-1	Frame_Shift_Del	c.1074_1074delA	p.K358fs
GSS	Stomach	TET1	10	70406668	70406668	1	Missense_Mutation	c.4182T>A	p.N1394K
GSS	Stomach	SMARCA4	19	11132522	11132522	1	Missense_Mutation	c.2738C>T	p.P913L
GSS	Stomach	CHD1	5	98234078	98234078	-1	Missense_Mutation	c.1247T>G	p.L416R
GSS	Stomach	WHSC1L1	8	38146051	38146051	-1	Missense_Mutation	c.3455C>T	p.T1152M
GSS	Stomach	TAF1L	9	32631377	32631377	-1	Missense_Mutation	c.4201A>G	p.M1401V
GSU	Stomach	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
GSU	Stomach	NIPBL	5	37064663	37064663	1	Missense_Mutation	c.8084C>T	p.T2695M
GSU	Stomach	STK31	7	23775325	23775325	1	Missense_Mutation	c.652A>G	p.T218A
GSU	Stomach	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
GSU	Stomach	TAF1	X	70621562	70621562	1	Missense_Mutation	c.4031T>C	p.I1344T
H4	Central nervous system	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
HARA	Lung	BRDT	1	92470019	92470019	1	Missense_Mutation	c.2449G>C	p.V817L
HARA	Lung	KDM5A	12	427411	427411	-1	Missense_Mutation	c.2758G>A	p.D920N
HARA	Lung	ING1	13	111368275	111368275	1	Missense_Mutation	c.485G>C	p.R162P
HARA	Lung	CREBBP	16	3789643	3789643	-1	Missense_Mutation	c.4216G>C	p.D1406H
HARA	Lung	CHD9	16	53358011	53358011	1	Frame_Shift_Del	c.7898_7898delG	p.R2633fs
HARA	Lung	DAXX	6	33288635	33288635	-1	Missense_Mutation	c.953G>T	p.R318L
HCC1143	Breast	TET1	10	70405103	70405103	1	Missense_Mutation	c.2617G>A	p.V873I
HCC1143	Breast	SMARCA4	19	11145606	11145606	1	Missense_Mutation	c.3968G>A	p.R1323H
HCC1143	Breast	ATRX	X	76938748	76938748	-1	Missense_Mutation	c.2000C>T	p.P667L
HCC1171	Lung	KMT2A	11	118373970	118373970	1	Missense_Mutation	c.7363G>T	p.V2455L
HCC1171	Lung	CHD8	14	21863508	21863508	-1	Missense_Mutation	c.4294G>T	p.D1432Y
HCC1171	Lung	KMT2C	7	151879126	151879126	-1	Missense_Mutation	c.5819A>T	p.E1940V
HCC1187	Breast	BAP1	3	52440271	52440271	-1	Nonsense_Mutation	c.781C>T	p.Q261*
HCC1195	Lung	SMARCA4	19	11129635	11129641	1	Frame_Shift_Del	c.2441_2447delCGCTGTC	p.T814fs
HCC1195	Lung	NIPBL	5	37000639	37000639	1	Missense_Mutation	c.3469G>C	p.E1157Q
HCC1195	Lung	NCOA2	8	71033566	71033566	-1	Missense_Mutation	c.4354A>G	p.M1452V
HCC1195	Lung	NCOA2	8	71071876	71071876	-1	Missense_Mutation	c.988G>C	p.G330R
HCC1359	Lung	KDM5A	12	427343	427343	-1	Missense_Mutation	c.2826G>A	p.M942I
HCC1359	Lung	CHD9	16	53352142	53352142	1	Nonsense_Mutation	c.7603G>T	p.G2535*
HCC1359	Lung	NIPBL	5	36985705	36985705	1	Missense_Mutation	c.2423G>A	p.R808Q
HCC1359	Lung	PHF3	6	64356665	64356665	1	Missense_Mutation	c.209G>A	p.S70N
HCC1359	Lung	ATRX	X	76937602	76937603	-1	Frame_Shift_Ins	c.3145_3146insA	p.I1049fs
HCC1395	Breast	TP53BP1	15	43762078	43762083	-1	In_Frame_Del	c.1362_1367delTATCCC	p.454_456PIP>P
HCC1395	Breast	CREBBP	16	3795301	3795301	-1	Missense_Mutation	c.3891C>G	p.H1297Q
HCC1395	Breast	ATF2	2	175957920	175957920	-1	Missense_Mutation	c.1054G>C	p.D352H
HCC1395	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HCC1395	Breast	TAF1	X	70598132	70598137	1	In_Frame_Del	c.1041_1046delAGATAT	p.DI348del
HCC1395	Breast	ATRX	X	76937225	76937225	-1	Missense_Mutation	c.3523A>G	p.K1175E
HCC1428	Breast	CHD5	1	6189124	6189124	-1	Silent	c.3393C>T	p.F1131F
HCC1428	Breast	NIPBL	5	37010310	37010310	1	Nonsense_Mutation	c.4543G>T	p.E1515*
HCC1438	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
HCC1438	Lung	ATF2	2	176001153	176001153	-1	Missense_Mutation	c.19G>T	p.V7L
HCC1438	Lung	CHD1	5	98234010	98234010	-1	Missense_Mutation	c.1315G>A	p.E439K
HCC1500	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HCC1500	Breast	BAG6	6	31616473	31616473	-1	Missense_Mutation	c.533C>G	p.T178S
HCC1500	Breast	KMT2C	7	151860271	151860271	-1	Missense_Mutation	c.10391A>T	p.Q3464L
HCC1569	Breast	ARID1A	1	27106778	27106778	1	Missense_Mutation	c.6389A>G	p.N2130S
HCC1569	Breast	NCOA4	10	51585486	51585486	1	Missense_Mutation	c.1633A>G	p.T545A
HCC1569	Breast	DNMT3B	20	31387087	31387087	1	Missense_Mutation	c.1712G>A	p.R571Q
HCC1569	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HCC1569	Breast	NIPBL	5	37049317	37049317	1	Frame_Shift_Del	c.6868_6868delT	p.F2290fs
HCC1569	Breast	JARID2	6	15410561	15410561	1	Silent	c.288T>C	p.S96S
HCC1569	Breast	PHF3	6	64394097	64394097	1	Frame_Shift_Del	c.474_474delA	p.T158fs
HCC1569	Breast	PHF3	6	64421195	64421195	1	Missense_Mutation	c.3934T>C	p.Y1312H
HCC1569	Breast	PHIP	6	79708054	79708054	-1	Missense_Mutation	c.1934G>A	p.S645N
HCC1569	Breast	KMT2C	7	151949134	151949134	-1	Missense_Mutation	c.1511T>C	p.L504P
HCC1569	Breast	WHSC1L1	8	38156962	38156962	-1	Missense_Mutation	c.2758G>T	p.G920C
HCC1569	Breast	NCOA2	8	71069209	71069209	-1	Missense_Mutation	c.1391C>T	p.A464V
HCC1588	Lung	TDG	12	104373728	104373729	1	Frame_Shift_Ins	c.286_287insA	p.E96fs
HCC1588	Lung	MGA	15	41961919	41961919	1	Missense_Mutation	c.827G>T	p.S276I
HCC1588	Lung	EZH2	7	148543657	148543657	-1	Frame_Shift_Del	c.151_151delG	p.E51fs
HCC1588	Lung	ZBTB33	X	119387833	119387834	1	In_Frame_Ins	c.563_564insTGA	p.194_195insD
HCC1599	Breast	KAT6A	8	41790399	41790399	-1	Missense_Mutation	c.5339A>G	p.Y1780C
HCC15	Lung	TRIM33	1	114942135	114942135	-1	Missense_Mutation	c.3064G>A	p.D1022N
HCC15	Lung	PRDM16	1	3160694	3160694	1	Missense_Mutation	c.431T>A	p.I144N
HCC15	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
HCC15	Lung	MGA	15	42003244	42003244	1	Missense_Mutation	c.2781G>T	p.Q927H
HCC15	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
HCC15	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HCC15	Lung	EP300	22	41566524	41566525	1	Frame_Shift_Ins	c.4401_4402insA	p.Y1467fs
HCC1806	Breast	BRD2	6	32948238	32948238	1	Missense_Mutation	c.2371A>G	p.K791E
HCC1833	Lung	KAT7	17	47886487	47886487	1	Missense_Mutation	c.670G>A	p.A224T
HCC1833	Lung	IKZF1	7	50468066	50468066	1	Missense_Mutation	c.1301C>T	p.A434V
HCC1954	Breast	KAT6B	10	76788618	76788618	1	Missense_Mutation	c.4036G>T	p.D1346Y
HCC1954	Breast	SP140	2	231150484	231150484	1	Missense_Mutation	c.1582G>A	p.G528S
HCC1954	Breast	NCOA1	2	24985607	24985607	1	Missense_Mutation	c.4117T>C	p.S1373P
HCC1954	Breast	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
HCC1954	Breast	HDAC8	X	71715040	71715040	-1	Silent	c.516T>A	p.I172I
HCC202	Breast	HNF1A	12	121435314	121435314	1	Missense_Mutation	c.1347C>G	p.I449M
HCC202	Breast	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
HCC202	Breast	CHD3	17	7804274	7804274	1	Frame_Shift_Del	c.3260_3260delG	p.C1087fs
HCC202	Breast	KMT2C	7	151904508	151904508	-1	Nonsense_Mutation	c.3718G>T	p.E1240*
HCC202	Breast	TAF1	X	70608199	70608199	1	Missense_Mutation	c.2600T>G	p.L867R
HCC2108	Lung	MSH6	2	48033392	48033393	1	Frame_Shift_Ins	c.3696_3697insAA	p.V1232fs
HCC2157	Breast	CHD8	14	21873400	21873400	-1	Missense_Mutation	c.2438G>A	p.R813H
HCC2157	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HCC2218	Breast	ERCC6	10	50678650	50678651	-1	Missense_Mutation	c.3355_3356GA>CT	p.E1119L
HCC2218	Breast	ERCC6	10	50678893	50678893	-1	Missense_Mutation	c.3113G>C	p.R1038T
HCC2218	Breast	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
HCC2218	Breast	EP300	22	41546047	41546047	1	Missense_Mutation	c.2662C>T	p.P888S
HCC2279	Lung	ARID1A	1	27087516	27087516	1	Missense_Mutation	c.2090C>T	p.P697L
HCC2279	Lung	ATRX	X	76938923	76938923	-1	Missense_Mutation	c.1825C>G	p.P609A
HCC2935	Lung	SUZ12	17	30302580	30302580	1	Missense_Mutation	c.671C>G	p.P224R
HCC2935	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
HCC2935	Lung	LMNB1	5	126161732	126161732	1	Frame_Shift_Del	c.1544_1544delG	p.W515fs
HCC2935	Lung	TAF1	X	70597567	70597568	1	In_Frame_Ins	c.889_890insAGG	p.298_299insE
HCC33	Lung	CREBBP	16	3779578	3779578	-1	Missense_Mutation	c.5470G>A	p.A1824T
HCC33	Lung	KMT2C	7	151873293	151873293	-1	Missense_Mutation	c.9245C>T	p.P3082L
HCC33	Lung	STK31	7	23802423	23802423	1	Nonsense_Mutation	c.1297G>T	p.E433*
HCC366	Lung	ERCC6	10	50690828	50690828	-1	Missense_Mutation	c.2074A>T	p.I692F
HCC366	Lung	KDM5A	12	422253	422253	-1	Missense_Mutation	c.3005G>A	p.R1002Q
HCC366	Lung	SMARCA4	19	11141556	11141556	1	Nonsense_Mutation	c.3533G>A	p.W1178*
HCC366	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
HCC366	Lung	TAF1L	9	32634702	32634702	-1	Missense_Mutation	c.876G>T	p.E292D
HCC38	Breast	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
HCC38	Breast	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
HCC38	Breast	BRD4	19	15374278	15374279	-1	Frame_Shift_Ins	c.1293_1294insAG	p.K431fs
HCC38	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HCC38	Breast	KAT6A	8	41806877	41806877	-1	Missense_Mutation	c.1603C>T	p.P535S
HCC4006	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
HCC44	Lung	ERCC6	10	50682281	50682281	-1	Missense_Mutation	c.2390C>G	p.S797C
HCC44	Lung	EP300	22	41573727	41573727	1	Missense_Mutation	c.6012G>T	p.Q2004H
HCC56	Large intestine	CHD8	14	21897278	21897278	-1	Missense_Mutation	c.223G>T	p.V75L
HCC56	Large intestine	MGA	15	41989082	41989082	1	Missense_Mutation	c.1874C>A	p.A625E
HCC56	Large intestine	KMT2C	7	151873372	151873372	-1	Missense_Mutation	c.9166C>G	p.Q3056E
HCC70	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HCC78	Lung	KMT2A	11	118373698	118373698	1	Missense_Mutation	c.7091C>G	p.S2364C
HCC78	Lung	MGA	15	42042754	42042754	1	Missense_Mutation	c.6949G>A	p.D2317N
HCC78	Lung	BAG6	6	31607297	31607297	-1	Nonsense_Mutation	c.3283C>T	p.Q1095*
HCC78	Lung	KDM6A	X	44929200	44929201	1	Frame_Shift_Ins	c.2456_2457insT	p.S819fs
HCC827	Lung	CHD8	14	21854038	21854038	-1	Missense_Mutation	c.6643C>T	p.H2215Y
HCC827	Lung	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
HCC95	Lung	KMT2A	11	118369223	118369223	1	Missense_Mutation	c.5941C>T	p.R1981W
HCC95	Lung	DUSP1	5	172196678	172196678	-1	Frame_Shift_Del	c.633_633delC	p.P211fs
HCT116	Large intestine	SFMBT2	10	7212995	7212997	-1	In_Frame_Del	c.2437_2439delGAG	p.E813del
HCT116	Large intestine	KAT6B	10	76789156	76789156	1	Missense_Mutation	c.4574C>T	p.T1525I
HCT116	Large intestine	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
HCT116	Large intestine	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
HCT116	Large intestine	ZMYM2	13	20641055	20641055	1	Missense_Mutation	c.3197G>A	p.C1066Y
HCT116	Large intestine	ZMYM2	13	20657094	20657095	1	Frame_Shift_Del	c.3742_3743delAA	p.K1248fs
HCT116	Large intestine	CHD8	14	21860710	21860710	-1	Missense_Mutation	c.5890C>T	p.R1964C
HCT116	Large intestine	CHD8	14	21862472	21862472	-1	Missense_Mutation	c.4726C>T	p.R1576C
HCT116	Large intestine	CHD8	14	21873452	21873452	-1	Missense_Mutation	c.2386G>T	p.G796W
HCT116	Large intestine	LMNB2	19	2435085	2435085	-1	Missense_Mutation	c.769G>A	p.A257T
HCT116	Large intestine	TFPT	19	54617959	54617960	-1	Frame_Shift_Del	c.144_145delGT	p.V48fs
HCT116	Large intestine	IDH1	2	209106786	209106786	-1	Missense_Mutation	c.782C>T	p.S261L
HCT116	Large intestine	NCOA1	2	24952419	24952419	1	Missense_Mutation	c.2936C>T	p.T979M
HCT116	Large intestine	EP300	22	41566525	41566525	1	Frame_Shift_Del	c.4402_4402delA	p.K1468fs
HCT116	Large intestine	CHD1	5	98238664	98238664	-1	Missense_Mutation	c.377C>T	p.S126F
HCT116	Large intestine	CHD1	5	98239584	98239584	-1	Missense_Mutation	c.284C>T	p.A95V
HCT116	Large intestine	PHF3	6	64401641	64401641	1	Missense_Mutation	c.2204G>A	p.C735Y
HCT116	Large intestine	TRIM24	7	138252230	138252230	1	Missense_Mutation	c.1535C>T	p.P512L
HCT116	Large intestine	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
HCT116	Large intestine	KMT2C	7	151900081	151900081	-1	Frame_Shift_Del	c.4030_4030delA	p.I1344fs
HCT116	Large intestine	KMT2C	7	151960144	151960144	-1	Missense_Mutation	c.1256A>G	p.Q419R
HCT116	Large intestine	TRRAP	7	98581748	98581748	1	Missense_Mutation	c.9067C>T	p.H3023Y
HCT116	Large intestine	TRRAP	7	98608765	98608765	1	Missense_Mutation	c.10987A>G	p.T3663A
HCT116	Large intestine	NCOA2	8	71071783	71071783	-1	Missense_Mutation	c.1081A>G	p.T361A
HCT116	Large intestine	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
HCT116	Large intestine	TAF1L	9	32633025	32633025	-1	Frame_Shift_Del	c.2553_2553delA	p.K851fs
HCT116	Large intestine	ATRX	X	76891517	76891519	-1	In_Frame_Del	c.4586_4588delCCA	p.T1529del
HCT15	Large intestine	LMNA	1	156105902	156105902	1	Missense_Mutation	c.1147G>A	p.E383K
HCT15	Large intestine	CHD5	1	6188630	6188630	-1	Missense_Mutation	c.3659C>A	p.P1220H
HCT15	Large intestine	CHD5	1	6206455	6206455	-1	Missense_Mutation	c.1619G>A	p.R540H
HCT15	Large intestine	MLLT10	10	22016806	22016806	1	Missense_Mutation	c.2060G>A	p.S687N
HCT15	Large intestine	MLLT10	10	22029110	22029110	1	Missense_Mutation	c.3031C>T	p.L1011L
HCT15	Large intestine	ERCC6	10	50682102	50682102	-1	Nonsense_Mutation	c.2569C>T	p.R857*
HCT15	Large intestine	TET1	10	70332337	70332337	1	Missense_Mutation	c.242G>A	p.R81H
HCT15	Large intestine	TET1	10	70332625	70332625	1	Missense_Mutation	c.530A>C	p.N177T
HCT15	Large intestine	TET1	10	70333431	70333431	1	Missense_Mutation	c.1336C>T	p.P446S
HCT15	Large intestine	KAT6B	10	76780543	76780543	1	Missense_Mutation	c.2833C>A	p.L945I
HCT15	Large intestine	KAT6B	10	76788332	76788332	1	Missense_Mutation	c.3750A>C	p.K1250N
HCT15	Large intestine	KAT6B	10	76789052	76789052	1	Missense_Mutation	c.4470G>T	p.K1490N
HCT15	Large intestine	KAT6B	10	76789486	76789486	1	Missense_Mutation	c.4904C>T	p.A1635V
HCT15	Large intestine	KAT6B	10	76790499	76790499	1	Missense_Mutation	c.5917C>T	p.P1973S
HCT15	Large intestine	KMT2A	11	118347548	118347548	1	Missense_Mutation	c.3185C>A	p.S1062Y
HCT15	Large intestine	KMT2A	11	118373149	118373149	1	Missense_Mutation	c.6542T>C	p.V2181A
HCT15	Large intestine	ZMYM2	13	20580542	20580542	1	Missense_Mutation	c.1328T>C	p.M443T
HCT15	Large intestine	CHD8	14	21861956	21861956	-1	Missense_Mutation	c.5161C>T	p.R1721C
HCT15	Large intestine	TP53BP1	15	43784544	43784544	-1	Missense_Mutation	c.130C>T	p.H44Y
HCT15	Large intestine	CREBBP	16	3807970	3807970	-1	Missense_Mutation	c.3449C>A	p.P1150H
HCT15	Large intestine	CHD9	16	53289681	53289681	1	Missense_Mutation	c.4199C>T	p.T1400I
HCT15	Large intestine	SUZ12	17	30322689	30322689	1	Missense_Mutation	c.1702A>G	p.S568G
HCT15	Large intestine	KAT7	17	47895299	47895299	1	Missense_Mutation	c.1081C>T	p.R361W
HCT15	Large intestine	SMARCA4	19	11132437	11132437	1	Missense_Mutation	c.2653C>T	p.R885C
HCT15	Large intestine	BRD4	19	15355374	15355374	-1	Missense_Mutation	c.2249C>T	p.P750L
HCT15	Large intestine	BRD4	19	15367974	15367974	-1	Missense_Mutation	c.1352A>G	p.E451G
HCT15	Large intestine	LMNB2	19	2435123	2435123	-1	Missense_Mutation	c.731T>C	p.V244A
HCT15	Large intestine	IDH1	2	209113217	209113217	-1	Missense_Mutation	c.290G>A	p.G97D
HCT15	Large intestine	HDAC4	2	240085511	240085511	-1	Missense_Mutation	c.599G>A	p.R200H
HCT15	Large intestine	MSH6	2	48025989	48025989	1	Frame_Shift_Del	c.867_867delC	p.G289fs
HCT15	Large intestine	MSH6	2	48032766	48032766	1	Missense_Mutation	c.3566C>T	p.T1189I
HCT15	Large intestine	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
HCT15	Large intestine	EP300	22	41548252	41548252	1	Nonsense_Mutation	c.3040G>T	p.E1014*
HCT15	Large intestine	BAP1	3	52437611	52437611	-1	Missense_Mutation	c.1550C>T	p.T517M
HCT15	Large intestine	WHSC1	4	1980559	1980559	1	Frame_Shift_Del	c.4021_4021delC	p.P1341fs
HCT15	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
HCT15	Large intestine	NIPBL	5	37001175	37001175	1	Missense_Mutation	c.3659C>T	p.A1220V
HCT15	Large intestine	CHD1	5	98205540	98205540	-1	Missense_Mutation	c.4025T>C	p.M1342T
HCT15	Large intestine	JARID2	6	15512446	15512446	1	Missense_Mutation	c.2960C>T	p.P987L
HCT15	Large intestine	PHF3	6	64394701	64394701	1	Missense_Mutation	c.1078C>A	p.L360I
HCT15	Large intestine	KMT2C	7	151860349	151860349	-1	Missense_Mutation	c.10313G>A	p.G3438D
HCT15	Large intestine	STK31	7	23808649	23808649	1	Missense_Mutation	c.1452A>C	p.Q484H
HCT15	Large intestine	TRRAP	7	98530973	98530973	1	Missense_Mutation	c.3962G>T	p.R1321M
HCT15	Large intestine	KAT6A	8	41790498	41790498	-1	Missense_Mutation	c.5240C>A	p.P1747Q
HCT15	Large intestine	NCOA2	8	71044196	71044196	-1	Missense_Mutation	c.3200A>G	p.H1067R
HCT15	Large intestine	BRD3	9	136913396	136913396	-1	Missense_Mutation	c.895C>T	p.P299S
HCT15	Large intestine	BRD3	9	136913458	136913458	-1	Missense_Mutation	c.833G>A	p.R278Q
HCT15	Large intestine	TAF1L	9	32631263	32631263	-1	Missense_Mutation	c.4315A>T	p.I1439F
HCT15	Large intestine	ATRX	X	76938862	76938862	-1	Missense_Mutation	c.1886T>G	p.L629R
HDLM2	Haematopoietic and lymphoid tissue	PRDM16	1	3329058	3329058	1	Missense_Mutation	c.2297G>A	p.G766D
HDLM2	Haematopoietic and lymphoid tissue	KDM5A	12	432307	432307	-1	Missense_Mutation	c.2216A>G	p.Y739C
HDLM2	Haematopoietic and lymphoid tissue	EP300	22	41513591	41513591	1	Missense_Mutation	c.495G>A	p.M165I
HDLM2	Haematopoietic and lymphoid tissue	HDAC3	5	141016185	141016185	-1	Missense_Mutation	c.68C>G	p.P23R
HDLM2	Haematopoietic and lymphoid tissue	PSIP1	9	15486878	15486878	-1	Missense_Mutation	c.340G>A	p.E114K
HDLM2	Haematopoietic and lymphoid tissue	TAF1L	9	32632220	32632220	-1	Missense_Mutation	c.3358G>A	p.G1120R
HDMYZ	Haematopoietic and lymphoid tissue	EP300	22	41568567	41568567	1	Missense_Mutation	c.4517G>T	p.G1506V
HEC108	Endometrium	LMNA	1	156104626	156104626	1	Missense_Mutation	c.670A>G	p.T224A
HEC108	Endometrium	ARID1A	1	27023528	27023528	1	Missense_Mutation	c.634T>C	p.Y212H
HEC108	Endometrium	ARID1A	1	27100123	27100123	1	Missense_Mutation	c.3919C>T	p.P1307S
HEC108	Endometrium	ARID1A	1	27101054	27101054	1	Nonsense_Mutation	c.4336C>T	p.R1446*
HEC108	Endometrium	ARID1A	1	27106967	27106967	1	Missense_Mutation	c.6578G>A	p.G2193D
HEC108	Endometrium	MLLT10	10	21959456	21959456	1	Missense_Mutation	c.874G>A	p.A292T
HEC108	Endometrium	SIRT1	10	69676123	69676123	1	Missense_Mutation	c.2017A>G	p.S673G
HEC108	Endometrium	TET1	10	70333443	70333443	1	Missense_Mutation	c.1348C>G	p.P450A
HEC108	Endometrium	TET1	10	70406132	70406132	1	Missense_Mutation	c.3646T>G	p.S1216A
HEC108	Endometrium	TET1	10	70446436	70446436	1	Missense_Mutation	c.5376C>A	p.N1792K
HEC108	Endometrium	KAT6B	10	76741613	76741613	1	Missense_Mutation	c.2300A>G	p.H767R
HEC108	Endometrium	KMT2A	11	118348790	118348790	1	Missense_Mutation	c.3443A>G	p.K1148R
HEC108	Endometrium	KMT2A	11	118352625	118352625	1	Missense_Mutation	c.3830C>T	p.S1277L
HEC108	Endometrium	KMT2A	11	118361941	118361941	1	Missense_Mutation	c.4727A>G	p.Y1576C
HEC108	Endometrium	KMT2A	11	118366584	118366584	1	Missense_Mutation	c.5533C>T	p.H1845Y
HEC108	Endometrium	KMT2A	11	118374459	118374459	1	Missense_Mutation	c.7852A>G	p.R2618G
HEC108	Endometrium	KMT2A	11	118376842	118376842	1	Missense_Mutation	c.10235T>C	p.L3412P
HEC108	Endometrium	KMT2A	11	118392019	118392019	1	Missense_Mutation	c.11530C>T	p.R3844W
HEC108	Endometrium	HNF1A	12	121416723	121416723	1	Missense_Mutation	c.152G>A	p.G51D
HEC108	Endometrium	ING1	13	111368100	111368100	1	Missense_Mutation	c.310G>T	p.G104C
HEC108	Endometrium	ZMYM2	13	20579228	20579228	1	Missense_Mutation	c.1148T>C	p.M383T
HEC108	Endometrium	CHD8	14	21873487	21873487	-1	Missense_Mutation	c.2351C>T	p.A784V
HEC108	Endometrium	CHD8	14	21897323	21897323	-1	Missense_Mutation	c.178A>G	p.T60A
HEC108	Endometrium	MGA	15	42026746	42026746	1	Frame_Shift_Del	c.3870_3870delA	p.L1290fs
HEC108	Endometrium	TP53BP1	15	43705433	43705433	-1	Missense_Mutation	c.5189A>G	p.N1730S
HEC108	Endometrium	CREBBP	16	3781419	3781419	-1	Missense_Mutation	c.4946T>C	p.I1649T
HEC108	Endometrium	CREBBP	16	3823832	3823832	-1	Missense_Mutation	c.2383C>T	p.P795S
HEC108	Endometrium	CHD9	16	53288449	53288449	1	Missense_Mutation	c.3961A>G	p.S1321G
HEC108	Endometrium	CHD9	16	53341618	53341618	1	Missense_Mutation	c.6806A>G	p.D2269G
HEC108	Endometrium	CHD9	16	53348331	53348331	1	Missense_Mutation	c.7265T>C	p.L2422S
HEC108	Endometrium	MLLT6	17	36876137	36876137	1	Missense_Mutation	c.2144C>T	p.A715V
HEC108	Endometrium	KAT7	17	47875861	47875861	1	Missense_Mutation	c.521G>A	p.R174H
HEC108	Endometrium	SMARCA4	19	11129638	11129638	1	Missense_Mutation	c.2444T>C	p.L815P
HEC108	Endometrium	LMNB2	19	2444472	2444472	-1	Missense_Mutation	c.331G>A	p.A111T
HEC108	Endometrium	IDH1	2	209106739	209106739	-1	Nonsense_Mutation	c.829C>T	p.Q277*
HEC108	Endometrium	HDAC4	2	240002823	240002823	-1	Frame_Shift_Del	c.2703_2703delC	p.P901fs
HEC108	Endometrium	HDAC4	2	240011790	240011790	-1	Missense_Mutation	c.2288A>G	p.N763S
HEC108	Endometrium	NCOA1	2	24896311	24896311	1	Silent	c.333C>A	p.S111S
HEC108	Endometrium	NCOA1	2	24980955	24980955	1	Missense_Mutation	c.3995A>G	p.N1332S
HEC108	Endometrium	MSH6	2	48026628	48026628	1	Missense_Mutation	c.1506A>G	p.I502M
HEC108	Endometrium	NCOA6	20	33345714	33345715	-1	In_Frame_Ins	c.836_837insACA	p.279_279Q>QQ
HEC108	Endometrium	NCOA3	20	46264985	46264985	1	Frame_Shift_Del	c.1855_1855delA	p.K619fs
HEC108	Endometrium	EP300	22	41523507	41523507	1	Missense_Mutation	c.923C>T	p.P308L
HEC108	Endometrium	EP300	22	41551101	41551101	1	Missense_Mutation	c.3245A>G	p.Q1082R
HEC108	Endometrium	EP300	22	41573408	41573408	1	Missense_Mutation	c.5693A>G	p.Q1898R
HEC108	Endometrium	TET2	4	106155431	106155431	1	Missense_Mutation	c.395A>G	p.K132R
HEC108	Endometrium	WHSC1	4	1920021	1920021	1	Missense_Mutation	c.1081A>C	p.K361Q
HEC108	Endometrium	NSD1	5	176710894	176710894	1	Missense_Mutation	c.6116G>A	p.R2039H
HEC108	Endometrium	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
HEC108	Endometrium	NIPBL	5	37020894	37020894	1	Missense_Mutation	c.5243T>C	p.V1748A
HEC108	Endometrium	CHD1	5	98234410	98234410	-1	Missense_Mutation	c.1144G>A	p.D382N
HEC108	Endometrium	HDAC2	6	114270204	114270204	-1	Missense_Mutation	c.1062A>T	p.L354F
HEC108	Endometrium	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
HEC108	Endometrium	HDAC2	6	114292055	114292055	-1	Silent	c.300A>C	p.G100G
HEC108	Endometrium	BAG6	6	31612923	31612923	-1	Frame_Shift_Del	c.1187_1187delC	p.P396fs
HEC108	Endometrium	BRD2	6	32945700	32945700	1	Missense_Mutation	c.1496A>G	p.E499G
HEC108	Endometrium	DAXX	6	33289544	33289544	-1	Silent	c.195G>A	p.S65S
HEC108	Endometrium	PHIP	6	79724818	79724818	-1	Missense_Mutation	c.1505T>C	p.I502T
HEC108	Endometrium	KMT2C	7	151843746	151843746	-1	Missense_Mutation	c.13969T>C	p.Y4657H
HEC108	Endometrium	KMT2C	7	151860463	151860463	-1	Missense_Mutation	c.10199G>A	p.R3400H
HEC108	Endometrium	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
HEC108	Endometrium	STK31	7	23751871	23751871	1	Missense_Mutation	c.116G>A	p.S39N
HEC108	Endometrium	STK31	7	23825188	23825188	1	Missense_Mutation	c.2240G>A	p.R747H
HEC108	Endometrium	STK31	7	23826172	23826172	1	Missense_Mutation	c.2320G>A	p.A774T
HEC108	Endometrium	IKZF1	7	50444464	50444464	1	Missense_Mutation	c.394C>T	p.L132F
HEC108	Endometrium	TRRAP	7	98550857	98550857	1	Missense_Mutation	c.5510C>T	p.T1837M
HEC108	Endometrium	TRRAP	7	98552779	98552779	1	Missense_Mutation	c.5768C>T	p.A1923V
HEC108	Endometrium	TRRAP	7	98592336	98592336	1	Missense_Mutation	c.10132T>C	p.F3378L
HEC108	Endometrium	KAT6A	8	41789854	41789854	-1	Missense_Mutation	c.5884G>A	p.A1962T
HEC108	Endometrium	KAT6A	8	41790610	41790610	-1	Missense_Mutation	c.5128A>G	p.S1710G
HEC108	Endometrium	KAT6A	8	41791467	41791467	-1	Missense_Mutation	c.4271C>G	p.T1424S
HEC108	Endometrium	KAT6A	8	41798766	41798766	-1	Missense_Mutation	c.2633G>A	p.R878H
HEC108	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
HEC108	Endometrium	PSIP1	9	15472735	15472735	-1	Missense_Mutation	c.872G>A	p.G291E
HEC108	Endometrium	TAF1L	9	32633584	32633584	-1	Frame_Shift_Del	c.1994_1994delA	p.K665fs
HEC108	Endometrium	KDM6A	X	44833931	44833931	1	Missense_Mutation	c.355T>C	p.Y119H
HEC108	Endometrium	KDM6A	X	44922844	44922844	1	Missense_Mutation	c.1861A>G	p.N621D
HEC108	Endometrium	HDAC6	X	48682634	48682634	1	Missense_Mutation	c.3509A>G	p.H1170R
HEC108	Endometrium	ATRX	X	76953087	76953087	-1	Missense_Mutation	c.226T>C	p.S76P
HEC151	Endometrium	SETDB1	1	150900422	150900422	1	Missense_Mutation	c.232G>A	p.V78I
HEC151	Endometrium	HDAC1	1	32798326	32798328	1	In_Frame_Del	c.1397_1399delAGG	p.E468del
HEC151	Endometrium	KMT2A	11	118374169	118374169	1	Missense_Mutation	c.7562G>A	p.R2521H
HEC151	Endometrium	KDM5A	12	459881	459881	-1	Missense_Mutation	c.1214T>C	p.V405A
HEC151	Endometrium	ING1	13	111371619	111371619	1	Silent	c.609C>T	p.R203R
HEC151	Endometrium	CHD8	14	21871808	21871808	-1	Frame_Shift_Del	c.2485_2485delA	p.I829fs
HEC151	Endometrium	MGA	15	42042077	42042077	1	Frame_Shift_Del	c.6272_6272delA	p.E2091fs
HEC151	Endometrium	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
HEC151	Endometrium	MLLT6	17	36881107	36881112	1	In_Frame_Del	c.3118_3123delGCCGCA	p.AA1046del
HEC151	Endometrium	SMARCA4	19	11132513	11132513	1	Missense_Mutation	c.2729C>T	p.T910M
HEC151	Endometrium	TRIM28	19	59057155	59057155	1	Missense_Mutation	c.478G>A	p.A160T
HEC151	Endometrium	TRIM28	19	59058983	59058983	1	Missense_Mutation	c.742G>A	p.A248T
HEC151	Endometrium	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
HEC151	Endometrium	MSH6	2	48030670	48030670	1	Missense_Mutation	c.3284G>A	p.R1095H
HEC151	Endometrium	EP300	22	41513352	41513352	1	Nonsense_Mutation	c.256C>T	p.R86*
HEC151	Endometrium	EP300	22	41573563	41573563	1	Missense_Mutation	c.5848A>G	p.R1950G
HEC151	Endometrium	PHF21B	22	45283956	45283956	-1	Frame_Shift_Del	c.1084_1084delG	p.A362fs
HEC151	Endometrium	BAP1	3	52441247	52441247	-1	Missense_Mutation	c.523C>T	p.P175S
HEC151	Endometrium	NSD1	5	176709491	176709491	1	Missense_Mutation	c.5918G>A	p.G1973D
HEC151	Endometrium	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
HEC151	Endometrium	NIPBL	5	37010322	37010322	1	Frame_Shift_Del	c.4555_4555delA	p.K1519fs
HEC151	Endometrium	KMT2C	7	151836292	151836292	-1	Missense_Mutation	c.14513C>T	p.T4838M
HEC151	Endometrium	KMT2C	7	151845523	151845524	-1	Frame_Shift_Ins	c.13488_13489insT	p.F4496fs
HEC151	Endometrium	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
HEC151	Endometrium	TRRAP	7	98547761	98547761	1	Missense_Mutation	c.5189C>T	p.T1730I
HEC151	Endometrium	KDM6A	X	44833947	44833947	1	Missense_Mutation	c.371C>T	p.S124F
HEC151	Endometrium	KDM6A	X	44918629	44918629	1	Missense_Mutation	c.1112C>T	p.A371V
HEC151	Endometrium	KDM6A	X	44966718	44966718	1	Frame_Shift_Del	c.4098_4098delA	p.G1366fs
HEC151	Endometrium	TAF1	X	70602717	70602717	1	Missense_Mutation	c.1832A>G	p.Q611R
HEC151	Endometrium	ATRX	X	76937602	76937602	-1	Frame_Shift_Del	c.3146_3146delT	p.I1049fs
HEC151	Endometrium	ATRX	X	76938089	76938090	-1	Frame_Shift_Del	c.2658_2659delGA	p.E886fs
HEC151	Endometrium	ATRX	X	76939674	76939674	-1	Frame_Shift_Del	c.1074_1074delA	p.K358fs
HEC1A	Endometrium	ARID1A	1	27056216	27056216	1	Missense_Mutation	c.1212A>T	p.Q404H
HEC1A	Endometrium	ARID1A	1	27100173	27100173	1	Silent	c.3969C>A	p.R1323R
HEC1A	Endometrium	ARID1A	1	27105670	27105670	1	Missense_Mutation	c.5281G>T	p.G1761C
HEC1A	Endometrium	ARID1A	1	27105892	27105892	1	Nonsense_Mutation	c.5503C>T	p.Q1835*
HEC1A	Endometrium	ARID1A	1	27106732	27106732	1	Nonsense_Mutation	c.6343C>T	p.Q2115*
HEC1A	Endometrium	PRDM16	1	3301765	3301766	1	Frame_Shift_Ins	c.488_489insG	p.A163fs
HEC1A	Endometrium	PRDM16	1	3328319	3328319	1	Missense_Mutation	c.1558C>T	p.P520S
HEC1A	Endometrium	CHD5	1	6173025	6173025	-1	Missense_Mutation	c.4946A>T	p.D1649V
HEC1A	Endometrium	CHD5	1	6188564	6188564	-1	Missense_Mutation	c.3725C>T	p.P1242L
HEC1A	Endometrium	TET1	10	70333620	70333620	1	Missense_Mutation	c.1525C>T	p.P509S
HEC1A	Endometrium	KAT6B	10	76784747	76784747	1	Missense_Mutation	c.3404G>A	p.R1135H
HEC1A	Endometrium	CHD8	14	21860949	21860949	-1	Missense_Mutation	c.5651G>A	p.R1884H
HEC1A	Endometrium	CHD8	14	21897481	21897481	-1	Missense_Mutation	c.20G>A	p.R7H
HEC1A	Endometrium	TP53BP1	15	43701900	43701900	-1	Missense_Mutation	c.5345A>G	p.E1782G
HEC1A	Endometrium	MLLT6	17	36876651	36876651	1	Missense_Mutation	c.2182G>A	p.A728T
HEC1A	Endometrium	SMARCA4	19	11097624	11097625	1	Frame_Shift_Ins	c.804_805insC	p.V268fs
HEC1A	Endometrium	BRD4	19	15350788	15350789	-1	Frame_Shift_Ins	c.3214_3215insC	p.Q1072fs
HEC1A	Endometrium	SP110	2	231079743	231079743	-1	Missense_Mutation	c.238C>A	p.L80I
HEC1A	Endometrium	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
HEC1A	Endometrium	EP300	22	41565529	41565529	1	Missense_Mutation	c.4195G>A	p.D1399N
HEC1A	Endometrium	BAP1	3	52442566	52442566	-1	Missense_Mutation	c.179G>A	p.R60Q
HEC1A	Endometrium	WHSC1	4	1980559	1980559	1	Frame_Shift_Del	c.4021_4021delC	p.P1341fs
HEC1A	Endometrium	NIPBL	5	37022389	37022389	1	Missense_Mutation	c.5471C>T	p.S1824L
HEC1A	Endometrium	JARID2	6	15520423	15520423	1	Missense_Mutation	c.3682G>A	p.V1228M
HEC1A	Endometrium	BAG6	6	31612352	31612352	-1	Missense_Mutation	c.1415C>T	p.P472L
HEC1A	Endometrium	BAG6	6	31615426	31615426	-1	Missense_Mutation	c.748C>T	p.L250F
HEC1A	Endometrium	PHIP	6	79713536	79713536	-1	Missense_Mutation	c.1564T>C	p.C522R
HEC1A	Endometrium	KMT2C	7	151845625	151845625	-1	Missense_Mutation	c.13387G>A	p.V4463I
HEC1A	Endometrium	KMT2C	7	151874147	151874148	-1	Frame_Shift_Ins	c.8390_8391insA	p.K2797fs
HEC1A	Endometrium	KMT2C	7	151879488	151879488	-1	Missense_Mutation	c.5457G>A	p.M1819I
HEC1A	Endometrium	TRRAP	7	98506388	98506388	1	Missense_Mutation	c.1153C>A	p.H385N
HEC1A	Endometrium	ASH2L	8	37985835	37985835	1	Missense_Mutation	c.1192C>T	p.R398W
HEC1A	Endometrium	NCOA2	8	71060525	71060525	-1	Missense_Mutation	c.2588T>A	p.L863Q
HEC1A	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
HEC1A	Endometrium	TAF1L	9	32635092	32635093	-1	Frame_Shift_Ins	c.485_486insC	p.P162fs
HEC1A	Endometrium	ATRX	X	76938169	76938169	-1	Missense_Mutation	c.2579T>C	p.M860T
HEC1B	Endometrium	ARID1A	1	27105670	27105670	1	Missense_Mutation	c.5281G>T	p.G1761C
HEC1B	Endometrium	ARID1A	1	27105892	27105892	1	Nonsense_Mutation	c.5503C>T	p.Q1835*
HEC1B	Endometrium	ARID1A	1	27106732	27106732	1	Nonsense_Mutation	c.6343C>T	p.Q2115*
HEC1B	Endometrium	TET1	10	70333620	70333620	1	Missense_Mutation	c.1525C>T	p.P509S
HEC1B	Endometrium	KAT6B	10	76784747	76784747	1	Missense_Mutation	c.3404G>A	p.R1135H
HEC1B	Endometrium	KAT6B	10	76788664	76788664	1	Missense_Mutation	c.4082A>C	p.E1361A
HEC1B	Endometrium	CHD8	14	21860949	21860949	-1	Missense_Mutation	c.5651G>A	p.R1884H
HEC1B	Endometrium	CHD8	14	21897481	21897481	-1	Missense_Mutation	c.20G>A	p.R7H
HEC1B	Endometrium	TP53BP1	15	43748760	43748760	-1	Missense_Mutation	c.2046G>T	p.E682D
HEC1B	Endometrium	CREBBP	16	3831218	3831218	-1	Missense_Mutation	c.1663C>A	p.L555M
HEC1B	Endometrium	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
HEC1B	Endometrium	BAP1	3	52437822	52437822	-1	Missense_Mutation	c.1339G>A	p.V447I
HEC1B	Endometrium	BAP1	3	52442566	52442566	-1	Missense_Mutation	c.179G>A	p.R60Q
HEC1B	Endometrium	NSD1	5	176673797	176673797	1	Missense_Mutation	c.4497G>T	p.E1499D
HEC1B	Endometrium	NSD1	5	176707797	176707797	1	Missense_Mutation	c.5854C>T	p.R1952W
HEC1B	Endometrium	NSD1	5	176721976	176721976	1	Missense_Mutation	c.7607C>T	p.A2536V
HEC1B	Endometrium	NIPBL	5	37022389	37022389	1	Missense_Mutation	c.5471C>T	p.S1824L
HEC1B	Endometrium	CHD1	5	98204203	98204203	-1	Missense_Mutation	c.4244G>A	p.S1415N
HEC1B	Endometrium	JARID2	6	15520423	15520423	1	Missense_Mutation	c.3682G>A	p.V1228M
HEC1B	Endometrium	BAG6	6	31612953	31612953	-1	Missense_Mutation	c.1157C>T	p.T386I
HEC1B	Endometrium	BAG6	6	31615426	31615426	-1	Missense_Mutation	c.748C>T	p.L250F
HEC1B	Endometrium	PHIP	6	79713536	79713536	-1	Missense_Mutation	c.1564T>C	p.C522R
HEC1B	Endometrium	KMT2C	7	151845501	151845501	-1	Missense_Mutation	c.13511C>T	p.P4504L
HEC1B	Endometrium	ASH2L	8	37985835	37985835	1	Missense_Mutation	c.1192C>T	p.R398W
HEC1B	Endometrium	WHSC1L1	8	38205103	38205103	-1	Missense_Mutation	c.587A>G	p.K196R
HEC1B	Endometrium	NCOA2	8	71060525	71060525	-1	Missense_Mutation	c.2588T>A	p.L863Q
HEC1B	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
HEC1B	Endometrium	TAF1	X	70586255	70586255	1	Missense_Mutation	c.91G>A	p.A31T
HEC1B	Endometrium	TAF1	X	70603920	70603920	1	Missense_Mutation	c.2116G>A	p.E706K
HEC1B	Endometrium	ATRX	X	76938169	76938169	-1	Missense_Mutation	c.2579T>C	p.M860T
HEC251	Endometrium	TRIM33	1	114964123	114964123	-1	Missense_Mutation	c.1996G>A	p.E666K
HEC251	Endometrium	ARID1A	1	27099904	27099904	1	Silent	c.3783T>C	p.S1261S
HEC251	Endometrium	ARID1A	1	27106720	27106720	1	Missense_Mutation	c.6331G>A	p.V2111I
HEC251	Endometrium	ARID1A	1	27107204	27107204	1	Nonsense_Mutation	c.6815C>A	p.S2272*
HEC251	Endometrium	PRDM16	1	3301789	3301789	1	Missense_Mutation	c.512A>G	p.Y171C
HEC251	Endometrium	CHD5	1	6172253	6172253	-1	Missense_Mutation	c.5087A>G	p.D1696G
HEC251	Endometrium	CHD5	1	6184086	6184086	-1	Missense_Mutation	c.4621G>A	p.E1541K
HEC251	Endometrium	BRDT	1	92443762	92443762	1	Missense_Mutation	c.1019A>C	p.K340T
HEC251	Endometrium	BRDT	1	92446681	92446681	1	Nonsense_Mutation	c.1708G>T	p.E570*
HEC251	Endometrium	MLLT10	10	21906130	21906130	1	Missense_Mutation	c.693G>T	p.E231D
HEC251	Endometrium	SIRT1	10	69672339	69672339	1	Missense_Mutation	c.1466T>C	p.L489S
HEC251	Endometrium	TET1	10	70406667	70406667	1	Missense_Mutation	c.4181A>C	p.N1394T
HEC251	Endometrium	TET1	10	70406692	70406692	1	Missense_Mutation	c.4206C>A	p.F1402L
HEC251	Endometrium	TET1	10	70406721	70406721	1	Missense_Mutation	c.4235C>T	p.S1412F
HEC251	Endometrium	TET1	10	70441195	70441195	1	Nonsense_Mutation	c.4864C>T	p.R1622*
HEC251	Endometrium	KAT6B	10	76735369	76735369	1	Missense_Mutation	c.1274T>G	p.L425R
HEC251	Endometrium	KMT2A	11	118342483	118342483	1	Missense_Mutation	c.609G>T	p.E203D
HEC251	Endometrium	KMT2A	11	118348685	118348685	1	Missense_Mutation	c.3338A>C	p.K1113T
HEC251	Endometrium	KMT2A	11	118373178	118373178	1	Nonsense_Mutation	c.6571C>T	p.R2191*
HEC251	Endometrium	KMT2A	11	118374718	118374718	1	Missense_Mutation	c.8111A>C	p.N2704T
HEC251	Endometrium	KDM5A	12	406233	406233	-1	Missense_Mutation	c.4208C>A	p.S1403Y
HEC251	Endometrium	ZMYM2	13	20580517	20580517	1	Missense_Mutation	c.1303C>T	p.R435C
HEC251	Endometrium	ZMYM2	13	20625726	20625726	1	Missense_Mutation	c.2446A>C	p.N816H
HEC251	Endometrium	ZMYM2	13	20638619	20638620	1	Frame_Shift_Ins	c.3066_3067insT	p.E1022fs
HEC251	Endometrium	CHD8	14	21867787	21867787	-1	Missense_Mutation	c.4058C>T	p.S1353L
HEC251	Endometrium	MGA	15	41961363	41961363	1	Nonsense_Mutation	c.271C>T	p.R91*
HEC251	Endometrium	MGA	15	41988670	41988670	1	Missense_Mutation	c.1462G>A	p.D488N
HEC251	Endometrium	MGA	15	41991290	41991290	1	Missense_Mutation	c.2121A>C	p.E707D
HEC251	Endometrium	MGA	15	42040978	42040978	1	Missense_Mutation	c.5356C>T	p.R1786W
HEC251	Endometrium	MGA	15	42054012	42054012	1	Missense_Mutation	c.7474C>T	p.R2492W
HEC251	Endometrium	TP53BP1	15	43705379	43705379	-1	Missense_Mutation	c.5243A>G	p.D1748G
HEC251	Endometrium	TP53BP1	15	43748367	43748367	-1	Missense_Mutation	c.2439G>T	p.K813N
HEC251	Endometrium	TP53BP1	15	43748515	43748515	-1	Missense_Mutation	c.2291T>C	p.V764A
HEC251	Endometrium	TP53BP1	15	43748825	43748825	-1	Nonsense_Mutation	c.1981G>T	p.E661*
HEC251	Endometrium	CHD9	16	53281230	53281230	1	Missense_Mutation	c.3480A>C	p.E1160D
HEC251	Endometrium	CHD9	16	53289604	53289604	1	Missense_Mutation	c.4122C>A	p.F1374L
HEC251	Endometrium	CHD9	16	53296905	53296905	1	Missense_Mutation	c.4216T>G	p.F1406V
HEC251	Endometrium	MLLT6	17	36863788	36863788	1	Missense_Mutation	c.239A>C	p.N80T
HEC251	Endometrium	KAT7	17	47900569	47900569	1	Missense_Mutation	c.1392G>T	p.K464N
HEC251	Endometrium	DNMT1	19	10267151	10267151	-1	Missense_Mutation	c.1315G>A	p.D439N
HEC251	Endometrium	SMARCA4	19	11105573	11105573	1	Missense_Mutation	c.1489A>T	p.I497F
HEC251	Endometrium	TRIM28	19	59056844	59056844	1	Missense_Mutation	c.393G>T	p.E131D
HEC251	Endometrium	ATF2	2	176001163	176001163	-1	Silent	c.9C>T	p.F3F
HEC251	Endometrium	NCOA1	2	24930609	24930609	1	Missense_Mutation	c.2270A>C	p.E757A
HEC251	Endometrium	MSH6	2	48010436	48010436	1	Missense_Mutation	c.64A>G	p.K22E
HEC251	Endometrium	MSH6	2	48025865	48025865	1	Missense_Mutation	c.743G>A	p.R248Q
HEC251	Endometrium	MSH6	2	48026405	48026405	1	Missense_Mutation	c.1283A>C	p.K428T
HEC251	Endometrium	MSH6	2	48026496	48026496	1	Missense_Mutation	c.1374T>A	p.H458Q
HEC251	Endometrium	MSH6	2	48027681	48027681	1	Missense_Mutation	c.2559G>T	p.K853N
HEC251	Endometrium	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HEC251	Endometrium	EP300	22	41573902	41573902	1	Missense_Mutation	c.6187T>C	p.S2063P
HEC251	Endometrium	WHSC1	4	1940221	1940221	1	Missense_Mutation	c.1718A>C	p.K573T
HEC251	Endometrium	NIPBL	5	37017211	37017211	1	Missense_Mutation	c.4867G>T	p.D1623Y
HEC251	Endometrium	NIPBL	5	37022427	37022427	1	Nonsense_Mutation	c.5509C>T	p.R1837*
HEC251	Endometrium	NIPBL	5	37064657	37064657	1	Missense_Mutation	c.8078A>G	p.D2693G
HEC251	Endometrium	CHD1	5	98228389	98228389	-1	Nonsense_Mutation	c.2020G>T	p.E674*
HEC251	Endometrium	CHD1	5	98236635	98236635	-1	Nonsense_Mutation	c.739G>T	p.E247*
HEC251	Endometrium	DAXX	6	33289545	33289545	-1	Missense_Mutation	c.194C>T	p.S65L
HEC251	Endometrium	DAXX	6	33289661	33289661	-1	Silent	c.78C>T	p.D26D
HEC251	Endometrium	PHF3	6	64356469	64356469	1	Missense_Mutation	c.13G>T	p.D5Y
HEC251	Endometrium	PHF3	6	64395010	64395010	1	Nonsense_Mutation	c.1387G>T	p.E463*
HEC251	Endometrium	PHF3	6	64404585	64404585	1	Nonsense_Mutation	c.2611G>T	p.E871*
HEC251	Endometrium	PHF3	6	64408406	64408406	1	Nonsense_Mutation	c.2893G>T	p.E965*
HEC251	Endometrium	PHF3	6	64422599	64422599	1	Missense_Mutation	c.5115G>T	p.E1705D
HEC251	Endometrium	PHIP	6	79655088	79655088	-1	Missense_Mutation	c.4757A>G	p.K1586R
HEC251	Endometrium	PHIP	6	79726297	79726297	-1	Missense_Mutation	c.1199A>C	p.K400T
HEC251	Endometrium	TRIM24	7	138223430	138223430	1	Missense_Mutation	c.1025T>G	p.L342R
HEC251	Endometrium	KMT2C	7	151848577	151848577	-1	Missense_Mutation	c.12616C>A	p.L4206I
HEC251	Endometrium	KMT2C	7	151859850	151859850	-1	Missense_Mutation	c.10812G>T	p.K3604N
HEC251	Endometrium	KMT2C	7	151927066	151927066	-1	Missense_Mutation	c.2918G>T	p.R973I
HEC251	Endometrium	KMT2C	7	151932921	151932921	-1	Missense_Mutation	c.2750G>T	p.G917V
HEC251	Endometrium	KMT2C	7	151945526	151945526	-1	Nonsense_Mutation	c.1993G>T	p.E665*
HEC251	Endometrium	KMT2C	7	151970902	151970902	-1	Missense_Mutation	c.900G>T	p.E300D
HEC251	Endometrium	STK31	7	23808740	23808740	1	Nonsense_Mutation	c.1543G>T	p.E515*
HEC251	Endometrium	TRRAP	7	98508190	98508190	1	Missense_Mutation	c.1772A>C	p.K591T
HEC251	Endometrium	TRRAP	7	98586412	98586412	1	Missense_Mutation	c.9426C>A	p.F3142L
HEC251	Endometrium	WHSC1L1	8	38133205	38133205	-1	Missense_Mutation	c.4268A>C	p.K1423T
HEC251	Endometrium	WHSC1L1	8	38153360	38153360	-1	Missense_Mutation	c.2869A>C	p.K957Q
HEC251	Endometrium	KAT6A	8	41805346	41805346	-1	Missense_Mutation	c.1825G>A	p.D609N
HEC251	Endometrium	PSIP1	9	15490025	15490025	-1	Missense_Mutation	c.247G>A	p.E83K
HEC251	Endometrium	HDAC6	X	48681418	48681418	1	Missense_Mutation	c.2609G>A	p.R870Q
HEC251	Endometrium	TAF1	X	70614006	70614006	1	Missense_Mutation	c.3377A>C	p.E1126A
HEC265	Endometrium	LMNA	1	156105783	156105783	1	Missense_Mutation	c.1028G>A	p.R343Q
HEC265	Endometrium	ARID1A	1	27101117	27101117	1	Frame_Shift_Del	c.4399_4399delC	p.P1467fs
HEC265	Endometrium	CHD5	1	6219407	6219407	-1	Missense_Mutation	c.376G>A	p.G126R
HEC265	Endometrium	MLLT10	10	22015258	22015258	1	Missense_Mutation	c.2012T>C	p.I671T
HEC265	Endometrium	HNF1A	12	121432118	121432118	1	Frame_Shift_Del	c.865_865delC	p.P289fs
HEC265	Endometrium	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
HEC265	Endometrium	ZMYM2	13	20657094	20657094	1	Frame_Shift_Del	c.3742_3742delA	p.K1248fs
HEC265	Endometrium	CHD8	14	21859176	21859176	-1	Frame_Shift_Del	c.6275_6275delA	p.N2092fs
HEC265	Endometrium	TP53BP1	15	43714249	43714249	-1	Missense_Mutation	c.3904G>T	p.G1302C
HEC265	Endometrium	CREBBP	16	3781320	3781320	-1	Missense_Mutation	c.5045G>A	p.R1682H
HEC265	Endometrium	MLLT6	17	36872004	36872004	1	Missense_Mutation	c.959G>A	p.G320D
HEC265	Endometrium	HDAC4	2	239976487	239976487	-1	Missense_Mutation	c.3031G>A	p.A1011T
HEC265	Endometrium	MSH6	2	48010597	48010597	1	Silent	c.225G>A	p.G75G
HEC265	Endometrium	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
HEC265	Endometrium	EP300	22	41566522	41566522	1	Missense_Mutation	c.4399T>C	p.Y1467H
HEC265	Endometrium	NIPBL	5	36985605	36985605	1	Frame_Shift_Del	c.2323_2323delA	p.K775fs
HEC265	Endometrium	NIPBL	5	37063896	37063896	1	Missense_Mutation	c.7865A>G	p.K2622R
HEC265	Endometrium	PHF3	6	64401733	64401734	1	Frame_Shift_Del	c.2296_2297delTG	p.C766fs
HEC265	Endometrium	KMT2C	7	151860293	151860293	-1	Missense_Mutation	c.10369G>A	p.D3457N
HEC265	Endometrium	KMT2C	7	151933016	151933016	-1	Splice_Region	c.2655C>T	p.G885G
HEC265	Endometrium	WHSC1L1	8	38184248	38184248	-1	Missense_Mutation	c.1708G>T	p.G570C
HEC265	Endometrium	WHSC1L1	8	38205308	38205309	-1	Frame_Shift_Ins	c.381_382insA	p.K127fs
HEC265	Endometrium	BRD3	9	136905293	136905295	-1	In_Frame_Del	c.1504_1506delAAG	p.K502del
HEC265	Endometrium	BRD3	9	136913485	136913485	-1	Missense_Mutation	c.806A>G	p.D269G
HEC265	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
HEC265	Endometrium	KDM6A	X	44911037	44911037	1	Silent	c.738A>G	p.L246L
HEC265	Endometrium	HDAC6	X	48672963	48672963	1	Missense_Mutation	c.923C>A	p.P308H
HEC265	Endometrium	TAF1	X	70613272	70613272	1	Missense_Mutation	c.3233A>C	p.E1078A
HEC50B	Endometrium	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
HEC50B	Endometrium	TET2	4	106156271	106156271	1	Missense_Mutation	c.1235C>T	p.S412F
HEC50B	Endometrium	DAXX	6	33288735	33288735	-1	Missense_Mutation	c.853C>T	p.R285W
HEC59	Endometrium	TRIM33	1	114976314	114976314	-1	Missense_Mutation	c.965C>T	p.A322V
HEC59	Endometrium	ARID1A	1	27056286	27056286	1	Nonsense_Mutation	c.1282C>T	p.Q428*
HEC59	Endometrium	ARID1A	1	27097780	27097780	1	Silent	c.3369C>T	p.S1123S
HEC59	Endometrium	PRDM16	1	3328748	3328748	1	Missense_Mutation	c.1987G>A	p.A663T
HEC59	Endometrium	PRDM16	1	3342276	3342276	1	Missense_Mutation	c.3071A>G	p.D1024G
HEC59	Endometrium	CHD5	1	6169945	6169945	-1	Missense_Mutation	c.5488G>A	p.A1830T
HEC59	Endometrium	CHD5	1	6188133	6188133	-1	Missense_Mutation	c.3876G>C	p.Q1292H
HEC59	Endometrium	CHD5	1	6202629	6202629	-1	Missense_Mutation	c.2080G>A	p.D694N
HEC59	Endometrium	CHD5	1	6228274	6228274	-1	Missense_Mutation	c.143C>A	p.P48H
HEC59	Endometrium	MLLT10	10	21962703	21962703	1	Silent	c.1476T>C	p.H492H
HEC59	Endometrium	ERCC6	10	50732572	50732572	-1	Missense_Mutation	c.904G>A	p.V302I
HEC59	Endometrium	SIRT1	10	69676092	69676092	1	Missense_Mutation	c.1986A>T	p.E662D
HEC59	Endometrium	KAT6B	10	76719764	76719764	1	Missense_Mutation	c.658T>A	p.L220M
HEC59	Endometrium	KAT6B	10	76729782	76729782	1	Missense_Mutation	c.851A>C	p.N284T
HEC59	Endometrium	KAT6B	10	76781772	76781772	1	Missense_Mutation	c.3155G>A	p.R1052Q
HEC59	Endometrium	KMT2A	11	118363816	118363816	1	Missense_Mutation	c.5049A>G	p.I1683M
HEC59	Endometrium	KMT2A	11	118374481	118374481	1	Missense_Mutation	c.7874G>A	p.R2625H
HEC59	Endometrium	MEN1	11	64573177	64573177	-1	Missense_Mutation	c.1130T>C	p.I377T
HEC59	Endometrium	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
HEC59	Endometrium	CHD8	14	21878045	21878045	-1	Missense_Mutation	c.1492C>T	p.R498W
HEC59	Endometrium	CHD8	14	21883770	21883770	-1	Missense_Mutation	c.1094T>C	p.V365A
HEC59	Endometrium	TP53BP1	15	43730536	43730536	-1	Frame_Shift_Del	c.3177_3177delC	p.P1059fs
HEC59	Endometrium	CREBBP	16	3779211	3779211	-1	Frame_Shift_Del	c.5837_5837delC	p.P1946fs
HEC59	Endometrium	CREBBP	16	3900353	3900353	-1	Missense_Mutation	c.743C>T	p.P248L
HEC59	Endometrium	CHD9	16	53279550	53279550	1	Missense_Mutation	c.3242G>A	p.R1081Q
HEC59	Endometrium	CHD9	16	53348351	53348351	1	Frame_Shift_Del	c.7285_7285delA	p.K2429fs
HEC59	Endometrium	MLLT6	17	36872704	36872704	1	Frame_Shift_Del	c.1121_1121delC	p.A374fs
HEC59	Endometrium	MLLT6	17	36872806	36872806	1	Missense_Mutation	c.1223G>A	p.R408H
HEC59	Endometrium	SMARCA4	19	11134234	11134234	1	Missense_Mutation	c.2900G>A	p.R967H
HEC59	Endometrium	BRD4	19	15367948	15367948	-1	Missense_Mutation	c.1378G>A	p.E460K
HEC59	Endometrium	BRD4	19	15376280	15376280	-1	Missense_Mutation	c.734A>G	p.Q245R
HEC59	Endometrium	BRD4	19	15379774	15379774	-1	Missense_Mutation	c.365C>T	p.A122V
HEC59	Endometrium	LMNB2	19	2444471	2444471	-1	Missense_Mutation	c.332C>T	p.A111V
HEC59	Endometrium	TRIM28	19	59059531	59059531	1	Missense_Mutation	c.1085T>C	p.L362S
HEC59	Endometrium	SP140	2	231134555	231134555	1	Missense_Mutation	c.1331C>T	p.A444V
HEC59	Endometrium	HDAC4	2	240002823	240002823	-1	Frame_Shift_Del	c.2703_2703delC	p.P901fs
HEC59	Endometrium	HDAC4	2	240048328	240048328	-1	Missense_Mutation	c.1342C>T	p.R448W
HEC59	Endometrium	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HEC59	Endometrium	EP300	22	41566556	41566556	1	Missense_Mutation	c.4433G>A	p.R1478H
HEC59	Endometrium	EP300	22	41572877	41572877	1	Missense_Mutation	c.5162C>T	p.A1721V
HEC59	Endometrium	LMNB1	5	126140499	126140499	1	Missense_Mutation	c.391G>A	p.A131T
HEC59	Endometrium	NSD1	5	176562682	176562682	1	Missense_Mutation	c.578G>A	p.C193Y
HEC59	Endometrium	NSD1	5	176562861	176562861	1	Missense_Mutation	c.757C>A	p.L253I
HEC59	Endometrium	NSD1	5	176636989	176636989	1	Missense_Mutation	c.1589C>T	p.P530L
HEC59	Endometrium	NSD1	5	176694587	176694587	1	Missense_Mutation	c.5171C>G	p.S1724C
HEC59	Endometrium	NIPBL	5	37008750	37008750	1	Missense_Mutation	c.4346G>T	p.R1449M
HEC59	Endometrium	NIPBL	5	37048716	37048716	1	Frame_Shift_Del	c.6702_6702delA	p.L2234fs
HEC59	Endometrium	NIPBL	5	37064972	37064972	1	Missense_Mutation	c.8393C>A	p.A2798D
HEC59	Endometrium	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
HEC59	Endometrium	DAXX	6	33287609	33287609	-1	Frame_Shift_Del	c.1524_1524delC	p.P508fs
HEC59	Endometrium	DAXX	6	33288332	33288332	-1	Missense_Mutation	c.1112G>A	p.R371Q
HEC59	Endometrium	KMT2C	7	151873599	151873599	-1	Missense_Mutation	c.8939A>G	p.N2980S
HEC59	Endometrium	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
HEC59	Endometrium	TRRAP	7	98506382	98506382	1	Missense_Mutation	c.1147G>A	p.V383M
HEC59	Endometrium	TRRAP	7	98547146	98547146	1	Missense_Mutation	c.4874G>A	p.R1625H
HEC59	Endometrium	TRRAP	7	98609000	98609000	1	Missense_Mutation	c.11137G>A	p.D3713N
HEC59	Endometrium	KAT6A	8	41791093	41791093	-1	Missense_Mutation	c.4645G>A	p.G1549S
HEC59	Endometrium	KAT6A	8	41838433	41838433	-1	Missense_Mutation	c.838T>C	p.F280L
HEC59	Endometrium	BRD3	9	136917491	136917491	-1	Nonsense_Mutation	c.288G>A	p.W96*
HEC59	Endometrium	TAF1L	9	32631451	32631451	-1	Missense_Mutation	c.4127G>A	p.R1376Q
HEC59	Endometrium	TAF1	X	70586258	70586258	1	Missense_Mutation	c.94G>A	p.G32R
HEC6	Endometrium	SETDB1	1	150900406	150900406	1	Missense_Mutation	c.216A>T	p.E72D
HEC6	Endometrium	ARID1A	1	27105931	27105931	1	Frame_Shift_Del	c.5542_5542delG	p.G1848fs
HEC6	Endometrium	HDAC1	1	32782338	32782338	1	Missense_Mutation	c.235A>G	p.I79V
HEC6	Endometrium	PRDM16	1	3301765	3301765	1	Missense_Mutation	c.488C>T	p.A163V
HEC6	Endometrium	CHD5	1	6181285	6181285	-1	Missense_Mutation	c.4792G>A	p.A1598T
HEC6	Endometrium	BRDT	1	92442861	92442861	1	Missense_Mutation	c.892C>T	p.P298S
HEC6	Endometrium	KAT6B	10	76788342	76788342	1	Missense_Mutation	c.3760C>T	p.R1254C
HEC6	Endometrium	KMT2A	11	118392771	118392771	1	Missense_Mutation	c.11803C>T	p.R3935C
HEC6	Endometrium	HNF1A	12	121437322	121437322	1	Missense_Mutation	c.1681G>A	p.G561R
HEC6	Endometrium	KDM5A	12	402247	402247	-1	Missense_Mutation	c.4544A>G	p.Q1515R
HEC6	Endometrium	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
HEC6	Endometrium	KDM5A	12	472257	472257	-1	Nonsense_Mutation	c.544C>T	p.Q182*
HEC6	Endometrium	CHD8	14	21859176	21859176	-1	Frame_Shift_Del	c.6275_6275delA	p.N2092fs
HEC6	Endometrium	MGA	15	42005477	42005477	1	Nonsense_Mutation	c.3213C>A	p.C1071*
HEC6	Endometrium	TP53BP1	15	43748684	43748684	-1	Missense_Mutation	c.2122C>T	p.L708F
HEC6	Endometrium	TP53BP1	15	43769929	43769929	-1	Missense_Mutation	c.817G>A	p.A273T
HEC6	Endometrium	CREBBP	16	3788672	3788672	-1	Missense_Mutation	c.4282C>T	p.R1428C
HEC6	Endometrium	CHD9	16	53358641	53358643	1	In_Frame_Del	c.8528_8530delAAG	p.E2845del
HEC6	Endometrium	SUZ12	17	30300238	30300239	1	Frame_Shift_Ins	c.579_580insA	p.H193fs
HEC6	Endometrium	MLLT6	17	36876672	36876672	1	Missense_Mutation	c.2203C>T	p.R735W
HEC6	Endometrium	KAT7	17	47895358	47895358	1	Missense_Mutation	c.1140A>G	p.I380M
HEC6	Endometrium	SMARCA4	19	11123686	11123686	1	Missense_Mutation	c.2336A>G	p.D779G
HEC6	Endometrium	BRD4	19	15383781	15383781	-1	Missense_Mutation	c.130A>G	p.N44D
HEC6	Endometrium	LMNB2	19	2444432	2444432	-1	Missense_Mutation	c.371T>C	p.L124P
HEC6	Endometrium	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
HEC6	Endometrium	DNMT3B	20	31383281	31383281	1	Missense_Mutation	c.1193G>A	p.R398H
HEC6	Endometrium	NCOA3	20	46264163	46264163	1	Missense_Mutation	c.1210T>C	p.S404P
HEC6	Endometrium	NCOA3	20	46277771	46277771	1	Missense_Mutation	c.3569C>A	p.A1190E
HEC6	Endometrium	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HEC6	Endometrium	HDAC3	5	141004793	141004793	-1	Missense_Mutation	c.1199C>A	p.P400H
HEC6	Endometrium	NIPBL	5	36972065	36972065	1	Missense_Mutation	c.790A>T	p.M264L
HEC6	Endometrium	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
HEC6	Endometrium	NIPBL	5	36985704	36985704	1	Nonsense_Mutation	c.2422C>T	p.R808*
HEC6	Endometrium	NIPBL	5	37026359	37026359	1	Missense_Mutation	c.5738T>C	p.L1913P
HEC6	Endometrium	NIPBL	5	37038740	37038740	1	Missense_Mutation	c.6008T>G	p.V2003G
HEC6	Endometrium	NIPBL	5	37064713	37064713	1	Missense_Mutation	c.8134G>A	p.A2712T
HEC6	Endometrium	HDAC2	6	114292205	114292205	-1	5'UTR	c.150C>A	p.A50A
HEC6	Endometrium	KMT2C	7	151841811	151841811	-1	Missense_Mutation	c.14330G>A	p.R4777Q
HEC6	Endometrium	KMT2C	7	151902220	151902221	-1	Frame_Shift_Del	c.3931_3932delAT	p.I1311fs
HEC6	Endometrium	TRRAP	7	98527649	98527649	1	Missense_Mutation	c.3213G>T	p.Q1071H
HEC6	Endometrium	TRRAP	7	98562347	98562347	1	Missense_Mutation	c.6904C>T	p.R2302W
HEC6	Endometrium	TRRAP	7	98589769	98589769	1	Missense_Mutation	c.9778G>A	p.V3260M
HEC6	Endometrium	TRRAP	7	98609124	98609124	1	Missense_Mutation	c.11261C>T	p.A3754V
HEC6	Endometrium	WHSC1L1	8	38135832	38135832	-1	Missense_Mutation	c.3859C>T	p.R1287W
HEC6	Endometrium	TAF1L	9	32630344	32630344	-1	Missense_Mutation	c.5234C>T	p.A1745V
HEC6	Endometrium	TAF1L	9	32633504	32633504	-1	Missense_Mutation	c.2074G>T	p.G692C
HEC6	Endometrium	KDM6A	X	44966657	44966657	1	Missense_Mutation	c.4037A>G	p.Y1346C
HEC6	Endometrium	HDAC6	X	48678603	48678603	1	Missense_Mutation	c.2278G>A	p.A760T
HEC6	Endometrium	ATRX	X	76939613	76939613	-1	Missense_Mutation	c.1135G>T	p.D379Y
HEL9217	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HEL9217	Haematopoietic and lymphoid tissue	PHF3	6	64389952	64389952	1	Missense_Mutation	c.296A>G	p.N99S
HEL	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HEL	Haematopoietic and lymphoid tissue	PHF3	6	64389952	64389952	1	Missense_Mutation	c.296A>G	p.N99S
HEPG2	Liver	BRDT	1	92446270	92446270	1	Missense_Mutation	c.1370A>C	p.E457A
HEPG2	Liver	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
HEPG2	Liver	NIPBL	5	37057297	37057297	1	Missense_Mutation	c.7273G>A	p.V2425M
HEYA8	Ovary	TP53BP1	15	43713344	43713345	-1	Frame_Shift_Ins	c.4128_4129insG	p.G1376fs
HEYA8	Ovary	TP53BP1	15	43713354	43713354	-1	Missense_Mutation	c.4119T>G	p.S1373R
HEYA8	Ovary	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
HGC27	Stomach	CHD5	1	6206846	6206846	-1	Missense_Mutation	c.1469G>A	p.G490E
HGC27	Stomach	EP300	22	41573312	41573312	1	Missense_Mutation	c.5597C>T	p.P1866L
HH	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HLF	Liver	KMT2A	11	118362596	118362596	1	Missense_Mutation	c.4957G>A	p.A1653T
HLF	Liver	MLLT6	17	36865472	36865472	1	Missense_Mutation	c.401C>T	p.S134L
HLF	Liver	TFPT	19	54613456	54613456	-1	Missense_Mutation	c.331C>T	p.R111W
HLFA	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HLFA	Lung	NSD1	5	176639097	176639097	1	Missense_Mutation	c.3697C>T	p.R1233W
HMC18	Breast	RAI1	17	17697094	17697102	1	In_Frame_Del	c.832_840delCAGCAGCAG	p.QQQ287del
HOS	Bone	CHD8	14	21862547	21862547	-1	Missense_Mutation	c.4651C>T	p.R1551C
HOS	Bone	IDH1	2	209106791	209106791	-1	Missense_Mutation	c.777G>A	p.M259I
HOS	Bone	NSD1	5	176638686	176638686	1	Missense_Mutation	c.3286C>T	p.H1096Y
HPBALL	Haematopoietic and lymphoid tissue	CHD5	1	6211176	6211176	-1	Missense_Mutation	c.910G>A	p.A304T
HPBALL	Haematopoietic and lymphoid tissue	SIRT1	10	69672747	69672747	1	Missense_Mutation	c.1874C>T	p.P625L
HPBALL	Haematopoietic and lymphoid tissue	KMT2A	11	118374970	118374970	1	Missense_Mutation	c.8363C>A	p.S2788Y
HPBALL	Haematopoietic and lymphoid tissue	MGA	15	42054027	42054027	1	Missense_Mutation	c.7489C>G	p.R2497G
HPBALL	Haematopoietic and lymphoid tissue	TFPT	19	54618021	54618021	-1	Missense_Mutation	c.83T>C	p.L28S
HPBALL	Haematopoietic and lymphoid tissue	EP300	22	41573032	41573032	1	Missense_Mutation	c.5317C>T	p.R1773W
HPBALL	Haematopoietic and lymphoid tissue	WHSC1	4	1902923	1902923	1	Missense_Mutation	c.542A>G	p.Q181R
HPBALL	Haematopoietic and lymphoid tissue	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
HPBALL	Haematopoietic and lymphoid tissue	KMT2C	7	151874835	151874835	-1	Missense_Mutation	c.7703G>T	p.G2568V
HPBALL	Haematopoietic and lymphoid tissue	TRRAP	7	98513350	98513350	1	Missense_Mutation	c.2204A>G	p.H735R
HPBALL	Haematopoietic and lymphoid tissue	BRD3	9	136918586	136918586	-1	Missense_Mutation	c.14C>T	p.T5M
HPBALL	Haematopoietic and lymphoid tissue	HDAC8	X	71710815	71710815	-1	Missense_Mutation	c.592G>A	p.V198M
HRT18	Large intestine	LMNA	1	156105059	156105059	1	Missense_Mutation	c.892C>T	p.R298C
HRT18	Large intestine	LMNA	1	156105902	156105902	1	Missense_Mutation	c.1147G>A	p.E383K
HRT18	Large intestine	ARID1A	1	27099865	27099865	1	Silent	c.3744A>C	p.S1248S
HRT18	Large intestine	PRDM16	1	3328712	3328712	1	Missense_Mutation	c.1951G>T	p.G651C
HRT18	Large intestine	CHD5	1	6188630	6188630	-1	Missense_Mutation	c.3659C>A	p.P1220H
HRT18	Large intestine	CHD5	1	6206455	6206455	-1	Missense_Mutation	c.1619G>A	p.R540H
HRT18	Large intestine	TET1	10	70332337	70332337	1	Missense_Mutation	c.242G>A	p.R81H
HRT18	Large intestine	TET1	10	70332625	70332625	1	Missense_Mutation	c.530A>C	p.N177T
HRT18	Large intestine	TET1	10	70333431	70333431	1	Missense_Mutation	c.1336C>T	p.P446S
HRT18	Large intestine	TET1	10	70411644	70411644	1	Missense_Mutation	c.4318C>A	p.L1440I
HRT18	Large intestine	KAT6B	10	76789052	76789052	1	Missense_Mutation	c.4470G>T	p.K1490N
HRT18	Large intestine	KAT6B	10	76790499	76790499	1	Missense_Mutation	c.5917C>T	p.P1973S
HRT18	Large intestine	KMT2A	11	118373149	118373149	1	Missense_Mutation	c.6542T>C	p.V2181A
HRT18	Large intestine	KMT2A	11	118374193	118374193	1	Missense_Mutation	c.7586C>A	p.P2529H
HRT18	Large intestine	ZMYM2	13	20580542	20580542	1	Missense_Mutation	c.1328T>C	p.M443T
HRT18	Large intestine	ZMYM2	13	20625672	20625672	1	Missense_Mutation	c.2392C>T	p.R798C
HRT18	Large intestine	CHD8	14	21861956	21861956	-1	Missense_Mutation	c.5161C>T	p.R1721C
HRT18	Large intestine	TP53BP1	15	43784544	43784544	-1	Missense_Mutation	c.130C>T	p.H44Y
HRT18	Large intestine	CHD9	16	53338220	53338220	1	Missense_Mutation	c.6302A>G	p.D2101G
HRT18	Large intestine	SUZ12	17	30322689	30322689	1	Missense_Mutation	c.1702A>G	p.S568G
HRT18	Large intestine	KAT7	17	47895299	47895299	1	Missense_Mutation	c.1081C>T	p.R361W
HRT18	Large intestine	SMARCA4	19	11132437	11132437	1	Missense_Mutation	c.2653C>T	p.R885C
HRT18	Large intestine	BRD4	19	15355374	15355374	-1	Missense_Mutation	c.2249C>T	p.P750L
HRT18	Large intestine	LMNB2	19	2435123	2435123	-1	Missense_Mutation	c.731T>C	p.V244A
HRT18	Large intestine	LMNB2	19	2435125	2435125	-1	Missense_Mutation	c.729G>T	p.E243D
HRT18	Large intestine	IDH1	2	209113217	209113217	-1	Missense_Mutation	c.290G>A	p.G97D
HRT18	Large intestine	MSH6	2	48025989	48025989	1	Frame_Shift_Del	c.867_867delC	p.G289fs
HRT18	Large intestine	EP300	22	41548252	41548252	1	Nonsense_Mutation	c.3040G>T	p.E1014*
HRT18	Large intestine	BAP1	3	52437611	52437611	-1	Missense_Mutation	c.1550C>T	p.T517M
HRT18	Large intestine	BAP1	3	52442509	52442509	-1	Missense_Mutation	c.236A>G	p.N79S
HRT18	Large intestine	BAP1	3	52443742	52443742	-1	Missense_Mutation	c.55G>A	p.V19M
HRT18	Large intestine	HDAC3	5	141008779	141008779	-1	Missense_Mutation	c.571T>C	p.S191P
HRT18	Large intestine	NSD1	5	176722244	176722244	1	Missense_Mutation	c.7875G>T	p.W2625C
HRT18	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
HRT18	Large intestine	NIPBL	5	37001175	37001175	1	Missense_Mutation	c.3659C>T	p.A1220V
HRT18	Large intestine	CHD1	5	98205540	98205540	-1	Missense_Mutation	c.4025T>C	p.M1342T
HRT18	Large intestine	JARID2	6	15507578	15507578	1	Missense_Mutation	c.2662C>T	p.H888Y
HRT18	Large intestine	PHF3	6	64394701	64394701	1	Missense_Mutation	c.1078C>A	p.L360I
HRT18	Large intestine	KMT2C	7	151860349	151860349	-1	Missense_Mutation	c.10313G>A	p.G3438D
HRT18	Large intestine	NCOA2	8	71044196	71044196	-1	Missense_Mutation	c.3200A>G	p.H1067R
HRT18	Large intestine	NCOA2	8	71071813	71071813	-1	Missense_Mutation	c.1051A>T	p.T351S
HRT18	Large intestine	BRD3	9	136913396	136913396	-1	Missense_Mutation	c.895C>T	p.P299S
HRT18	Large intestine	BRD3	9	136913458	136913458	-1	Missense_Mutation	c.833G>A	p.R278Q
HRT18	Large intestine	ATRX	X	76938862	76938862	-1	Missense_Mutation	c.1886T>G	p.L629R
HS281T	Breast	KDM6A	X	44870249	44870249	1	Missense_Mutation	c.428A>G	p.Y143C
HS571T	Ovary	CHD5	1	6214746	6214746	-1	Missense_Mutation	c.719G>A	p.R240H
HS571T	Ovary	SMARCA4	19	11113807	11113807	1	Frame_Shift_Del	c.1915_1915delC	p.L639fs
HS578T	Breast	HNF1A	12	121432070	121432070	1	Missense_Mutation	c.817A>G	p.K273E
HS600T	Skin	KMT2C	7	151859815	151859816	-1	In_Frame_Ins	c.10846_10847insATG	p.3615_3616insD
HS604T	Haematopoietic and lymphoid tissue	CREBBP	16	3819311	3819311	-1	Missense_Mutation	c.2924C>T	p.P975L
HS611T	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HS616T	Haematopoietic and lymphoid tissue	KDM5A	12	420070	420070	-1	Missense_Mutation	c.3197C>G	p.S1066C
HS618T	Lung	ARID1A	1	27101022	27101022	1	Missense_Mutation	c.4304A>G	p.Y1435C
HS618T	Lung	TRIM24	7	138268735	138268735	1	Missense_Mutation	c.2934A>C	p.E978D
HS618T	Lung	ATRX	X	76919029	76919029	-1	Missense_Mutation	c.3962A>G	p.N1321S
HS675T	Large intestine	CHD5	1	6203888	6203888	-1	Missense_Mutation	c.2038G>T	p.V680L
HS675T	Large intestine	KMT2A	11	118376881	118376881	1	Missense_Mutation	c.10274C>T	p.A3425V
HS675T	Large intestine	CHD9	16	53319530	53319531	1	Missense_Mutation	c.4990_4991GA>CC	p.E1664P
HS675T	Large intestine	TAF1L	9	32635108	32635108	-1	Missense_Mutation	c.470C>T	p.P157L
HS683	Central nervous system	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
HS683	Central nervous system	PHF3	6	64395640	64395640	1	Missense_Mutation	c.2017C>T	p.R673C
HS695T	Skin	KAT6B	10	76603234	76603234	1	Missense_Mutation	c.619C>G	p.Q207E
HS695T	Skin	KDM5A	12	416197	416197	-1	Missense_Mutation	c.3989C>T	p.S1330F
HS695T	Skin	CHD9	16	53276922	53276922	1	Missense_Mutation	c.3048G>A	p.M1016I
HS695T	Skin	NIPBL	5	36995737	36995737	1	Missense_Mutation	c.3135A>T	p.Q1045H
HS698T	Large intestine	KDM5A	12	420184	420184	-1	Missense_Mutation	c.3083C>T	p.A1028V
HS698T	Large intestine	CHD9	16	53358719	53358719	1	Missense_Mutation	c.8606A>G	p.D2869G
HS698T	Large intestine	ARID1B	6	157099333	157099335	1	In_Frame_Del	c.96_98delCCA	p.H38del
HS698T	Large intestine	KMT2C	7	151873293	151873293	-1	Missense_Mutation	c.9245C>T	p.P3082L
HS729	Soft tissue	MGA	15	42053982	42053982	1	Missense_Mutation	c.7444A>G	p.I2482V
HS729	Soft tissue	DNMT3B	20	31389203	31389203	1	Missense_Mutation	c.2116G>A	p.D706N
HS729	Soft tissue	ATRX	X	76890109	76890109	-1	Nonsense_Mutation	c.4785T>A	p.C1595*
HS737T	Bone	PRDM16	1	3328826	3328826	1	Missense_Mutation	c.2065G>C	p.A689P
HS737T	Bone	IDH1	2	209113355	209113355	-1	Missense_Mutation	c.152C>G	p.A51G
HS737T	Bone	KAT6A	8	41789921	41789921	-1	Missense_Mutation	c.5817C>A	p.N1939K
HS746T	Stomach	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
HS746T	Stomach	NSD1	5	176694654	176694654	1	Missense_Mutation	c.5238T>G	p.N1746K
HS746T	Stomach	DAXX	6	33287438	33287438	-1	Missense_Mutation	c.1695G>C	p.E565D
HS746T	Stomach	NCOA2	8	71069432	71069432	-1	Missense_Mutation	c.1168A>C	p.T390P
HS751T	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HS751T	Haematopoietic and lymphoid tissue	BAG6	6	31609982	31609982	-1	Frame_Shift_Del	c.2152_2152delG	p.A718fs
HS766T	Pancreas	ARID1A	1	27057904	27057904	1	Nonsense_Mutation	c.1612C>T	p.Q538*
HS766T	Pancreas	KMT2A	11	118343290	118343290	1	Missense_Mutation	c.1416G>A	p.M472I
HS766T	Pancreas	SP140	2	231120208	231120208	1	Missense_Mutation	c.1201C>T	p.R401C
HS766T	Pancreas	KMT2C	7	151945028	151945028	-1	Missense_Mutation	c.2491A>G	p.T831A
HS766T	Pancreas	ZBTB33	X	119387833	119387834	1	In_Frame_Ins	c.563_564insTGA	p.194_195insD
HS819T	Bone	BRD2	6	32948364	32948364	1	Missense_Mutation	c.2380G>A	p.E794K
HS821T	Bone	CHD5	1	6185666	6185666	-1	Missense_Mutation	c.4178G>T	p.R1393L
HS821T	Bone	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
HS821T	Bone	EP300	22	41513561	41513561	1	Missense_Mutation	c.465C>G	p.N155K
HS821T	Bone	NIPBL	5	36971047	36971047	1	Missense_Mutation	c.680T>G	p.L227W
HS822T	Bone	NSD1	5	176638597	176638597	1	Missense_Mutation	c.3197C>T	p.A1066V
HS834T	Skin	EP300	22	41527444	41527446	1	In_Frame_Del	c.1335_1337delGGG	p.G446del
HS839T	Skin	ERCC6	10	50738779	50738779	-1	Missense_Mutation	c.530A>G	p.Q177R
HS839T	Skin	KAT6B	10	76781905	76781906	1	In_Frame_Ins	c.3288_3289insGAA	p.1104_1105insE
HS839T	Skin	MSH6	2	48027633	48027633	1	Missense_Mutation	c.2511C>G	p.H837Q
HS852T	Skin	MGA	15	42052632	42052632	1	Missense_Mutation	c.7303C>T	p.R2435W
HS852T	Skin	MLLT6	17	36872038	36872038	1	Silent	c.993C>T	p.S331S
HS852T	Skin	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
HS863T	Bone	BRDT	1	92428412	92428412	1	Missense_Mutation	c.101A>G	p.Y34C
HS888T	Bone	ING1	13	111367955	111367955	1	Missense_Mutation	c.165C>A	p.N55K
HS888T	Bone	WHSC1L1	8	38146228	38146228	-1	Missense_Mutation	c.3278C>T	p.S1093L
HS934T	Skin	CHD1	5	98192095	98192095	-1	Missense_Mutation	c.5122C>T	p.R1708W
HS936T	Skin	PRDM16	1	3328245	3328245	1	Missense_Mutation	c.1484C>G	p.P495R
HS936T	Skin	TET2	4	106155146	106155146	1	Missense_Mutation	c.110C>T	p.P37L
HS936T	Skin	KMT2C	7	151878920	151878920	-1	Nonsense_Mutation	c.6025A>T	p.K2009*
HS936T	Skin	ATRX	X	76907782	76907784	-1	In_Frame_Del	c.4377_4379delGGA	p.1459_1460EE>E
HS940T	Skin	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
HS944T	Skin	CHD5	1	6170023	6170023	-1	Missense_Mutation	c.5410G>A	p.E1804K
HS944T	Skin	DNMT1	19	10265400	10265400	-1	Missense_Mutation	c.1694C>T	p.S565F
HS944T	Skin	SMARCA4	19	11123707	11123707	1	Missense_Mutation	c.2357C>T	p.T786I
HS944T	Skin	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
HS944T	Skin	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HSC2	Upper aerodigestive tract	KDM5A	12	404779	404779	-1	Missense_Mutation	c.4415C>A	p.T1472K
HSC2	Upper aerodigestive tract	TET2	4	106157539	106157539	1	Missense_Mutation	c.2503C>T	p.R835C
HSC2	Upper aerodigestive tract	KMT2C	7	151845580	151845581	-1	Frame_Shift_Ins	c.13431_13432insT	p.F4477fs
HSC3	Upper aerodigestive tract	MLLT10	10	22016808	22016808	1	Missense_Mutation	c.2062C>T	p.R688C
HSC3	Upper aerodigestive tract	CHD8	14	21862612	21862612	-1	Missense_Mutation	c.4586G>A	p.R1529Q
HSC3	Upper aerodigestive tract	NCOA3	20	46279860	46279861	1	In_Frame_Ins	c.3786_3787insCAA	p.1276_1277insQ
HSC4	Upper aerodigestive tract	MLLT10	10	21959505	21959505	1	Nonsense_Mutation	c.923C>G	p.S308*
HSC4	Upper aerodigestive tract	ZMYM2	13	20635316	20635316	1	Missense_Mutation	c.2863G>C	p.D955H
HSC4	Upper aerodigestive tract	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HSC4	Upper aerodigestive tract	KMT2C	7	151949117	151949117	-1	Missense_Mutation	c.1528G>C	p.E510Q
HSC4	Upper aerodigestive tract	TAF1	X	70597666	70597666	1	Missense_Mutation	c.988G>A	p.D330N
HT1080	Soft tissue	LMNB2	19	2431824	2431824	-1	Missense_Mutation	c.1667C>T	p.T556M
HT1080	Soft tissue	IDH1	2	209113113	209113113	-1	Missense_Mutation	c.394C>T	p.R132C
HT115	Large intestine	PRDM16	1	3301793	3301793	1	Silent	c.516C>T	p.I172I
HT115	Large intestine	CHD5	1	6196672	6196672	-1	Missense_Mutation	c.2601G>T	p.K867N
HT115	Large intestine	BMI1	10	22617066	22617066	1	Missense_Mutation	c.858G>T	p.L286F
HT115	Large intestine	BMI1	10	22618173	22618173	1	Missense_Mutation	c.1112G>A	p.R371Q
HT115	Large intestine	TET1	10	70333611	70333611	1	Missense_Mutation	c.1516A>C	p.S506R
HT115	Large intestine	TET1	10	70404489	70404489	1	Missense_Mutation	c.2003A>C	p.K668T
HT115	Large intestine	TET1	10	70405915	70405915	1	Missense_Mutation	c.3429G>T	p.K1143N
HT115	Large intestine	KAT6B	10	76719776	76719776	1	Nonsense_Mutation	c.670G>T	p.E224*
HT115	Large intestine	KMT2A	11	118344036	118344036	1	Missense_Mutation	c.2162G>A	p.R721Q
HT115	Large intestine	KDM5A	12	416138	416138	-1	Nonsense_Mutation	c.4048C>T	p.R1350*
HT115	Large intestine	KDM5A	12	463247	463247	-1	Missense_Mutation	c.1024G>A	p.A342T
HT115	Large intestine	KDM5A	12	475146	475146	-1	Missense_Mutation	c.491G>T	p.R164I
HT115	Large intestine	CHD8	14	21883118	21883118	-1	Missense_Mutation	c.1166T>C	p.F389S
HT115	Large intestine	CHD8	14	21896242	21896242	-1	Missense_Mutation	c.550C>T	p.R184W
HT115	Large intestine	MGA	15	42019410	42019410	1	Nonsense_Mutation	c.3463C>T	p.R1155*
HT115	Large intestine	MGA	15	42050033	42050033	1	Missense_Mutation	c.7187G>A	p.R2396Q
HT115	Large intestine	MGA	15	42054533	42054533	1	Missense_Mutation	c.7717C>A	p.L2573I
HT115	Large intestine	TP53BP1	15	43720257	43720257	-1	Missense_Mutation	c.3785T>C	p.V1262A
HT115	Large intestine	CREBBP	16	3779193	3779193	-1	Missense_Mutation	c.5855C>T	p.P1952L
HT115	Large intestine	ATF2	2	175939523	175939523	-1	Silent	c.1332G>A	p.P444P
HT115	Large intestine	ATF2	2	175982844	175982844	-1	Missense_Mutation	c.321G>A	p.M107I
HT115	Large intestine	MSH6	2	48027854	48027854	1	Missense_Mutation	c.2732G>A	p.R911Q
HT115	Large intestine	NCOA3	20	46275981	46275981	1	Missense_Mutation	c.3417G>A	p.M1139I
HT115	Large intestine	ATXN7	3	63898360	63898361	1	In_Frame_Ins	c.86_87insGCAGCA	p.39_40insQQ
HT115	Large intestine	HDAC3	5	141001061	141001061	-1	Missense_Mutation	c.1261G>T	p.D421Y
HT115	Large intestine	NIPBL	5	36975971	36975971	1	Missense_Mutation	c.962G>T	p.R321I
HT115	Large intestine	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
HT115	Large intestine	PHF3	6	64394228	64394228	1	Missense_Mutation	c.605G>A	p.R202Q
HT115	Large intestine	PHF3	6	64395641	64395641	1	Missense_Mutation	c.2018G>A	p.R673H
HT115	Large intestine	PHIP	6	79679609	79679609	-1	Missense_Mutation	c.3148G>T	p.D1050Y
HT115	Large intestine	PHIP	6	79726294	79726294	-1	Missense_Mutation	c.1202G>A	p.S401N
HT115	Large intestine	KMT2C	7	151851508	151851508	-1	Nonsense_Mutation	c.11983C>T	p.R3995*
HT115	Large intestine	KMT2C	7	151874972	151874972	-1	Missense_Mutation	c.7566G>C	p.M2522I
HT115	Large intestine	KMT2C	7	151884466	151884466	-1	Missense_Mutation	c.4889C>T	p.S1630L
HT115	Large intestine	KMT2C	7	151949069	151949069	-1	Missense_Mutation	c.1576C>T	p.R526C
HT115	Large intestine	STK31	7	23768755	23768755	1	Nonsense_Mutation	c.370C>T	p.R124*
HT115	Large intestine	TRRAP	7	98515205	98515205	1	Missense_Mutation	c.2525T>C	p.V842A
HT115	Large intestine	WHSC1L1	8	38186946	38186946	-1	Missense_Mutation	c.1531A>G	p.N511D
HT115	Large intestine	KAT6A	8	41792241	41792241	-1	Missense_Mutation	c.3497G>T	p.R1166I
HT115	Large intestine	BRD3	9	136918489	136918489	-1	Missense_Mutation	c.111C>G	p.N37K
HT115	Large intestine	PSIP1	9	15466833	15466833	-1	Missense_Mutation	c.1445C>A	p.S482Y
HT115	Large intestine	PSIP1	9	15474111	15474112	-1	Frame_Shift_Ins	c.753_754insA	p.K251fs
HT115	Large intestine	TAF1L	9	32630248	32630248	-1	Missense_Mutation	c.5330G>A	p.G1777E
HT115	Large intestine	ATRX	X	76937335	76937335	-1	Missense_Mutation	c.3413G>T	p.R1138I
HT115	Large intestine	ATRX	X	76938141	76938141	-1	Missense_Mutation	c.2607G>T	p.K869N
HT1376	Urinary tract	ARID1A	1	27023451	27023464	1	Frame_Shift_Del	c.557_570delGCGGCGGCGGCGGG	p.S186fs
HT1376	Urinary tract	NIPBL	5	36985729	36985729	1	Missense_Mutation	c.2447G>A	p.R816H
HT1376	Urinary tract	NIPBL	5	36986185	36986185	1	Missense_Mutation	c.2903A>G	p.N968S
HT29	Large intestine	PRDM16	1	3301728	3301728	1	Missense_Mutation	c.451C>G	p.L151V
HT29	Large intestine	CHD9	16	53190863	53190863	1	Nonsense_Mutation	c.862C>T	p.Q288*
HT29	Large intestine	TRIM24	7	138263991	138263991	1	Missense_Mutation	c.2299A>G	p.S767G
HT29	Large intestine	KMT2C	7	151877118	151877118	-1	Missense_Mutation	c.7243C>T	p.P2415S
HT29	Large intestine	BRD3	9	136916738	136916738	-1	Missense_Mutation	c.445C>G	p.P149A
HT55	Large intestine	ERCC6	10	50740912	50740912	-1	Missense_Mutation	c.99A>T	p.Q33H
HT55	Large intestine	TET1	10	70332653	70332653	1	Missense_Mutation	c.558A>T	p.Q186H
HT55	Large intestine	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
HT55	Large intestine	KAT7	17	47869293	47869293	1	Missense_Mutation	c.61T>C	p.S21P
HT55	Large intestine	KMT2C	7	151884843	151884843	-1	Missense_Mutation	c.4750G>A	p.G1584R
HT55	Large intestine	SET	9	131455984	131455984	1	Missense_Mutation	c.599A>C	p.E200A
HT55	Large intestine	TAF1L	9	32634517	32634517	-1	Missense_Mutation	c.1061A>T	p.K354I
HT55	Large intestine	ATRX	X	76939456	76939456	-1	Missense_Mutation	c.1292A>T	p.E431V
HT	Haematopoietic and lymphoid tissue	HDAC1	1	32793271	32793271	1	Missense_Mutation	c.629A>G	p.D210G
HT	Haematopoietic and lymphoid tissue	MLLT10	10	21962348	21962348	1	Missense_Mutation	c.1121T>A	p.F374Y
HT	Haematopoietic and lymphoid tissue	HNF1A	12	121437299	121437299	1	Missense_Mutation	c.1658A>G	p.D553G
HT	Haematopoietic and lymphoid tissue	KDM5A	12	475171	475171	-1	Missense_Mutation	c.466T>C	p.S156P
HT	Haematopoietic and lymphoid tissue	CHD8	14	21854221	21854221	-1	Missense_Mutation	c.6460A>G	p.M2154V
HT	Haematopoietic and lymphoid tissue	MGA	15	42050036	42050036	1	Missense_Mutation	c.7190A>G	p.K2397R
HT	Haematopoietic and lymphoid tissue	SMARCA4	19	11132457	11132457	1	Missense_Mutation	c.2673C>G	p.C891W
HT	Haematopoietic and lymphoid tissue	ATF2	2	175939529	175939529	-1	Silent	c.1326A>C	p.S442S
HT	Haematopoietic and lymphoid tissue	EP300	22	41569645	41569645	1	Frame_Shift_Del	c.4636_4636delA	p.K1546fs
HT	Haematopoietic and lymphoid tissue	NSD1	5	176562715	176562715	1	Missense_Mutation	c.611A>G	p.K204R
HT	Haematopoietic and lymphoid tissue	BRD2	6	32948215	32948215	1	Missense_Mutation	c.2348A>G	p.N783S
HT	Haematopoietic and lymphoid tissue	STK31	7	23751889	23751889	1	Missense_Mutation	c.134T>C	p.V45A
HT	Haematopoietic and lymphoid tissue	STK31	7	23793966	23793966	1	Missense_Mutation	c.1166A>C	p.D389A
HT	Haematopoietic and lymphoid tissue	TRRAP	7	98507728	98507728	1	Frame_Shift_Del	c.1400_1400delT	p.I467fs
HT	Haematopoietic and lymphoid tissue	KDM6A	X	44942751	44942751	1	Missense_Mutation	c.3487C>T	p.R1163C
HTK	Haematopoietic and lymphoid tissue	CHD8	14	21862547	21862547	-1	Missense_Mutation	c.4651C>T	p.R1551C
HTK	Haematopoietic and lymphoid tissue	EP300	22	41574490	41574490	1	Missense_Mutation	c.6775G>A	p.A2259T
HTK	Haematopoietic and lymphoid tissue	NSD1	5	176638686	176638686	1	Missense_Mutation	c.3286C>T	p.H1096Y
HTK	Haematopoietic and lymphoid tissue	ARID1B	6	157099426	157099427	1	In_Frame_Ins	c.189_190insCAG	p.73_74insQ
HUCCT1	Biliary tract	ZMYM2	13	20577001	20577001	1	Missense_Mutation	c.859T>G	p.S287A
HUG1N	Stomach	KMT2D	12	49426754	49426759	-1	In_Frame_Del	c.11729_11734delAGCAAC	p.QQ3910del
HUG1N	Stomach	CHD9	16	53269101	53269101	1	Missense_Mutation	c.2516G>A	p.R839H
HUG1N	Stomach	CHD9	16	53358353	53358353	1	Missense_Mutation	c.8240C>G	p.S2747C
HUG1N	Stomach	HDAC4	2	240036897	240036897	-1	Missense_Mutation	c.1628G>T	p.R543L
HUG1N	Stomach	MSH6	2	48030630	48030630	1	Missense_Mutation	c.3244C>T	p.P1082S
HUG1N	Stomach	TAF1L	9	32633080	32633080	-1	Missense_Mutation	c.2498T>C	p.L833P
HUH28	Biliary tract	ARID1A	1	27088666	27088666	1	Missense_Mutation	c.2275A>G	p.M759V
HUH28	Biliary tract	NCOA3	20	46279831	46279836	1	In_Frame_Del	c.3757_3762delCAGCAA	p.QQ1275del
HUH28	Biliary tract	SMARCB1	22	24143309	24143309	1	Intron	c.514G>A	p.A172T
HUH28	Biliary tract	KDM6A	X	44938495	44938495	1	Missense_Mutation	c.3199A>G	p.T1067A
HUH6	Liver	BRD4	19	15365010	15365010	-1	Missense_Mutation	c.2111A>T	p.E704V
HUH6	Liver	BRD2	6	32944480	32944480	1	Missense_Mutation	c.967C>T	p.P323S
HUH6	Liver	STK31	7	23810655	23810655	1	Nonsense_Mutation	c.1745C>A	p.S582*
HUH6	Liver	TNRC18	7	5352636	5352638	-1	In_Frame_Del	c.7884_7886delCTC	p.2628_2629SS>S
HUH7	Liver	KMT2C	7	151864281	151864281	-1	Missense_Mutation	c.9700C>T	p.L3234F
HUH7	Liver	TAF1	X	70596818	70596818	1	Intron	c.551G>T	p.G184V
HUNS1	Haematopoietic and lymphoid tissue	MGA	15	42034822	42034822	1	Missense_Mutation	c.4664G>A	p.G1555E
HUNS1	Haematopoietic and lymphoid tissue	SP140	2	231177313	231177313	1	Missense_Mutation	c.2518G>A	p.G840S
HUNS1	Haematopoietic and lymphoid tissue	NSD1	5	176684035	176684035	1	Nonsense_Mutation	c.4849G>T	p.E1617*
HUNS1	Haematopoietic and lymphoid tissue	TRRAP	7	98495461	98495461	1	Missense_Mutation	c.605C>T	p.P202L
HUPT3	Pancreas	CHD5	1	6189106	6189106	-1	Silent	c.3411C>T	p.I1137I
HUPT3	Pancreas	MSH6	2	48033981	48033982	1	Frame_Shift_Ins	c.4065_4066insTTGA	p.T1355fs
HUPT3	Pancreas	NIPBL	5	37014818	37014819	1	In_Frame_Ins	c.4594_4595insATA	p.1532_1532E>DK
HUPT4	Pancreas	MSH6	2	48025909	48025909	1	Missense_Mutation	c.787G>A	p.V263M
HUT102	Haematopoietic and lymphoid tissue	TET2	4	106158300	106158303	1	Frame_Shift_Del	c.3264_3267delACAA	p.R1088fs
HUT102	Haematopoietic and lymphoid tissue	KMT2C	7	151927402	151927402	-1	Missense_Mutation	c.2774C>T	p.S925F
HUT78	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
HUT78	Haematopoietic and lymphoid tissue	KMT2C	7	151849808	151849808	-1	Missense_Mutation	c.12508T>A	p.F4170I
HUT78	Haematopoietic and lymphoid tissue	TAF1L	9	32631518	32631518	-1	Missense_Mutation	c.4060G>A	p.E1354K
IALM	Lung	PHF3	6	64422804	64422804	1	Missense_Mutation	c.5320G>A	p.E1774K
IALM	Lung	KMT2C	7	151851393	151851393	-1	Missense_Mutation	c.12098C>T	p.P4033L
IALM	Lung	KMT2C	7	151893019	151893019	-1	Missense_Mutation	c.4351G>T	p.D1451Y
IALM	Lung	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
IGR37	Skin	MEN1	11	64575402	64575402	-1	Missense_Mutation	c.630C>A	p.D210E
IGR37	Skin	NIPBL	5	37063925	37063927	1	In_Frame_Del	c.7894_7896delGAA	p.E2636del
IGR37	Skin	TNRC18	7	5352636	5352638	-1	In_Frame_Del	c.7884_7886delCTC	p.2628_2629SS>S
IGR39	Skin	MEN1	11	64575402	64575402	-1	Missense_Mutation	c.630C>A	p.D210E
IGROV1	Ovary	SETDB1	1	150936510	150936510	1	Missense_Mutation	c.3709G>A	p.V1237M
IGROV1	Ovary	ARID1A	1	27023716	27023716	1	Frame_Shift_Del	c.822_822delG	p.M274fs
IGROV1	Ovary	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
IGROV1	Ovary	KMT2A	11	118392772	118392772	1	Missense_Mutation	c.11804G>A	p.R3935H
IGROV1	Ovary	CHD8	14	21854217	21854217	-1	Missense_Mutation	c.6464A>G	p.Q2155R
IGROV1	Ovary	CHD8	14	21883992	21883992	-1	Missense_Mutation	c.954A>T	p.E318D
IGROV1	Ovary	MGA	15	42021442	42021442	1	Frame_Shift_Del	c.3738_3738delA	p.R1246fs
IGROV1	Ovary	CREBBP	16	3807941	3807941	-1	Missense_Mutation	c.3478A>G	p.M1160V
IGROV1	Ovary	SMARCA4	19	11144049	11144051	1	In_Frame_Del	c.3630_3632delGGA	p.E1212del
IGROV1	Ovary	TRIM28	19	59061780	59061780	1	Missense_Mutation	c.2368C>T	p.R790C
IGROV1	Ovary	ATF2	2	175957949	175957949	-1	Missense_Mutation	c.1025G>A	p.R342H
IGROV1	Ovary	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
IGROV1	Ovary	DNMT3B	20	31387128	31387128	1	Missense_Mutation	c.1753G>A	p.A585T
IGROV1	Ovary	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
IGROV1	Ovary	CHD1	5	98236745	98236745	-1	Frame_Shift_Del	c.629_629delA	p.K210fs
IGROV1	Ovary	KMT2C	7	151874148	151874149	-1	Frame_Shift_Del	c.8389_8390delAA	p.K2797fs
IGROV1	Ovary	NCOA2	8	71068387	71068387	-1	Missense_Mutation	c.2213A>G	p.K738R
IGROV1	Ovary	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
IGROV1	Ovary	HDAC8	X	71787792	71787792	-1	Silent	c.384C>T	p.D128D
IM95	Stomach	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
IM95	Stomach	SIRT1	10	69648795	69648795	1	Frame_Shift_Del	c.703_703delA	p.K235fs
IM95	Stomach	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
IM95	Stomach	CHD8	14	21861835	21861835	-1	Missense_Mutation	c.5282A>G	p.D1761G
IM95	Stomach	MGA	15	41961400	41961400	1	Missense_Mutation	c.308G>A	p.R103H
IM95	Stomach	TP53BP1	15	43712845	43712845	-1	Frame_Shift_Del	c.4339_4339delC	p.R1447fs
IM95	Stomach	CHD9	16	53337669	53337671	1	In_Frame_Del	c.5751_5753delAGA	p.E1919del
IM95	Stomach	SP140	2	231159025	231159025	1	Frame_Shift_Del	c.2008_2008delA	p.K670fs
IM95	Stomach	HDAC4	2	240024513	240024513	-1	Missense_Mutation	c.2177A>G	p.N726S
IM95	Stomach	NCOA3	20	46279861	46279866	1	In_Frame_Del	c.3787_3792delCAGCAA	p.QQ1275del
IM95	Stomach	EP300	22	41545952	41545954	1	In_Frame_Del	c.2567_2569delCAA	p.T858del
IM95	Stomach	NIPBL	5	36984981	36984981	1	Missense_Mutation	c.1699C>T	p.P567S
IM95	Stomach	KMT2C	7	151845524	151845524	-1	Frame_Shift_Del	c.13488_13488delT	p.F4496fs
IM95	Stomach	TRRAP	7	98576517	98576517	1	Missense_Mutation	c.8603C>T	p.A2868V
IM95	Stomach	TAF1L	9	32633584	32633584	-1	Frame_Shift_Del	c.1994_1994delA	p.K665fs
IMR32	Autonomic ganglia	MGA	15	42041538	42041538	1	Missense_Mutation	c.5733C>G	p.S1911R
IMR32	Autonomic ganglia	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
IMR32	Autonomic ganglia	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
IMR32	Autonomic ganglia	TAF1	X	70679496	70679496	1	Missense_Mutation	c.5219C>A	p.S1740Y
IPC298	Skin	TP53BP1	15	43707894	43707894	-1	Missense_Mutation	c.4987C>T	p.R1663C
IPC298	Skin	CHD9	16	53348835	53348835	1	Missense_Mutation	c.7463C>T	p.P2488L
IPC298	Skin	MLLT6	17	36864105	36864105	1	Missense_Mutation	c.334C>T	p.P112S
IPC298	Skin	DAXX	6	33289545	33289545	-1	Missense_Mutation	c.194C>T	p.S65L
IPC298	Skin	WHSC1L1	8	38135861	38135861	-1	Missense_Mutation	c.3830C>G	p.A1277G
ISHIKAWAHERAKLIO02ER	Endometrium	SETDB1	1	150923942	150923942	1	Missense_Mutation	c.2315A>C	p.E772A
ISHIKAWAHERAKLIO02ER	Endometrium	ARID1A	1	27106804	27106804	1	Frame_Shift_Del	c.6415_6415delC	p.P2139fs
ISHIKAWAHERAKLIO02ER	Endometrium	HDAC1	1	32797831	32797833	1	In_Frame_Del	c.1360_1362delGAG	p.E455del
ISHIKAWAHERAKLIO02ER	Endometrium	BRDT	1	92445274	92445274	1	Missense_Mutation	c.1259A>C	p.E420A
ISHIKAWAHERAKLIO02ER	Endometrium	KMT2A	11	118344186	118344186	1	Frame_Shift_Del	c.2312_2312delC	p.T771fs
ISHIKAWAHERAKLIO02ER	Endometrium	KMT2A	11	118373379	118373379	1	Missense_Mutation	c.6772A>G	p.S2258G
ISHIKAWAHERAKLIO02ER	Endometrium	CHD8	14	21871780	21871780	-1	Missense_Mutation	c.2513A>G	p.H838R
ISHIKAWAHERAKLIO02ER	Endometrium	CHD8	14	21873968	21873968	-1	Missense_Mutation	c.2126T>G	p.F709C
ISHIKAWAHERAKLIO02ER	Endometrium	IDH2	15	90633800	90633800	-1	Missense_Mutation	c.284A>G	p.Q95R
ISHIKAWAHERAKLIO02ER	Endometrium	CREBBP	16	3779604	3779604	-1	Frame_Shift_Del	c.5444_5444delG	p.G1815fs
ISHIKAWAHERAKLIO02ER	Endometrium	CHD9	16	53340190	53340190	1	Missense_Mutation	c.6661G>A	p.A2221T
ISHIKAWAHERAKLIO02ER	Endometrium	MLLT6	17	36873177	36873177	1	Missense_Mutation	c.1594T>G	p.F532V
ISHIKAWAHERAKLIO02ER	Endometrium	MLLT6	17	36873736	36873736	1	Missense_Mutation	c.1703G>A	p.R568Q
ISHIKAWAHERAKLIO02ER	Endometrium	LMNB2	19	2434488	2434488	-1	Missense_Mutation	c.1007G>A	p.R336Q
ISHIKAWAHERAKLIO02ER	Endometrium	ATF2	2	175976382	175976382	-1	Missense_Mutation	c.742C>A	p.L248I
ISHIKAWAHERAKLIO02ER	Endometrium	IDH1	2	209116262	209116263	-1	Frame_Shift_Ins	c.13_14insA	p.I5fs
ISHIKAWAHERAKLIO02ER	Endometrium	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
ISHIKAWAHERAKLIO02ER	Endometrium	MSH6	2	48032158	48032158	1	Missense_Mutation	c.3548T>C	p.I1183T
ISHIKAWAHERAKLIO02ER	Endometrium	EP300	22	41574679	41574679	1	Frame_Shift_Del	c.6964_6964delC	p.P2322fs
ISHIKAWAHERAKLIO02ER	Endometrium	WHSC1	4	1920189	1920189	1	Missense_Mutation	c.1249G>A	p.D417N
ISHIKAWAHERAKLIO02ER	Endometrium	NIPBL	5	36986064	36986064	1	Missense_Mutation	c.2782G>C	p.V928L
ISHIKAWAHERAKLIO02ER	Endometrium	HDAC2	6	114264534	114264534	-1	Missense_Mutation	c.1641A>C	p.E547D
ISHIKAWAHERAKLIO02ER	Endometrium	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
ISHIKAWAHERAKLIO02ER	Endometrium	BAG6	6	31617055	31617055	-1	Frame_Shift_Del	c.344_344delC	p.P115fs
ISHIKAWAHERAKLIO02ER	Endometrium	BRD2	6	32942500	32942500	1	Nonsense_Mutation	c.291G>A	p.W97*
ISHIKAWAHERAKLIO02ER	Endometrium	KMT2C	7	151842238	151842238	-1	Missense_Mutation	c.14174G>T	p.R4725M
ISHIKAWAHERAKLIO02ER	Endometrium	TRRAP	7	98528364	98528364	1	Missense_Mutation	c.3502A>G	p.M1168V
ISHIKAWAHERAKLIO02ER	Endometrium	KAT6A	8	41798406	41798406	-1	Missense_Mutation	c.2993G>T	p.R998L
ISHIKAWAHERAKLIO02ER	Endometrium	ATRX	X	76918975	76918975	-1	Missense_Mutation	c.4016G>T	p.R1339M
ISTMES2	Pleura	TNRC18	7	5352659	5352660	-1	In_Frame_Ins	c.7862_7863insATC	p.2621_2621S>SS
J82	Urinary tract	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
J82	Urinary tract	KMT2C	7	151891205	151891205	-1	Missense_Mutation	c.4549G>A	p.G1517R
J82	Urinary tract	KDM6A	X	44969400	44969400	1	Missense_Mutation	c.4238G>A	p.C1413Y
JEKO1	Haematopoietic and lymphoid tissue	ERCC6	10	50740632	50740632	-1	Missense_Mutation	c.379G>A	p.V127I
JEKO1	Haematopoietic and lymphoid tissue	NIPBL	5	36953800	36953800	1	Translation_Start_Site	c.2T>A	p.M1K
JEKO1	Haematopoietic and lymphoid tissue	ATRX	X	76940012	76940012	-1	Missense_Mutation	c.736C>T	p.R246C
JHH1	Liver	CREBBP	16	3779794	3779794	-1	Nonsense_Mutation	c.5254G>T	p.E1752*
JHH1	Liver	TET2	4	106156895	106156895	1	Missense_Mutation	c.1859A>G	p.Q620R
JHH1	Liver	TAF1	X	70643015	70643015	1	Missense_Mutation	c.4561G>T	p.D1521Y
JHH2	Liver	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
JHH2	Liver	NIPBL	5	37064654	37064654	1	Nonsense_Mutation	c.8075C>A	p.S2692*
JHH2	Liver	TAF1L	9	32635075	32635075	-1	Missense_Mutation	c.503A>G	p.D168G
JHH4	Liver	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
JHH5	Liver	HDAC1	1	32793249	32793249	1	Missense_Mutation	c.607G>A	p.E203K
JHH5	Liver	CHD9	16	53337835	53337835	1	Missense_Mutation	c.5917G>A	p.G1973S
JHH5	Liver	SUZ12	17	30320959	30320959	1	Missense_Mutation	c.1369T>G	p.C457G
JHH5	Liver	EP300	22	41565529	41565529	1	Missense_Mutation	c.4195G>A	p.D1399N
JHH5	Liver	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
JHH6	Liver	NCOA3	20	46281213	46281213	1	Missense_Mutation	c.4010C>T	p.S1337L
JHH6	Liver	TET2	4	106157066	106157066	1	Missense_Mutation	c.2030C>G	p.P677R
JHH7	Liver	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
JHH7	Liver	KMT2C	7	151848022	151848022	-1	Missense_Mutation	c.12737A>G	p.Y4246C
JHOC5	Ovary	MLLT10	10	22022704	22022704	1	Missense_Mutation	c.2552C>T	p.T851I
JHOM1	Ovary	ARID1B	6	157099403	157099417	1	In_Frame_Del	c.166_180delCAGCAGCAGCAGCAG	p.QQQQQ66del
JHOM2B	Ovary	BRDT	1	92456780	92456780	1	Missense_Mutation	c.2054C>A	p.S685Y
JHOM2B	Ovary	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
JHOM2B	Ovary	NIPBL	5	37017250	37017250	1	Missense_Mutation	c.4906C>T	p.R1636C
JHOS2	Ovary	DAXX	6	33287881	33287883	-1	In_Frame_Del	c.1406_1408delAGG	p.E469del
JHOS4	Ovary	CHD9	16	53301389	53301389	1	Silent	c.4504C>T	p.L1502L
JHOS4	Ovary	ATRX	X	76812975	76812975	-1	Missense_Mutation	c.6646G>C	p.D2216H
JHUEM1	Endometrium	ARID1A	1	27088711	27088711	1	Missense_Mutation	c.2320C>T	p.R774C
JHUEM1	Endometrium	ARID1A	1	27106709	27106710	1	Frame_Shift_Ins	c.6320_6321insC	p.G2107fs
JHUEM1	Endometrium	KAT6B	10	76729826	76729826	1	Missense_Mutation	c.895T>C	p.C299R
JHUEM1	Endometrium	KAT6B	10	76788689	76788690	1	In_Frame_Ins	c.4107_4108insGAA	p.1373_1374insE
JHUEM1	Endometrium	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
JHUEM1	Endometrium	CHD8	14	21863197	21863197	-1	Missense_Mutation	c.4427C>T	p.A1476V
JHUEM1	Endometrium	IDH2	15	90628112	90628112	-1	Missense_Mutation	c.1207G>A	p.V403M
JHUEM1	Endometrium	SMARCA4	19	11141550	11141550	1	Missense_Mutation	c.3527G>A	p.S1176N
JHUEM1	Endometrium	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
JHUEM1	Endometrium	EP300	22	41525914	41525914	1	Nonsense_Mutation	c.1189C>T	p.R397*
JHUEM1	Endometrium	NSD1	5	176673750	176673750	1	Frame_Shift_Del	c.4450_4450delA	p.K1484fs
JHUEM1	Endometrium	NIPBL	5	36985803	36985803	1	Nonsense_Mutation	c.2521C>T	p.R841*
JHUEM1	Endometrium	NIPBL	5	37064899	37064899	1	Frame_Shift_Del	c.8320_8320delA	p.K2774fs
JHUEM1	Endometrium	CHD1	5	98231940	98231940	-1	Missense_Mutation	c.1700G>A	p.S567N
JHUEM1	Endometrium	BRD2	6	32947886	32947886	1	Missense_Mutation	c.2228G>A	p.R743H
JHUEM1	Endometrium	PHIP	6	79680566	79680566	-1	Missense_Mutation	c.2929A>T	p.M977L
JHUEM1	Endometrium	KMT2C	7	151874147	151874148	-1	Frame_Shift_Ins	c.8390_8391insA	p.K2797fs
JHUEM1	Endometrium	TRRAP	7	98506575	98506575	1	Missense_Mutation	c.1340G>A	p.R447Q
JHUEM1	Endometrium	WHSC1L1	8	38187222	38187222	-1	Frame_Shift_Del	c.1255_1255delA	p.T419fs
JHUEM1	Endometrium	KAT6A	8	41839415	41839415	-1	Missense_Mutation	c.767G>A	p.R256Q
JHUEM1	Endometrium	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
JHUEM1	Endometrium	TAF1	X	70613167	70613167	1	Missense_Mutation	c.3128G>A	p.R1043H
JHUEM1	Endometrium	TAF1	X	70621491	70621491	1	Missense_Mutation	c.3960G>T	p.Q1320H
JHUEM2	Endometrium	ARID1A	1	27097708	27097709	1	Frame_Shift_Del	c.3297_3298delTC	p.C1099fs
JHUEM2	Endometrium	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
JHUEM2	Endometrium	KDM5A	12	401995	401995	-1	Missense_Mutation	c.4796G>T	p.G1599V
JHUEM2	Endometrium	MGA	15	42003509	42003509	1	Nonsense_Mutation	c.3046C>T	p.R1016*
JHUEM2	Endometrium	MLLT6	17	36863212	36863212	1	Missense_Mutation	c.119G>A	p.G40D
JHUEM2	Endometrium	MSH6	2	48028127	48028127	1	Missense_Mutation	c.3005G>A	p.G1002D
JHUEM2	Endometrium	DNMT3B	20	31379484	31379484	1	Silent	c.891C>A	p.S297S
JHUEM2	Endometrium	NSD1	5	176722104	176722104	1	Missense_Mutation	c.7735C>G	p.Q2579E
JHUEM2	Endometrium	JARID2	6	15512482	15512482	1	Missense_Mutation	c.2996G>T	p.R999M
JHUEM2	Endometrium	BAG6	6	31612923	31612923	-1	Frame_Shift_Del	c.1187_1187delC	p.P396fs
JHUEM2	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
JHUEM2	Endometrium	HDAC6	X	48681901	48681901	1	Frame_Shift_Del	c.3092_3092delC	p.T1031fs
JHUEM7	Endometrium	ARID1A	1	27099433	27099433	1	Missense_Mutation	c.3670A>G	p.M1224V
JHUEM7	Endometrium	ARID1A	1	27106354	27106354	1	Nonsense_Mutation	c.5965C>T	p.R1989*
JHUEM7	Endometrium	ARID1A	1	27107083	27107083	1	Missense_Mutation	c.6694C>T	p.R2232W
JHUEM7	Endometrium	CHD5	1	6219568	6219568	-1	Missense_Mutation	c.215A>G	p.N72S
JHUEM7	Endometrium	BMI1	10	22618427	22618427	1	Nonsense_Mutation	c.1366C>T	p.R456*
JHUEM7	Endometrium	ERCC6	10	50667076	50667076	-1	Missense_Mutation	c.4267G>A	p.E1423K
JHUEM7	Endometrium	SIRT1	10	69672420	69672420	1	Missense_Mutation	c.1547G>A	p.R516Q
JHUEM7	Endometrium	TET1	10	70406692	70406692	1	Missense_Mutation	c.4206C>A	p.F1402L
JHUEM7	Endometrium	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
JHUEM7	Endometrium	KMT2A	11	118344164	118344164	1	Missense_Mutation	c.2290A>C	p.S764R
JHUEM7	Endometrium	KMT2A	11	118376757	118376757	1	Missense_Mutation	c.10150C>A	p.L3384I
JHUEM7	Endometrium	KDM5A	12	475125	475125	-1	Missense_Mutation	c.512T>G	p.L171R
JHUEM7	Endometrium	CHD8	14	21862332	21862332	-1	Missense_Mutation	c.4785C>A	p.F1595L
JHUEM7	Endometrium	CHD8	14	21868446	21868446	-1	Missense_Mutation	c.3754C>T	p.R1252C
JHUEM7	Endometrium	CHD8	14	21876918	21876918	-1	Missense_Mutation	c.1594C>A	p.L532I
JHUEM7	Endometrium	MGA	15	42042523	42042523	1	Nonsense_Mutation	c.6718G>T	p.E2240*
JHUEM7	Endometrium	TP53BP1	15	43748645	43748645	-1	Missense_Mutation	c.2161A>G	p.M721V
JHUEM7	Endometrium	CREBBP	16	3786104	3786104	-1	Missense_Mutation	c.4661A>C	p.K1554T
JHUEM7	Endometrium	CHD9	16	53260293	53260293	1	Nonsense_Mutation	c.1912C>T	p.R638*
JHUEM7	Endometrium	CHD9	16	53279629	53279629	1	Missense_Mutation	c.3321G>T	p.K1107N
JHUEM7	Endometrium	CHD9	16	53358694	53358694	1	Missense_Mutation	c.8581A>C	p.S2861R
JHUEM7	Endometrium	SUZ12	17	30321730	30321730	1	Missense_Mutation	c.1585C>A	p.L529I
JHUEM7	Endometrium	MLLT6	17	36871984	36871984	1	Missense_Mutation	c.939G>T	p.K313N
JHUEM7	Endometrium	KAT7	17	47875855	47875855	1	Missense_Mutation	c.515G>A	p.R172H
JHUEM7	Endometrium	NCOA1	2	24920554	24920554	1	Missense_Mutation	c.836C>T	p.S279F
JHUEM7	Endometrium	NCOA1	2	24920589	24920589	1	Missense_Mutation	c.871T>G	p.L291V
JHUEM7	Endometrium	MSH6	2	48027541	48027541	1	Missense_Mutation	c.2419G>A	p.E807K
JHUEM7	Endometrium	PCNA	20	5099498	5099498	-1	Missense_Mutation	c.236T>G	p.L79R
JHUEM7	Endometrium	EP300	22	41553277	41553277	1	Missense_Mutation	c.3366G>T	p.W1122C
JHUEM7	Endometrium	EP300	22	41573156	41573156	1	Missense_Mutation	c.5441G>A	p.R1814Q
JHUEM7	Endometrium	NIPBL	5	36986147	36986147	1	Missense_Mutation	c.2865T>G	p.N955K
JHUEM7	Endometrium	NIPBL	5	36986194	36986194	1	Missense_Mutation	c.2912A>C	p.Q971P
JHUEM7	Endometrium	CHD1	5	98233968	98233968	-1	Missense_Mutation	c.1357G>T	p.D453Y
JHUEM7	Endometrium	HDAC2	6	114274503	114274503	-1	Missense_Mutation	c.859C>T	p.R287C
JHUEM7	Endometrium	DAXX	6	33287874	33287874	-1	Missense_Mutation	c.1415A>G	p.D472G
JHUEM7	Endometrium	PHF3	6	64394521	64394521	1	Missense_Mutation	c.898A>C	p.I300L
JHUEM7	Endometrium	PHF3	6	64412404	64412404	1	Nonsense_Mutation	c.3106G>T	p.E1036*
JHUEM7	Endometrium	PHIP	6	79726309	79726309	-1	Missense_Mutation	c.1187G>A	p.R396Q
JHUEM7	Endometrium	TRIM24	7	138239446	138239446	1	Missense_Mutation	c.1265C>A	p.S422Y
JHUEM7	Endometrium	TRIM24	7	138269549	138269549	1	Missense_Mutation	c.3006G>T	p.K1002N
JHUEM7	Endometrium	KMT2C	7	151841862	151841862	-1	Missense_Mutation	c.14279C>T	p.S4760L
JHUEM7	Endometrium	KMT2C	7	151845469	151845469	-1	Nonsense_Mutation	c.13543G>T	p.E4515*
JHUEM7	Endometrium	KMT2C	7	151878529	151878529	-1	Missense_Mutation	c.6416G>A	p.R2139Q
JHUEM7	Endometrium	KMT2C	7	151882686	151882686	-1	Missense_Mutation	c.5039A>C	p.K1680T
JHUEM7	Endometrium	STK31	7	23776563	23776563	1	Missense_Mutation	c.883G>A	p.V295I
JHUEM7	Endometrium	STK31	7	23776662	23776662	1	Nonsense_Mutation	c.982G>T	p.E328*
JHUEM7	Endometrium	STK31	7	23821118	23821118	1	Missense_Mutation	c.2046T>G	p.I682M
JHUEM7	Endometrium	KAT6A	8	41791084	41791084	-1	Missense_Mutation	c.4654G>T	p.D1552Y
JHUEM7	Endometrium	KAT6A	8	41792241	41792241	-1	Missense_Mutation	c.3497G>T	p.R1166I
JHUEM7	Endometrium	KAT6A	8	41806761	41806761	-1	Missense_Mutation	c.1719G>T	p.K573N
JHUEM7	Endometrium	KAT6A	8	41834576	41834576	-1	Missense_Mutation	c.1313G>A	p.R438Q
JHUEM7	Endometrium	KAT6A	8	41834819	41834819	-1	Missense_Mutation	c.1070G>A	p.R357Q
JHUEM7	Endometrium	NCOA2	8	71087023	71087023	-1	Missense_Mutation	c.331G>A	p.D111N
JHUEM7	Endometrium	SET	9	131455237	131455237	1	Missense_Mutation	c.508G>A	p.E170K
JHUEM7	Endometrium	KDM6A	X	44922979	44922979	1	Missense_Mutation	c.1996G>C	p.A666P
JHUEM7	Endometrium	TAF1	X	70596932	70596932	1	Missense_Mutation	c.665A>C	p.E222A
JHUEM7	Endometrium	TAF1	X	70644009	70644009	1	Silent	c.4734C>A	p.I1578I
JHUEM7	Endometrium	ATRX	X	76907720	76907720	-1	Missense_Mutation	c.4441C>T	p.R1481W
JHUEM7	Endometrium	ATRX	X	76918876	76918876	-1	Missense_Mutation	c.4115G>T	p.R1372I
JHUEM7	Endometrium	ATRX	X	76937311	76937311	-1	Missense_Mutation	c.3437C>A	p.T1146N
JIMT1	Breast	ARID1A	1	27058045	27058047	1	In_Frame_Del	c.1753_1755delCAG	p.Q586del
JIMT1	Breast	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
JJN3	Haematopoietic and lymphoid tissue	NIPBL	5	37020565	37020565	1	Missense_Mutation	c.5015C>T	p.S1672F
JJN3	Haematopoietic and lymphoid tissue	NCOA2	8	71036260	71036261	-1	Missense_Mutation	c.4151_4152AC>TA	p.Y1384L
JK1	Haematopoietic and lymphoid tissue	NCOA3	20	46251047	46251047	1	Missense_Mutation	c.56A>G	p.K19R
JK1	Haematopoietic and lymphoid tissue	EP300	22	41522018	41522018	1	Missense_Mutation	c.880G>A	p.V294I
JL1	Pleura	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
JL1	Pleura	DAXX	6	33288656	33288656	-1	Missense_Mutation	c.932G>A	p.R311Q
JM1	Haematopoietic and lymphoid tissue	BRD2	6	32943235	32943235	1	Nonsense_Mutation	c.408G>A	p.W136*
JMSU1	Urinary tract	CHD9	16	53341834	53341834	1	Missense_Mutation	c.7022G>A	p.R2341Q
JMSU1	Urinary tract	LMNB2	19	2431885	2431885	-1	Missense_Mutation	c.1606G>A	p.A536T
JMSU1	Urinary tract	IKZF1	7	50444283	50444283	1	Nonsense_Mutation	c.213T>A	p.C71*
JVM2	Haematopoietic and lymphoid tissue	NCOA2	8	71128902	71128902	-1	Missense_Mutation	c.79G>A	p.G27R
JVM3	Haematopoietic and lymphoid tissue	CHD8	14	21896221	21896221	-1	Missense_Mutation	c.571G>A	p.A191T
JVM3	Haematopoietic and lymphoid tissue	WHSC1	4	1980584	1980584	1	Missense_Mutation	c.4046A>T	p.K1349M
K029AX	Skin	EP300	22	41547933	41547933	1	Missense_Mutation	c.2914C>G	p.P972A
K562	Haematopoietic and lymphoid tissue	CHD5	1	6181198	6181199	-1	Missense_Mutation	c.4878_4879GA>TC	p.1626_1627EK>DQ
K562	Haematopoietic and lymphoid tissue	CHD5	1	6196598	6196598	-1	Missense_Mutation	c.2675T>C	p.F892S
K562	Haematopoietic and lymphoid tissue	BRDT	1	92446579	92446579	1	Nonsense_Mutation	c.1606C>T	p.R536*
K562	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
K562	Haematopoietic and lymphoid tissue	WHSC1	4	1941422	1941422	1	Nonsense_Mutation	c.1798C>T	p.R600*
K562	Haematopoietic and lymphoid tissue	TRRAP	7	98495374	98495374	1	Missense_Mutation	c.518T>G	p.F173C
K562	Haematopoietic and lymphoid tissue	KAT6A	8	41790109	41790109	-1	Missense_Mutation	c.5629C>T	p.R1877C
K562	Haematopoietic and lymphoid tissue	HDAC8	X	71715076	71715076	-1	Silent	c.480G>T	p.L160L
KALS1	Central nervous system	CHD5	1	6184080	6184080	-1	Missense_Mutation	c.4627A>T	p.I1543F
KALS1	Central nervous system	NCOA4	10	51579154	51579154	1	Missense_Mutation	c.61C>A	p.Q21K
KARPAS299	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
KARPAS620	Haematopoietic and lymphoid tissue	TP53BP1	15	43712710	43712710	-1	Missense_Mutation	c.4474G>T	p.V1492L
KARPAS620	Haematopoietic and lymphoid tissue	NCOA1	2	24881572	24881572	1	Missense_Mutation	c.26C>T	p.S9F
KARPAS620	Haematopoietic and lymphoid tissue	EP300	22	41531828	41531828	1	Missense_Mutation	c.1540A>G	p.M514V
KARPAS620	Haematopoietic and lymphoid tissue	TRRAP	7	98569468	98569468	1	Missense_Mutation	c.7718C>T	p.T2573M
KARPAS620	Haematopoietic and lymphoid tissue	TAF1L	9	32634970	32634970	-1	Missense_Mutation	c.608G>A	p.S203N
KASUMI2	Haematopoietic and lymphoid tissue	MLLT6	17	36871897	36871897	1	Silent	c.852C>T	p.H284H
KASUMI2	Haematopoietic and lymphoid tissue	NCOA1	2	24914382	24914382	1	Nonsense_Mutation	c.565C>T	p.R189*
KASUMI2	Haematopoietic and lymphoid tissue	PHF3	6	64419051	64419051	1	Missense_Mutation	c.3716T>C	p.L1239P
KASUMI2	Haematopoietic and lymphoid tissue	ATRX	X	76940462	76940462	-1	Missense_Mutation	c.631C>T	p.R211C
KASUMI2	Haematopoietic and lymphoid tissue	ATRX	X	76972690	76972690	-1	Silent	c.51G>A	p.K17K
KATOIII	Stomach	ING1	13	111368032	111368032	1	Missense_Mutation	c.242G>A	p.R81Q
KATOIII	Stomach	MLLT6	17	36865780	36865780	1	Frame_Shift_Del	c.504_504delG	p.V168fs
KATOIII	Stomach	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
KATOIII	Stomach	STK31	7	23775325	23775325	1	Missense_Mutation	c.652A>G	p.T218A
KCL22	Haematopoietic and lymphoid tissue	ARID1A	1	27101590	27101590	1	Silent	c.4872C>T	p.H1624H
KCL22	Haematopoietic and lymphoid tissue	CHD5	1	6196670	6196670	-1	Missense_Mutation	c.2603T>A	p.I868N
KCL22	Haematopoietic and lymphoid tissue	CHD5	1	6196841	6196841	-1	Missense_Mutation	c.2521T>C	p.W841R
KCL22	Haematopoietic and lymphoid tissue	MEN1	11	64572588	64572588	-1	Nonsense_Mutation	c.1283G>A	p.W428*
KCL22	Haematopoietic and lymphoid tissue	CREBBP	16	3778915	3778915	-1	Nonsense_Mutation	c.6133C>T	p.Q2045*
KCL22	Haematopoietic and lymphoid tissue	TFPT	19	54617952	54617952	-1	Missense_Mutation	c.152G>T	p.G51V
KCL22	Haematopoietic and lymphoid tissue	TRIM28	19	59061831	59061831	1	Missense_Mutation	c.2419G>A	p.A807T
KCL22	Haematopoietic and lymphoid tissue	SP110	2	231042924	231042924	-1	Missense_Mutation	c.1396G>A	p.V466M
KCL22	Haematopoietic and lymphoid tissue	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
KCL22	Haematopoietic and lymphoid tissue	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
KCL22	Haematopoietic and lymphoid tissue	HDAC6	X	48666507	48666507	1	Missense_Mutation	c.700G>A	p.A234T
KE37	Haematopoietic and lymphoid tissue	ERCC6	10	50708599	50708599	-1	Missense_Mutation	c.1670G>A	p.R557H
KE37	Haematopoietic and lymphoid tissue	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
KELLY	Autonomic ganglia	HDAC4	2	239988456	239988456	-1	Missense_Mutation	c.2950G>A	p.A984T
KG1	Haematopoietic and lymphoid tissue	TET1	10	70333629	70333629	1	Missense_Mutation	c.1534A>G	p.T512A
KG1	Haematopoietic and lymphoid tissue	MSH6	2	48027719	48027719	1	Missense_Mutation	c.2597A>C	p.K866T
KG1	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
KG1	Haematopoietic and lymphoid tissue	NCOA2	8	71069286	71069286	-1	Missense_Mutation	c.1314G>A	p.M438I
KHM1B	Haematopoietic and lymphoid tissue	CHD8	14	21876679	21876679	-1	Missense_Mutation	c.1685G>A	p.G562D
KHM1B	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
KLE	Endometrium	DNMT1	19	10244348	10244348	-1	Missense_Mutation	c.4894G>C	p.D1632H
KLE	Endometrium	TAF1	X	70603843	70603843	1	Missense_Mutation	c.2039G>T	p.G680V
KM12	Large intestine	TRIM33	1	114948221	114948221	-1	Missense_Mutation	c.2579G>A	p.G860E
KM12	Large intestine	ARID1A	1	27057975	27057975	1	Missense_Mutation	c.1683G>C	p.Q561H
KM12	Large intestine	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
KM12	Large intestine	HDAC1	1	32798310	32798310	1	Missense_Mutation	c.1381G>A	p.E461K
KM12	Large intestine	BRDT	1	92446221	92446221	1	Missense_Mutation	c.1321C>T	p.L441F
KM12	Large intestine	SIRT1	10	69669062	69669062	1	Missense_Mutation	c.1220T>C	p.M407T
KM12	Large intestine	KAT6B	10	76744869	76744869	1	Frame_Shift_Del	c.2405_2405delA	p.Q802fs
KM12	Large intestine	KMT2A	11	118391565	118391565	1	Frame_Shift_Del	c.11478_11478delA	p.L3826fs
KM12	Large intestine	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
KM12	Large intestine	KDM5A	12	420070	420070	-1	Missense_Mutation	c.3197C>G	p.S1066C
KM12	Large intestine	ZMYM2	13	20657094	20657094	1	Frame_Shift_Del	c.3742_3742delA	p.K1248fs
KM12	Large intestine	MGA	15	41999983	41999983	1	Missense_Mutation	c.2246G>A	p.G749E
KM12	Large intestine	CREBBP	16	3781375	3781375	-1	Missense_Mutation	c.4990C>T	p.R1664C
KM12	Large intestine	CHD9	16	53263000	53263000	1	Frame_Shift_Del	c.2274_2274delT	p.H758fs
KM12	Large intestine	KAT7	17	47893242	47893242	1	Silent	c.930C>T	p.F310F
KM12	Large intestine	KAT7	17	47899143	47899143	1	Frame_Shift_Del	c.1377_1377delT	p.Y459fs
KM12	Large intestine	BRD4	19	15379780	15379780	-1	Nonsense_Mutation	c.359G>A	p.W120*
KM12	Large intestine	SP140	2	231157477	231157477	1	Missense_Mutation	c.1942G>A	p.G648R
KM12	Large intestine	HDAC4	2	240002823	240002823	-1	Frame_Shift_Del	c.2703_2703delC	p.P901fs
KM12	Large intestine	HDAC4	2	240056117	240056117	-1	Missense_Mutation	c.1118C>T	p.A373V
KM12	Large intestine	HDAC4	2	240085610	240085610	-1	Missense_Mutation	c.500C>T	p.A167V
KM12	Large intestine	EP300	22	41545082	41545082	1	Missense_Mutation	c.2282A>G	p.Q761R
KM12	Large intestine	EP300	22	41566478	41566478	1	Missense_Mutation	c.4355C>T	p.P1452L
KM12	Large intestine	NIPBL	5	37020571	37020571	1	Missense_Mutation	c.5021A>G	p.K1674R
KM12	Large intestine	NIPBL	5	37061013	37061013	1	Missense_Mutation	c.7753G>A	p.G2585R
KM12	Large intestine	NIPBL	5	37064687	37064687	1	Missense_Mutation	c.8108A>G	p.E2703G
KM12	Large intestine	HDAC2	6	114264518	114264518	-1	Frame_Shift_Del	c.1657_1657delA	p.T553fs
KM12	Large intestine	PHF3	6	64421676	64421676	1	Frame_Shift_Del	c.4192_4192delT	p.F1398fs
KM12	Large intestine	KMT2C	7	151853394	151853394	-1	Missense_Mutation	c.11708C>T	p.S3903F
KM12	Large intestine	IKZF1	7	50468297	50468297	1	Missense_Mutation	c.1532G>A	p.R511Q
KM12	Large intestine	TRRAP	7	98563462	98563462	1	Missense_Mutation	c.7099G>A	p.V2367M
KM12	Large intestine	TAF1L	9	32633296	32633296	-1	Missense_Mutation	c.2282C>T	p.A761V
KM12	Large intestine	KDM6A	X	44732910	44732910	1	Frame_Shift_Del	c.113_113delC	p.S38fs
KMBC2	Urinary tract	ATF2	2	175939399	175939399	-1	Missense_Mutation	c.1456G>C	p.E486Q
KMBC2	Urinary tract	SP110	2	231072770	231072770	-1	Missense_Mutation	c.834G>C	p.K278N
KMBC2	Urinary tract	CHD1	5	98193941	98193941	-1	Missense_Mutation	c.4730C>G	p.S1577C
KMBC2	Urinary tract	ATRX	X	76854897	76854897	-1	Missense_Mutation	c.5939C>G	p.S1980C
KMH2	Haematopoietic and lymphoid tissue	KMT2A	11	118360573	118360573	1	Missense_Mutation	c.4546A>T	p.T1516S
KMH2	Haematopoietic and lymphoid tissue	NCOA3	20	46279879	46279887	1	In_Frame_Del	c.3805_3813delCAGCAACAG	p.QQQ1272del
KMH2	Haematopoietic and lymphoid tissue	STK31	7	23871902	23871902	1	Nonsense_Mutation	c.2977A>T	p.K993*
KMH2	Haematopoietic and lymphoid tissue	TAF1L	9	32635573	32635573	-1	Missense_Mutation	c.5G>A	p.R2Q
KMM1	Haematopoietic and lymphoid tissue	IDH2	15	90628510	90628510	-1	Missense_Mutation	c.1077G>T	p.Q359H
KMM1	Haematopoietic and lymphoid tissue	MSH6	2	48026290	48026290	1	Missense_Mutation	c.1168G>A	p.D390N
KMM1	Haematopoietic and lymphoid tissue	KMT2C	7	151874662	151874662	-1	Nonsense_Mutation	c.7876G>T	p.E2626*
KMRC1	Kidney	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
KMRC1	Kidney	SMARCB1	22	24143261	24143261	1	Missense_Mutation	c.466C>T	p.P156S
KMRC20	Kidney	NCOA1	2	24952569	24952569	1	Missense_Mutation	c.3086G>A	p.R1029Q
KMRC20	Kidney	BAP1	3	52443601	52443601	-1	Missense_Mutation	c.91G>A	p.E31K
KMRC2	Kidney	TP53BP1	15	43772210	43772210	-1	Missense_Mutation	c.505G>C	p.A169P
KMRC2	Kidney	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
KMRC2	Kidney	TRRAP	7	98609764	98609764	1	Missense_Mutation	c.11366C>T	p.T3789M
KMRC3	Kidney	MLLT10	10	22022997	22022997	1	Missense_Mutation	c.2845C>T	p.L949F
KMRC3	Kidney	MPHOSPH8	13	20222604	20222604	1	Frame_Shift_Del	c.1261_1261delA	p.K421fs
KMRC3	Kidney	MGA	15	41961346	41961346	1	Frame_Shift_Del	c.254_254delG	p.W85fs
KMRC3	Kidney	RAI1	17	17698602	17698603	1	Frame_Shift_Ins	c.2340_2341insA	p.S780fs
KMRC3	Kidney	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
KMRC3	Kidney	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
KMRC3	Kidney	STK31	7	23775325	23775325	1	Missense_Mutation	c.652A>G	p.T218A
KMRC3	Kidney	TRRAP	7	98547137	98547137	1	Missense_Mutation	c.4865C>T	p.T1622M
KMS11	Haematopoietic and lymphoid tissue	ZMYM2	13	20593696	20593696	1	Missense_Mutation	c.1522C>T	p.H508Y
KMS11	Haematopoietic and lymphoid tissue	CHD9	16	53348780	53348780	1	Missense_Mutation	c.7408C>T	p.P2470S
KMS12BM	Haematopoietic and lymphoid tissue	LMNA	1	156108511	156108511	1	Missense_Mutation	c.1931G>A	p.R644H
KMS12BM	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
KMS12BM	Haematopoietic and lymphoid tissue	KDM5A	12	430171	430171	-1	Missense_Mutation	c.2531G>A	p.R844Q
KMS12BM	Haematopoietic and lymphoid tissue	ING1	13	111371869	111371869	1	Missense_Mutation	c.859A>C	p.K287Q
KMS12BM	Haematopoietic and lymphoid tissue	BRD3	9	136905311	136905311	-1	Missense_Mutation	c.1488G>C	p.E496D
KMS21BM	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
KMS21BM	Haematopoietic and lymphoid tissue	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
KMS21BM	Haematopoietic and lymphoid tissue	NCOA6	20	33345712	33345732	-1	In_Frame_Del	c.819_839delGCAGCAGCAGCAACAACAGCA	p.273_280QQQQQQQQ>Q
KMS21BM	Haematopoietic and lymphoid tissue	LMNB1	5	126147535	126147535	1	Missense_Mutation	c.884A>G	p.E295G
KMS21BM	Haematopoietic and lymphoid tissue	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
KMS26	Haematopoietic and lymphoid tissue	SETDB1	1	150935140	150935141	1	Missense_Mutation	c.3236_3237AG>TA	p.K1079I
KMS26	Haematopoietic and lymphoid tissue	KAT6B	10	76789970	76789975	1	In_Frame_Del	c.5388_5393delGCGAAT	p.RM1797del
KMS26	Haematopoietic and lymphoid tissue	MSH6	2	48026047	48026047	1	Missense_Mutation	c.925T>G	p.S309A
KMS26	Haematopoietic and lymphoid tissue	KMT2C	7	151855953	151855953	-1	Missense_Mutation	c.11665A>C	p.K3889Q
KMS27	Haematopoietic and lymphoid tissue	PRDM16	1	3329036	3329036	1	Missense_Mutation	c.2275C>T	p.R759W
KMS27	Haematopoietic and lymphoid tissue	CHD5	1	6194240	6194240	-1	Missense_Mutation	c.3092A>G	p.K1031R
KMS27	Haematopoietic and lymphoid tissue	CHD9	16	53301210	53301210	1	Missense_Mutation	c.4325G>A	p.S1442N
KMS27	Haematopoietic and lymphoid tissue	TRIM28	19	59059004	59059004	1	Missense_Mutation	c.763C>T	p.L255F
KMS27	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
KMS28BM	Haematopoietic and lymphoid tissue	LMNA	1	156105782	156105782	1	Silent	c.1027C>A	p.R343R
KMS28BM	Haematopoietic and lymphoid tissue	EP300	22	41572420	41572420	1	Missense_Mutation	c.4949C>T	p.S1650F
KMS34	Haematopoietic and lymphoid tissue	CERS2	1	150936793	150936793	-1	3'Flank	c.3829C>A	p.L1277I
KMS34	Haematopoietic and lymphoid tissue	KDM6A	X	44732846	44732846	1	Missense_Mutation	c.49G>T	p.A17S
KNS42	Central nervous system	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
KNS42	Central nervous system	SMARCA4	19	11097673	11097673	1	Missense_Mutation	c.853C>A	p.P285T
KNS42	Central nervous system	PHIP	6	79695133	79695133	-1	Missense_Mutation	c.2473G>A	p.V825I
KNS42	Central nervous system	TAF1L	9	32630360	32630360	-1	Missense_Mutation	c.5218G>A	p.G1740R
KNS60	Central nervous system	ERCC6	10	50732482	50732482	-1	Missense_Mutation	c.994A>G	p.I332V
KNS60	Central nervous system	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
KNS60	Central nervous system	PHF3	6	64423083	64423083	1	Missense_Mutation	c.5599C>T	p.R1867C
KNS60	Central nervous system	TRIM24	7	138264196	138264196	1	Missense_Mutation	c.2504G>T	p.G835V
KNS62	Lung	TET1	10	70405700	70405700	1	Nonsense_Mutation	c.3214C>T	p.Q1072*
KNS62	Lung	CHD8	14	21868155	21868155	-1	Missense_Mutation	c.3965G>T	p.G1322V
KNS62	Lung	BAG6	6	31612906	31612906	-1	Missense_Mutation	c.1204G>T	p.A402S
KNS62	Lung	TAF1	X	70612786	70612786	1	Missense_Mutation	c.3053G>A	p.R1018H
KO52	Haematopoietic and lymphoid tissue	SP140	2	231149079	231149079	1	Missense_Mutation	c.1517G>C	p.G506A
KO52	Haematopoietic and lymphoid tissue	MSH6	2	48028270	48028270	1	Missense_Mutation	c.3148G>A	p.A1050T
KO52	Haematopoietic and lymphoid tissue	NCOA3	20	46279860	46279861	1	In_Frame_Ins	c.3786_3787insCAA	p.1276_1277insQ
KO52	Haematopoietic and lymphoid tissue	ASH2L	8	37963121	37963121	1	Missense_Mutation	c.53C>T	p.P18L
KP1N	Pancreas	NCOA1	2	24881622	24881622	1	Missense_Mutation	c.76A>C	p.T26P
KP1NL	Pancreas	BRDT	1	92442615	92442615	1	Missense_Mutation	c.646A>G	p.K216E
KP1NL	Pancreas	NCOA1	2	24881622	24881622	1	Missense_Mutation	c.76A>C	p.T26P
KP2	Pancreas	EP400	12	132547088	132547093	1	In_Frame_Del	c.8176_8181delCAACAA	p.QQ2746del
KP2	Pancreas	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
KP2	Pancreas	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
KP2	Pancreas	NSD1	5	176722104	176722104	1	Missense_Mutation	c.7735C>G	p.Q2579E
KP3	Pancreas	ARID1A	1	27106803	27106804	1	Frame_Shift_Ins	c.6414_6415insC	p.T2138fs
KP3	Pancreas	ERCC6	10	50686482	50686482	-1	Missense_Mutation	c.2204G>T	p.R735L
KP3	Pancreas	KAT6B	10	76788310	76788310	1	Missense_Mutation	c.3728A>G	p.K1243R
KP3	Pancreas	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
KP3	Pancreas	NSD1	5	176722221	176722221	1	Missense_Mutation	c.7852G>A	p.V2618I
KP3	Pancreas	ASH2L	8	37991057	37991057	1	Missense_Mutation	c.1613A>G	p.H538R
KP3	Pancreas	TAF1	X	70612819	70612819	1	Missense_Mutation	c.3086G>A	p.R1029H
KP4	Pancreas	DNMT3B	20	31375048	31375048	1	Missense_Mutation	c.445C>T	p.R149W
KP4	Pancreas	NCOA3	20	46266444	46266444	1	Missense_Mutation	c.2429C>T	p.S810F
KP4	Pancreas	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
KPL1	Breast	ERCC6	10	50740764	50740764	-1	Missense_Mutation	c.247G>A	p.V83I
KPL1	Breast	ZMYM2	13	20577008	20577008	1	Missense_Mutation	c.866C>T	p.S289L
KPL1	Breast	NSD1	5	176721856	176721856	1	Missense_Mutation	c.7487G>A	p.G2496D
KPNRTBM1	Autonomic ganglia	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
KPNRTBM1	Autonomic ganglia	MSH6	2	48033670	48033670	1	Missense_Mutation	c.3881G>C	p.C1294S
KPNSI9S	Autonomic ganglia	KAT6B	10	76732361	76732361	1	Missense_Mutation	c.1025T>C	p.I342T
KPNSI9S	Autonomic ganglia	NCOA1	2	24929781	24929781	1	Missense_Mutation	c.1442T>C	p.I481T
KPNSI9S	Autonomic ganglia	CHD1	5	98235237	98235238	-1	Missense_Mutation	c.1031_1032GA>AC	p.R344N
KPNSI9S	Autonomic ganglia	DAXX	6	33287881	33287883	-1	In_Frame_Del	c.1406_1408delAGG	p.E469del
KPNYN	Autonomic ganglia	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
KS1	Central nervous system	BRDT	1	92428328	92428328	1	Missense_Mutation	c.17G>A	p.R6Q
KS1	Central nervous system	KAT6B	10	76788267	76788267	1	Missense_Mutation	c.3685A>G	p.S1229G
KS1	Central nervous system	TP53BP1	15	43771703	43771703	-1	Missense_Mutation	c.680C>T	p.S227F
KU1919	Urinary tract	ARID1A	1	27094448	27094448	1	Nonsense_Mutation	c.3156T>G	p.Y1052*
KU1919	Urinary tract	PRDM16	1	3328737	3328737	1	Missense_Mutation	c.1976C>T	p.P659L
KU1919	Urinary tract	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
KU1919	Urinary tract	EP300	22	41572976	41572976	1	Nonsense_Mutation	c.5261C>A	p.S1754*
KU1919	Urinary tract	NIPBL	5	36962300	36962300	1	Nonsense_Mutation	c.534C>A	p.Y178*
KU1919	Urinary tract	KDM6A	X	44929487	44929487	1	Nonsense_Mutation	c.2743C>T	p.Q915*
KU812	Haematopoietic and lymphoid tissue	ZMYM2	13	20600757	20600757	1	Silent	c.1590T>C	p.Y530Y
KU812	Haematopoietic and lymphoid tissue	TAF1L	9	32631719	32631719	-1	Missense_Mutation	c.3859G>T	p.G1287C
KURAMOCHI	Ovary	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
KURAMOCHI	Ovary	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
KURAMOCHI	Ovary	TAF1L	9	32631944	32631944	-1	Missense_Mutation	c.3634G>A	p.A1212T
KYM1	Soft tissue	TET1	10	70332974	70332974	1	Missense_Mutation	c.879A>T	p.E293D
KYM1	Soft tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
KYM1	Soft tissue	MGA	15	41962114	41962114	1	Missense_Mutation	c.1022C>T	p.A341V
KYM1	Soft tissue	TP53BP1	15	43771703	43771703	-1	Missense_Mutation	c.680C>T	p.S227F
KYM1	Soft tissue	TET2	4	106156255	106156255	1	Missense_Mutation	c.1219G>T	p.V407L
KYM1	Soft tissue	PHF3	6	64419118	64419118	1	Missense_Mutation	c.3783A>G	p.I1261M
KYM1	Soft tissue	SET	9	131456289	131456289	1	Missense_Mutation	c.817G>C	p.D273H
KYM1	Soft tissue	TAF1L	9	32634445	32634445	-1	Missense_Mutation	c.1133G>T	p.G378V
KYM1	Soft tissue	TAF1L	9	32634551	32634551	-1	Missense_Mutation	c.1027T>A	p.S343T
KYO1	Haematopoietic and lymphoid tissue	SETDB1	1	150915361	150915361	1	Missense_Mutation	c.707A>G	p.N236S
KYO1	Haematopoietic and lymphoid tissue	BMI1	10	22617098	22617098	1	Missense_Mutation	c.890C>G	p.S297C
KYO1	Haematopoietic and lymphoid tissue	TP53BP1	15	43767844	43767844	-1	Missense_Mutation	c.1004C>G	p.S335C
KYSE140	Oesophagus	MGA	15	42002892	42002892	1	Missense_Mutation	c.2429G>A	p.G810E
KYSE140	Oesophagus	SMARCA4	19	11144122	11144122	1	Missense_Mutation	c.3703G>T	p.D1235Y
KYSE140	Oesophagus	TRRAP	7	98522877	98522877	1	Missense_Mutation	c.2966C>A	p.A989E
KYSE140	Oesophagus	KAT6A	8	41790019	41790019	-1	Missense_Mutation	c.5719C>T	p.P1907S
KYSE150	Oesophagus	SUZ12	17	30322737	30322737	1	Nonsense_Mutation	c.1750G>T	p.E584*
KYSE150	Oesophagus	TRIM28	19	59059057	59059057	1	Missense_Mutation	c.816G>C	p.K272N
KYSE150	Oesophagus	WHSC1	4	1957007	1957007	1	Missense_Mutation	c.2458C>T	p.R820W
KYSE150	Oesophagus	WHSC1	4	1959735	1959735	1	Missense_Mutation	c.2957G>A	p.R986H
KYSE150	Oesophagus	NSD1	5	176720957	176720958	1	Missense_Mutation	c.6588_6589GG>AA	p.D2197N
KYSE150	Oesophagus	TRRAP	7	98591259	98591259	1	Nonsense_Mutation	c.9904C>T	p.R3302*
KYSE150	Oesophagus	HDAC6	X	48682095	48682095	1	Missense_Mutation	c.3203C>T	p.S1068F
KYSE150	Oesophagus	TAF1	X	70613167	70613167	1	Missense_Mutation	c.3128G>A	p.R1043H
KYSE180	Oesophagus	DNMT1	19	10273397	10273397	-1	Frame_Shift_Del	c.954_954delA	p.K318fs
KYSE180	Oesophagus	NIPBL	5	37052538	37052538	1	Missense_Mutation	c.7133C>T	p.P2378L
KYSE180	Oesophagus	NCOA2	8	71069365	71069365	-1	Missense_Mutation	c.1235A>C	p.N412T
KYSE180	Oesophagus	KDM6A	X	44918514	44918514	1	Nonsense_Mutation	c.997C>T	p.Q333*
KYSE270	Oesophagus	SMARCA4	19	11105565	11105565	1	Missense_Mutation	c.1481C>G	p.T494R
KYSE270	Oesophagus	TFPT	19	54610386	54610386	-1	Missense_Mutation	c.733C>T	p.P245S
KYSE270	Oesophagus	DNMT3B	20	31395596	31395596	1	Missense_Mutation	c.2449G>T	p.D817Y
KYSE270	Oesophagus	HDAC2	6	114274527	114274527	-1	Nonsense_Mutation	c.835G>T	p.E279*
KYSE270	Oesophagus	TRRAP	7	98547761	98547761	1	Missense_Mutation	c.5189C>T	p.T1730I
KYSE270	Oesophagus	TAF1L	9	32631724	32631725	-1	Missense_Mutation	c.3853_3854GC>AT	p.A1285I
KYSE270	Oesophagus	TAF1L	9	32632898	32632898	-1	Missense_Mutation	c.2680G>A	p.E894K
KYSE30	Oesophagus	SETDB1	1	150923439	150923439	1	Missense_Mutation	c.2086G>C	p.E696Q
KYSE30	Oesophagus	MGA	15	42059170	42059170	1	Frame_Shift_Del	c.8890_8890delC	p.P2964fs
KYSE30	Oesophagus	SMARCA4	19	11141547	11141547	1	Missense_Mutation	c.3524A>G	p.D1175G
KYSE30	Oesophagus	KAT6A	8	41801480	41801480	-1	Missense_Mutation	c.2014C>T	p.R672C
KYSE30	Oesophagus	NCOA2	8	71069365	71069365	-1	Missense_Mutation	c.1235A>C	p.N412T
KYSE30	Oesophagus	BRD3	9	136907064	136907064	-1	Missense_Mutation	c.1225G>A	p.E409K
KYSE410	Oesophagus	SMARCA4	19	11144038	11144038	1	Missense_Mutation	c.3619G>A	p.V1207I
KYSE410	Oesophagus	TET2	4	106156895	106156895	1	Missense_Mutation	c.1859A>G	p.Q620R
KYSE410	Oesophagus	KMT2C	7	151896424	151896424	-1	Missense_Mutation	c.4213G>T	p.D1405Y
KYSE410	Oesophagus	WHSC1L1	8	38173540	38173540	-1	Missense_Mutation	c.1876T>C	p.S626P
KYSE410	Oesophagus	BRD3	9	136901305	136901305	-1	Silent	c.1785A>T	p.V595V
KYSE410	Oesophagus	TAF1L	9	32633128	32633128	-1	Missense_Mutation	c.2450G>A	p.R817K
KYSE450	Oesophagus	PRDM16	1	3328952	3328952	1	Missense_Mutation	c.2191C>T	p.P731S
KYSE450	Oesophagus	NIPBL	5	37064664	37064664	1	Silent	c.8085G>T	p.T2695T
KYSE450	Oesophagus	NCOA2	8	71033564	71033564	-1	Missense_Mutation	c.4356G>C	p.M1452I
KYSE450	Oesophagus	TAF1L	9	32631312	32631312	-1	Missense_Mutation	c.4266C>G	p.H1422Q
KYSE450	Oesophagus	HDAC6	X	48661317	48661317	1	Missense_Mutation	c.133C>T	p.P45S
KYSE510	Oesophagus	PRDM16	1	3322116	3322116	1	Missense_Mutation	c.1090C>T	p.R364W
KYSE510	Oesophagus	CHD8	14	21860016	21860018	-1	In_Frame_Del	c.6022_6024delAAG	p.K2008del
KYSE510	Oesophagus	MLLT6	17	36873157	36873157	1	Missense_Mutation	c.1574G>A	p.G525E
KYSE510	Oesophagus	NCOA3	20	46265100	46265100	1	Missense_Mutation	c.1970C>T	p.S657F
KYSE510	Oesophagus	EP300	22	41551096	41551097	1	Missense_Mutation	c.3240_3241CC>TT	p.P1081S
KYSE520	Oesophagus	KDM5A	12	416706	416706	-1	Missense_Mutation	c.3844C>T	p.R1282C
KYSE520	Oesophagus	NCOA1	2	24980874	24980874	1	Missense_Mutation	c.3914C>T	p.T1305M
KYSE520	Oesophagus	WHSC1	4	1957458	1957458	1	Frame_Shift_Del	c.2557_2557delT	p.F853fs
KYSE520	Oesophagus	TRRAP	7	98609102	98609102	1	Missense_Mutation	c.11239C>T	p.P3747S
KYSE520	Oesophagus	TAF1L	9	32631218	32631218	-1	Missense_Mutation	c.4360C>T	p.R1454C
KYSE70	Oesophagus	ARID1A	1	27106354	27106354	1	Nonsense_Mutation	c.5965C>T	p.R1989*
KYSE70	Oesophagus	ERCC6	10	50686468	50686468	-1	Missense_Mutation	c.2218C>T	p.P740S
KYSE70	Oesophagus	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
KYSE70	Oesophagus	HDAC3	5	141005843	141005843	-1	Missense_Mutation	c.838G>A	p.V280I
L1236	Haematopoietic and lymphoid tissue	BRDT	1	92443820	92443820	1	Missense_Mutation	c.1077T>A	p.D359E
L1236	Haematopoietic and lymphoid tissue	BRDT	1	92446300	92446300	1	Missense_Mutation	c.1400A>T	p.K467M
L1236	Haematopoietic and lymphoid tissue	KMT2C	7	151835959	151835959	-1	Missense_Mutation	c.14565T>G	p.C4855W
L1236	Haematopoietic and lymphoid tissue	TRRAP	7	98530972	98530972	1	Missense_Mutation	c.3961A>T	p.R1321W
L1236	Haematopoietic and lymphoid tissue	ATRX	X	76939742	76939742	-1	Missense_Mutation	c.1006T>C	p.S336P
L33	Pancreas	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
L33	Pancreas	CHD8	14	21869099	21869099	-1	Missense_Mutation	c.3468T>A	p.H1156Q
L33	Pancreas	MSH6	2	48027054	48027054	1	Missense_Mutation	c.1932G>C	p.R644S
L33	Pancreas	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
L363	Haematopoietic and lymphoid tissue	ARID1A	1	27057949	27057949	1	Missense_Mutation	c.1657C>G	p.Q553E
L363	Haematopoietic and lymphoid tissue	MSH6	2	48025785	48025785	1	Missense_Mutation	c.663A>C	p.E221D
L363	Haematopoietic and lymphoid tissue	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
L428	Haematopoietic and lymphoid tissue	PRDM16	1	3102727	3102727	1	Missense_Mutation	c.76C>T	p.R26W
L428	Haematopoietic and lymphoid tissue	BMI1	10	22616978	22616978	1	Missense_Mutation	c.845A>G	p.D282G
L428	Haematopoietic and lymphoid tissue	TET1	10	70406082	70406082	1	Missense_Mutation	c.3596G>A	p.G1199E
L428	Haematopoietic and lymphoid tissue	KAT6B	10	76735363	76735363	1	Missense_Mutation	c.1268C>G	p.S423C
L428	Haematopoietic and lymphoid tissue	CHD8	14	21864005	21864005	-1	Nonsense_Mutation	c.4261C>T	p.Q1421*
L428	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
L540	Haematopoietic and lymphoid tissue	CHD8	14	21863071	21863071	-1	Missense_Mutation	c.4553G>A	p.R1518Q
L540	Haematopoietic and lymphoid tissue	CREBBP	16	3790538	3790538	-1	Missense_Mutation	c.3995C>T	p.T1332I
L540	Haematopoietic and lymphoid tissue	MLLT6	17	36871887	36871887	1	Missense_Mutation	c.842C>T	p.S281F
L540	Haematopoietic and lymphoid tissue	MSH6	2	48030631	48030631	1	Missense_Mutation	c.3245C>T	p.P1082L
L540	Haematopoietic and lymphoid tissue	PHF3	6	64404555	64404555	1	Nonsense_Mutation	c.2581C>T	p.Q861*
L540	Haematopoietic and lymphoid tissue	KMT2C	7	151921250	151921250	-1	Missense_Mutation	c.3173G>C	p.R1058T
L540	Haematopoietic and lymphoid tissue	HDAC6	X	48674033	48674033	1	Missense_Mutation	c.1308G>T	p.E436D
LC1F	Lung	HNF1A	12	121434520	121434520	1	Missense_Mutation	c.1284C>A	p.N428K
LC1F	Lung	KMT2C	7	151878419	151878419	-1	Nonsense_Mutation	c.6526C>T	p.Q2176*
LC1SQSF	Lung	TET1	10	70333248	70333248	1	Missense_Mutation	c.1153C>T	p.H385Y
LC1SQSF	Lung	HNF1A	12	121434520	121434520	1	Missense_Mutation	c.1284C>A	p.N428K
LC1SQSF	Lung	CHD8	14	21897329	21897329	-1	Missense_Mutation	c.172G>T	p.V58L
LC1SQSF	Lung	KMT2C	7	151878419	151878419	-1	Nonsense_Mutation	c.6526C>T	p.Q2176*
LCLC103H	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
LCLC97TM1	Lung	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
LCLC97TM1	Lung	SET	9	131453478	131453478	1	Missense_Mutation	c.142A>G	p.I48V
LI7	Liver	SP110	2	231050856	231050856	-1	Missense_Mutation	c.1133C>A	p.A378E
LK2	Lung	NIPBL	5	37003433	37003433	1	Missense_Mutation	c.3839C>T	p.S1280F
LN18	Central nervous system	SIRT1	10	69669020	69669020	1	Missense_Mutation	c.1178C>G	p.P393R
LN18	Central nervous system	NCOA3	20	46279858	46279866	1	In_Frame_Del	c.3784_3792delCAGCAGCAA	p.QQQ1274del
LN18	Central nervous system	EP300	22	41566459	41566459	1	Missense_Mutation	c.4336T>A	p.Y1446N
LN18	Central nervous system	BAG6	6	31614245	31614245	-1	Missense_Mutation	c.862A>T	p.S288C
LN18	Central nervous system	TRIM24	7	138263977	138263977	1	Missense_Mutation	c.2285C>A	p.S762Y
LN18	Central nervous system	KMT2C	7	151935851	151935853	-1	In_Frame_Del	c.2591_2593delAAG	p.E864del
LN18	Central nervous system	IKZF1	7	50444372	50444372	1	Missense_Mutation	c.302G>A	p.S101N
LN18	Central nervous system	KAT6A	8	41791931	41791931	-1	Missense_Mutation	c.3807G>C	p.E1269D
LN229	Central nervous system	NCOA1	2	24964974	24964974	1	Missense_Mutation	c.3625A>G	p.M1209V
LN229	Central nervous system	NIPBL	5	37008803	37008803	1	Missense_Mutation	c.4399A>G	p.K1467E
LN229	Central nervous system	BAG6	6	31609962	31609962	-1	Missense_Mutation	c.2172A>T	p.E724D
LNCAPCLONEFGC	Prostate	SETDB1	1	150933458	150933458	1	Missense_Mutation	c.2920G>A	p.E974K
LNCAPCLONEFGC	Prostate	ARID1A	1	27023744	27023744	1	Frame_Shift_Del	c.850_850delG	p.G284fs
LNCAPCLONEFGC	Prostate	HDAC1	1	32797831	32797833	1	In_Frame_Del	c.1360_1362delGAG	p.E455del
LNCAPCLONEFGC	Prostate	PRDM16	1	3329015	3329015	1	Missense_Mutation	c.2254A>G	p.K752E
LNCAPCLONEFGC	Prostate	KAT6B	10	76789938	76789938	1	Missense_Mutation	c.5356G>A	p.E1786K
LNCAPCLONEFGC	Prostate	MEN1	11	64573814	64573814	-1	Nonsense_Mutation	c.954T>A	p.Y318*
LNCAPCLONEFGC	Prostate	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
LNCAPCLONEFGC	Prostate	KDM5A	12	438063	438063	-1	Missense_Mutation	c.1906T>C	p.C636R
LNCAPCLONEFGC	Prostate	CHD8	14	21869127	21869127	-1	Missense_Mutation	c.3440A>G	p.D1147G
LNCAPCLONEFGC	Prostate	MGA	15	42041384	42041384	1	Missense_Mutation	c.5579C>T	p.A1860V
LNCAPCLONEFGC	Prostate	MGA	15	42041509	42041509	1	Missense_Mutation	c.5704C>A	p.L1902M
LNCAPCLONEFGC	Prostate	MGA	15	42042007	42042007	1	Nonsense_Mutation	c.6202G>T	p.E2068*
LNCAPCLONEFGC	Prostate	TP53BP1	15	43748890	43748890	-1	Missense_Mutation	c.1916G>A	p.R639Q
LNCAPCLONEFGC	Prostate	TP53BP1	15	43783907	43783907	-1	Nonsense_Mutation	c.331C>T	p.Q111*
LNCAPCLONEFGC	Prostate	CREBBP	16	3900767	3900767	-1	Missense_Mutation	c.329C>T	p.A110V
LNCAPCLONEFGC	Prostate	CHD9	16	53348351	53348351	1	Frame_Shift_Del	c.7285_7285delA	p.K2429fs
LNCAPCLONEFGC	Prostate	HDAC4	2	240002823	240002823	-1	Frame_Shift_Del	c.2703_2703delC	p.P901fs
LNCAPCLONEFGC	Prostate	NCOA3	20	46264693	46264694	1	Frame_Shift_Del	c.1563_1564delCT	p.S521fs
LNCAPCLONEFGC	Prostate	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
LNCAPCLONEFGC	Prostate	EP300	22	41573047	41573047	1	Missense_Mutation	c.5332G>T	p.G1778W
LNCAPCLONEFGC	Prostate	NIPBL	5	36986347	36986347	1	Missense_Mutation	c.3065A>G	p.D1022G
LNCAPCLONEFGC	Prostate	CHD1	5	98235339	98235340	-1	Frame_Shift_Ins	c.929_930insA	p.N310fs
LNCAPCLONEFGC	Prostate	HDAC2	6	114279911	114279911	-1	Missense_Mutation	c.467C>T	p.A156V
LNCAPCLONEFGC	Prostate	PHIP	6	79671459	79671459	-1	Missense_Mutation	c.3604T>C	p.Y1202H
LNCAPCLONEFGC	Prostate	TRIM24	7	138213961	138213961	1	Missense_Mutation	c.982C>A	p.L328M
LNCAPCLONEFGC	Prostate	KMT2C	7	151845524	151845524	-1	Frame_Shift_Del	c.13488_13488delT	p.F4496fs
LNCAPCLONEFGC	Prostate	KMT2C	7	151849891	151849891	-1	Missense_Mutation	c.12425T>C	p.L4142S
LNCAPCLONEFGC	Prostate	KMT2C	7	151874147	151874148	-1	Frame_Shift_Ins	c.8390_8391insA	p.K2797fs
LNCAPCLONEFGC	Prostate	KMT2C	7	151879576	151879576	-1	Missense_Mutation	c.5369C>T	p.S1790F
LNCAPCLONEFGC	Prostate	TRRAP	7	98574160	98574160	1	Missense_Mutation	c.7993C>T	p.R2665W
LNCAPCLONEFGC	Prostate	TRRAP	7	98602921	98602921	1	Missense_Mutation	c.10661C>T	p.P3554L
LNCAPCLONEFGC	Prostate	KAT6A	8	41789934	41789934	-1	Missense_Mutation	c.5804G>T	p.S1935I
LNCAPCLONEFGC	Prostate	KAT6A	8	41801359	41801359	-1	Missense_Mutation	c.2135G>A	p.S712N
LNCAPCLONEFGC	Prostate	ATRX	X	76778785	76778787	-1	In_Frame_Del	c.6792_6794delAGA	p.2264_2265EE>E
LOUNH91	Lung	KAT6B	10	76788618	76788618	1	Missense_Mutation	c.4036G>T	p.D1346Y
LOUNH91	Lung	TP53BP1	15	43762078	43762083	-1	In_Frame_Del	c.1362_1367delTATCCC	p.454_456PIP>P
LOUNH91	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
LOUNH91	Lung	EP300	22	41527535	41527535	1	Nonsense_Mutation	c.1426C>T	p.Q476*
LOVO	Large intestine	LMNA	1	156106147	156106147	1	Missense_Mutation	c.1300G>A	p.A434T
LOVO	Large intestine	ARID1A	1	27106804	27106804	1	Frame_Shift_Del	c.6415_6415delC	p.P2139fs
LOVO	Large intestine	ERCC6	10	50701211	50701211	-1	Silent	c.1773G>A	p.P591P
LOVO	Large intestine	TET1	10	70405251	70405251	1	Missense_Mutation	c.2765G>T	p.R922I
LOVO	Large intestine	MEN1	11	64572200	64572200	-1	Missense_Mutation	c.1454G>A	p.R485Q
LOVO	Large intestine	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
LOVO	Large intestine	CREBBP	16	3830839	3830839	-1	Missense_Mutation	c.1717A>G	p.T573A
LOVO	Large intestine	IDH1	2	209116262	209116263	-1	Frame_Shift_Ins	c.13_14insA	p.I5fs
LOVO	Large intestine	HDAC4	2	240024574	240024574	-1	Missense_Mutation	c.2116G>A	p.A706T
LOVO	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
LOVO	Large intestine	NIPBL	5	37064672	37064672	1	Missense_Mutation	c.8093C>T	p.A2698V
LOVO	Large intestine	CHD1	5	98236905	98236905	-1	Missense_Mutation	c.572G>C	p.R191T
LOVO	Large intestine	JARID2	6	15512598	15512598	1	Missense_Mutation	c.3112A>C	p.S1038R
LOVO	Large intestine	BAG6	6	31612922	31612923	-1	Frame_Shift_Ins	c.1187_1188insC	p.P396fs
LOVO	Large intestine	BAG6	6	31617054	31617055	-1	Frame_Shift_Ins	c.344_345insC	p.P115fs
LOVO	Large intestine	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
LOVO	Large intestine	KMT2C	7	151902215	151902215	-1	Missense_Mutation	c.3937G>A	p.E1313K
LOVO	Large intestine	KMT2C	7	151921641	151921641	-1	Missense_Mutation	c.3037T>C	p.C1013R
LOVO	Large intestine	TAF1L	9	32635451	32635451	-1	Missense_Mutation	c.127G>T	p.G43C
LOXIMVI	Skin	ARID1A	1	27099397	27099397	1	Nonsense_Mutation	c.3634C>T	p.Q1212*
LOXIMVI	Skin	NIPBL	5	36986382	36986382	1	Missense_Mutation	c.3100A>G	p.K1034E
LP1	Haematopoietic and lymphoid tissue	DNMT1	19	10274009	10274009	-1	Missense_Mutation	c.919A>G	p.K307E
LP1	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
LP1	Haematopoietic and lymphoid tissue	PHF3	6	64394904	64394904	1	Missense_Mutation	c.1281T>A	p.S427R
LP1	Haematopoietic and lymphoid tissue	TRRAP	7	98557015	98557015	1	Missense_Mutation	c.6370C>T	p.R2124C
LP1	Haematopoietic and lymphoid tissue	KDM6A	X	44922760	44922760	1	Nonsense_Mutation	c.1777C>T	p.Q593*
LS1034	Large intestine	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
LS1034	Large intestine	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
LS1034	Large intestine	KAT6A	8	41906294	41906294	-1	Missense_Mutation	c.202C>T	p.L68F
LS123	Large intestine	BRD4	19	15355069	15355069	-1	Missense_Mutation	c.2554A>C	p.N852H
LS123	Large intestine	TRRAP	7	98608816	98608816	1	Missense_Mutation	c.11038G>A	p.G3680S
LS123	Large intestine	ATRX	X	76938416	76938416	-1	Missense_Mutation	c.2332A>G	p.K778E
LS180	Large intestine	SETDB1	1	150933597	150933597	1	Missense_Mutation	c.3059A>C	p.E1020A
LS180	Large intestine	ARID1A	1	27097688	27097688	1	Frame_Shift_Del	c.3277_3277delA	p.K1093fs
LS180	Large intestine	PRDM16	1	3160677	3160677	1	Silent	c.414G>A	p.S138S
LS180	Large intestine	MEN1	11	64575121	64575121	-1	Missense_Mutation	c.701G>A	p.R234H
LS180	Large intestine	HNF1A	12	121432115	121432115	1	Frame_Shift_Del	c.862_862delG	p.G288fs
LS180	Large intestine	KDM5A	12	495079	495079	-1	Missense_Mutation	c.227G>A	p.R76H
LS180	Large intestine	CHD9	16	53276755	53276755	1	Missense_Mutation	c.2881C>T	p.R961C
LS180	Large intestine	ATF2	2	175979496	175979496	-1	Missense_Mutation	c.548T>C	p.V183A
LS180	Large intestine	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
LS180	Large intestine	EP300	22	41489097	41489097	1	Missense_Mutation	c.89G>T	p.G30V
LS180	Large intestine	NIPBL	5	37019422	37019422	1	Missense_Mutation	c.4930G>A	p.G1644R
LS180	Large intestine	CHD1	5	98236745	98236745	-1	Frame_Shift_Del	c.629_629delA	p.K210fs
LS180	Large intestine	JARID2	6	15468922	15468922	1	Missense_Mutation	c.643A>C	p.T215P
LS180	Large intestine	PHIP	6	79727087	79727087	-1	Missense_Mutation	c.1112T>C	p.I371T
LS180	Large intestine	TRIM24	7	138262329	138262329	1	Frame_Shift_Del	c.2252_2252delA	p.Q751fs
LS180	Large intestine	BRD3	9	136918528	136918529	-1	Frame_Shift_Ins	c.71_72insC	p.P24fs
LS180	Large intestine	TAF1L	9	32633568	32633568	-1	Missense_Mutation	c.2010A>C	p.E670D
LS180	Large intestine	TAF1L	9	32633584	32633584	-1	Frame_Shift_Del	c.1994_1994delA	p.K665fs
LS180	Large intestine	KDM6A	X	44937706	44937706	1	Missense_Mutation	c.3050A>C	p.N1017T
LS180	Large intestine	KDM6A	X	44966717	44966718	1	Frame_Shift_Ins	c.4097_4098insA	p.G1366fs
LS411N	Large intestine	TRIM33	1	114968345	114968345	-1	Missense_Mutation	c.1421G>A	p.G474D
LS411N	Large intestine	ARID1A	1	27100176	27100176	1	Frame_Shift_Del	c.3972_3972delC	p.Y1324fs
LS411N	Large intestine	CHD5	1	6211115	6211115	-1	Missense_Mutation	c.971A>C	p.K324T
LS411N	Large intestine	MLLT10	10	21884285	21884285	1	Silent	c.321G>A	p.L107L
LS411N	Large intestine	MLLT10	10	22022772	22022772	1	Missense_Mutation	c.2620G>A	p.A874T
LS411N	Large intestine	ERCC6	10	50701201	50701201	-1	Missense_Mutation	c.1783G>T	p.A595S
LS411N	Large intestine	NCOA4	10	51580584	51580584	1	Missense_Mutation	c.218G>A	p.S73N
LS411N	Large intestine	TET1	10	70411666	70411666	1	Missense_Mutation	c.4340C>T	p.A1447V
LS411N	Large intestine	KAT6B	10	76789270	76789270	1	Missense_Mutation	c.4688C>T	p.A1563V
LS411N	Large intestine	HNF1A	12	121434458	121434458	1	Missense_Mutation	c.1222C>A	p.L408I
LS411N	Large intestine	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
LS411N	Large intestine	CHD8	14	21859171	21859171	-1	Missense_Mutation	c.6280A>G	p.K2094E
LS411N	Large intestine	CREBBP	16	3778467	3778467	-1	Missense_Mutation	c.6581G>A	p.R2194Q
LS411N	Large intestine	CREBBP	16	3817721	3817721	-1	Frame_Shift_Del	c.3250_3250delA	p.I1084fs
LS411N	Large intestine	CHD9	16	53289575	53289575	1	Missense_Mutation	c.4093A>G	p.M1365V
LS411N	Large intestine	CHD9	16	53337676	53337676	1	Missense_Mutation	c.5758C>T	p.R1920C
LS411N	Large intestine	CHD9	16	53358016	53358016	1	Frame_Shift_Del	c.7903_7903delA	p.K2635fs
LS411N	Large intestine	CHD9	16	53358698	53358698	1	Missense_Mutation	c.8585C>A	p.P2862H
LS411N	Large intestine	MLLT6	17	36873753	36873753	1	Missense_Mutation	c.1720C>A	p.P574T
LS411N	Large intestine	BRD4	19	15376311	15376311	-1	Nonsense_Mutation	c.703C>T	p.Q235*
LS411N	Large intestine	NCOA3	20	46279858	46279866	1	In_Frame_Del	c.3784_3792delCAGCAGCAA	p.QQQ1274del
LS411N	Large intestine	TET2	4	106155778	106155779	1	Frame_Shift_Ins	c.742_743insA	p.E248fs
LS411N	Large intestine	WHSC1	4	1902973	1902973	1	Frame_Shift_Del	c.592_592delA	p.K198fs
LS411N	Large intestine	LMNB1	5	126147514	126147514	1	Missense_Mutation	c.863G>A	p.S288N
LS411N	Large intestine	NSD1	5	176673721	176673721	1	Missense_Mutation	c.4421A>C	p.Q1474P
LS411N	Large intestine	NIPBL	5	37059042	37059042	1	Missense_Mutation	c.7460A>G	p.E2487G
LS411N	Large intestine	HDAC2	6	114277262	114277262	-1	Missense_Mutation	c.694G>A	p.G232R
LS411N	Large intestine	JARID2	6	15468817	15468817	1	Missense_Mutation	c.538C>A	p.Q180K
LS411N	Large intestine	BAG6	6	31615542	31615542	-1	Missense_Mutation	c.632C>T	p.P211L
LS411N	Large intestine	PHIP	6	79700598	79700598	-1	Missense_Mutation	c.2306C>A	p.P769H
LS411N	Large intestine	PHIP	6	79707219	79707219	-1	Missense_Mutation	c.2113G>A	p.A705T
LS411N	Large intestine	PHIP	6	79727072	79727072	-1	Missense_Mutation	c.1127C>T	p.T376I
LS411N	Large intestine	KMT2C	7	151835922	151835922	-1	Missense_Mutation	c.14602A>T	p.I4868F
LS411N	Large intestine	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
LS411N	Large intestine	KMT2C	7	151874724	151874724	-1	Missense_Mutation	c.7814C>G	p.T2605R
LS411N	Large intestine	KMT2C	7	152012398	152012398	-1	Missense_Mutation	c.415T>C	p.C139R
LS411N	Large intestine	IKZF1	7	50468318	50468318	1	Missense_Mutation	c.1553T>C	p.M518T
LS411N	Large intestine	TRRAP	7	98519452	98519452	1	Missense_Mutation	c.2699G>A	p.G900D
LS411N	Large intestine	TRRAP	7	98553862	98553862	1	Missense_Mutation	c.6010C>T	p.R2004W
LS411N	Large intestine	TRRAP	7	98565233	98565233	1	Missense_Mutation	c.7403G>T	p.R2468L
LS411N	Large intestine	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
LS411N	Large intestine	TAF1L	9	32633083	32633083	-1	Missense_Mutation	c.2495G>A	p.R832H
LS411N	Large intestine	HDAC8	X	71792521	71792521	-1	Silent	c.91C>T	p.L31L
LS411N	Large intestine	ATRX	X	76944330	76944330	-1	Missense_Mutation	c.575T>C	p.L192S
LS513	Large intestine	KAT6B	10	76789824	76789824	1	Missense_Mutation	c.5242G>A	p.V1748I
LS513	Large intestine	MGA	15	41961919	41961919	1	Missense_Mutation	c.827G>T	p.S276I
LS513	Large intestine	SMARCA4	19	11134251	11134251	1	Missense_Mutation	c.2917C>T	p.R973W
LS513	Large intestine	HDAC4	2	240098226	240098226	-1	Missense_Mutation	c.373C>G	p.Q125E
LS513	Large intestine	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
LS513	Large intestine	ARID1B	6	157099403	157099405	1	In_Frame_Del	c.166_168delCAG	p.Q73del
LS513	Large intestine	STK31	7	23775253	23775253	1	Missense_Mutation	c.580T>G	p.Y194D
LU65	Lung	MSH6	2	48033981	48033982	1	Frame_Shift_Ins	c.4065_4066insTTGA	p.T1355fs
LU99	Lung	CHD8	14	21871261	21871261	-1	Missense_Mutation	c.2792G>A	p.R931Q
LU99	Lung	DNMT1	19	10249229	10249229	-1	Missense_Mutation	c.4001C>T	p.A1334V
LU99	Lung	EP300	22	41547916	41547916	1	Frame_Shift_Del	c.2897_2897delC	p.A966fs
LU99	Lung	NCOA2	8	71039273	71039273	-1	Missense_Mutation	c.3691A>G	p.N1231D
LUDLU1	Lung	ERCC6	10	50732184	50732184	-1	Missense_Mutation	c.1292G>T	p.G431V
LUDLU1	Lung	KAT6B	10	76790203	76790203	1	Missense_Mutation	c.5621C>T	p.A1874V
LUDLU1	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
LXF289	Lung	ERCC6	10	50668447	50668447	-1	Missense_Mutation	c.4034C>T	p.S1345L
LXF289	Lung	KAT6B	10	76789215	76789215	1	Missense_Mutation	c.4633G>A	p.V1545I
LXF289	Lung	KMT2A	11	118373862	118373862	1	Missense_Mutation	c.7255G>A	p.E2419K
LXF289	Lung	MGA	15	42005463	42005463	1	Nonsense_Mutation	c.3199C>T	p.Q1067*
LXF289	Lung	CHD1	5	98209342	98209342	-1	Missense_Mutation	c.3526T>A	p.C1176S
LXF289	Lung	BRD2	6	32947742	32947742	1	Missense_Mutation	c.2084A>T	p.E695V
MALME3M	Skin	SMARCB1	22	24158958	24158958	1	Missense_Mutation	c.657G>T	p.E219D
MALME3M	Skin	WHSC1	4	1959686	1959686	1	Missense_Mutation	c.2908C>T	p.R970C
MC116	Haematopoietic and lymphoid tissue	SMARCA4	19	11144179	11144190	1	In_Frame_Del	c.3760_3771delGAGGAGCAGGAT	p.EEQD1254del
MCAS	Ovary	MLLT10	10	21962816	21962816	1	Missense_Mutation	c.1589G>T	p.S530I
MCAS	Ovary	TP53BP1	15	43784609	43784609	-1	Missense_Mutation	c.65C>G	p.T22S
MCAS	Ovary	KAT6A	8	41798773	41798773	-1	Nonsense_Mutation	c.2626C>T	p.Q876*
MCF7	Breast	ERCC6	10	50740764	50740764	-1	Missense_Mutation	c.247G>A	p.V83I
MCF7	Breast	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
MDAMB134VI	Breast	ARID1A	1	27099397	27099397	1	Nonsense_Mutation	c.3634C>T	p.Q1212*
MDAMB134VI	Breast	KAT6A	8	41790713	41790714	-1	In_Frame_Ins	c.5024_5025insACC	p.1675_1675P>PP
MDAMB361	Breast	SETDB1	1	150933591	150933591	1	Missense_Mutation	c.3053G>A	p.R1018Q
MDAMB361	Breast	ARID1A	1	27094465	27094465	1	Missense_Mutation	c.3173T>G	p.V1058G
MDAMB361	Breast	CHD8	14	21853822	21853822	-1	Missense_Mutation	c.6859G>T	p.D2287Y
MDAMB361	Breast	BAP1	3	52437774	52437774	-1	Missense_Mutation	c.1387C>G	p.L463V
MDAMB361	Breast	DAXX	6	33287796	33287796	-1	Missense_Mutation	c.1493C>T	p.A498V
MDAMB361	Breast	TRRAP	7	98509802	98509803	1	Missense_Mutation	c.2165_2166CC>TT	p.S722F
MDAMB361	Breast	ATRX	X	76938079	76938079	-1	Missense_Mutation	c.2669C>T	p.S890L
MDAMB415	Breast	MLLT10	10	21962675	21962675	1	Missense_Mutation	c.1448G>C	p.G483A
MDAMB415	Breast	CHD9	16	53281261	53281261	1	Missense_Mutation	c.3511G>C	p.D1171H
MDAMB415	Breast	KMT2C	7	151859516	151859516	-1	Missense_Mutation	c.11146G>A	p.E3716K
MDAMB435S	Skin	KDM5A	12	394762	394762	-1	Missense_Mutation	c.4933C>T	p.P1645S
MDAMB435S	Skin	MGA	15	41988409	41988409	1	Missense_Mutation	c.1201A>G	p.T401A
MDAMB435S	Skin	JARID2	6	15374416	15374416	1	Missense_Mutation	c.114G>T	p.K38N
MDAMB435S	Skin	TRIM24	7	138239515	138239515	1	Missense_Mutation	c.1334C>T	p.S445L
MDAMB435S	Skin	KMT2C	7	151846057	151846057	-1	Missense_Mutation	c.12955G>A	p.E4319K
MDAMB435S	Skin	KAT6A	8	41798530	41798530	-1	Missense_Mutation	c.2869G>T	p.A957S
MDAMB435S	Skin	BRD3	9	136901264	136901264	-1	Missense_Mutation	c.1826C>T	p.S609F
MDAMB435S	Skin	TAF1L	9	32633189	32633189	-1	Missense_Mutation	c.2389G>A	p.D797N
MDAMB435S	Skin	TAF1L	9	32633981	32633981	-1	Missense_Mutation	c.1597C>T	p.P533S
MDAMB435S	Skin	TAF1	X	70678119	70678119	1	Missense_Mutation	c.5027C>T	p.S1676F
MDAMB436	Breast	NCOA2	8	71128925	71128925	-1	Missense_Mutation	c.56G>A	p.R19H
MDAMB436	Breast	KDM6A	X	44936047	44936047	1	Missense_Mutation	c.2964G>C	p.L988F
MDAMB453	Breast	TET1	10	70450954	70450954	1	Missense_Mutation	c.5794G>A	p.E1932K
MDAMB453	Breast	TET1	10	70451110	70451110	1	Missense_Mutation	c.5950G>A	p.E1984K
MDAMB453	Breast	KAT6B	10	76784959	76784959	1	Missense_Mutation	c.3616G>A	p.E1206K
MDAMB453	Breast	CHD8	14	21861875	21861875	-1	Missense_Mutation	c.5242G>A	p.E1748K
MDAMB453	Breast	MGA	15	41991137	41991137	1	Nonsense_Mutation	c.2090C>G	p.S697*
MDAMB453	Breast	TP53BP1	15	43766892	43766892	-1	Missense_Mutation	c.1159A>T	p.T387S
MDAMB453	Breast	SUZ12	17	30325969	30325969	1	Missense_Mutation	c.2167G>A	p.E723K
MDAMB453	Breast	BRD4	19	15355405	15355405	-1	Missense_Mutation	c.2218C>T	p.H740Y
MDAMB453	Breast	PHF3	6	64423126	64423126	1	Missense_Mutation	c.5642C>T	p.P1881L
MDAMB453	Breast	KMT2C	7	151962153	151962153	-1	Missense_Mutation	c.1154G>A	p.C385Y
MDAMB453	Breast	HDAC6	X	48682395	48682396	1	Missense_Mutation	c.3367_3368CC>GT	p.P1123V
MDAMB468	Breast	PRDM16	1	3334509	3334509	1	Missense_Mutation	c.2809C>G	p.P937A
MDAMB468	Breast	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
MDAMB468	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
MDAMB468	Breast	ARID1B	6	157099402	157099403	1	In_Frame_Ins	c.165_166insCAG	p.73_74insQ
MDAMB468	Breast	SMARCA2	9	2039793	2039794	1	In_Frame_Ins	c.683_684insGCC	p.228_229insP
MDAPCA2B	Prostate	PRDM16	1	3102984	3102984	1	Frame_Shift_Del	c.333_333delC	p.G111fs
MDAPCA2B	Prostate	PRDM16	1	3342777	3342777	1	Missense_Mutation	c.3272G>A	p.R1091Q
MDAPCA2B	Prostate	CHD5	1	6184635	6184635	-1	Missense_Mutation	c.4481G>A	p.G1494D
MDAPCA2B	Prostate	CHD5	1	6188930	6188930	-1	Missense_Mutation	c.3587G>A	p.G1196D
MDAPCA2B	Prostate	ERCC6	10	50684316	50684316	-1	Missense_Mutation	c.2327A>G	p.Y776C
MDAPCA2B	Prostate	TET1	10	70333429	70333429	1	Missense_Mutation	c.1334C>G	p.A445G
MDAPCA2B	Prostate	KMT2A	11	118352795	118352795	1	Missense_Mutation	c.4000C>T	p.P1334S
MDAPCA2B	Prostate	TP53BP1	15	43712638	43712638	-1	Missense_Mutation	c.4546G>A	p.G1516R
MDAPCA2B	Prostate	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
MDAPCA2B	Prostate	WHSC1	4	1902782	1902782	1	Missense_Mutation	c.401A>G	p.N134S
MDAPCA2B	Prostate	JARID2	6	15410528	15410528	1	Silent	c.255A>C	p.A85A
MDAPCA2B	Prostate	DAXX	6	33289271	33289271	-1	Missense_Mutation	c.317G>A	p.R106H
MDAPCA2B	Prostate	PHF3	6	64395267	64395267	1	Frame_Shift_Del	c.1644_1644delA	p.R548fs
MDAPCA2B	Prostate	KMT2C	7	151842355	151842355	-1	Frame_Shift_Del	c.14057_14057delA	p.N4686fs
MDAPCA2B	Prostate	KMT2C	7	151945412	151945412	-1	Missense_Mutation	c.2107C>T	p.H703Y
MDAPCA2B	Prostate	WHSC1L1	8	38139082	38139082	-1	Missense_Mutation	c.3521A>G	p.Y1174C
MDST8	Large intestine	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
MDST8	Large intestine	NSD1	5	176722221	176722221	1	Missense_Mutation	c.7852G>A	p.V2618I
MDST8	Large intestine	PHF3	6	64408425	64408425	1	Missense_Mutation	c.2912G>T	p.R971L
MDST8	Large intestine	KMT2C	7	151860509	151860509	-1	Missense_Mutation	c.10153T>C	p.F3385L
MDST8	Large intestine	STK31	7	23809307	23809307	1	Missense_Mutation	c.1645G>A	p.D549N
MDST8	Large intestine	TRRAP	7	98553896	98553896	1	Missense_Mutation	c.6044A>G	p.K2015R
MDST8	Large intestine	NCOA2	8	71053503	71053503	-1	Missense_Mutation	c.2944C>T	p.R982W
ME1	Haematopoietic and lymphoid tissue	NSD1	5	176715892	176715892	1	Missense_Mutation	c.6224C>A	p.P2075Q
MEG01	Haematopoietic and lymphoid tissue	BMI1	10	22618227	22618227	1	Missense_Mutation	c.1166C>T	p.A389V
MEG01	Haematopoietic and lymphoid tissue	BRD2	6	32945304	32945304	1	Missense_Mutation	c.1286A>G	p.N429S
MEG01	Haematopoietic and lymphoid tissue	WHSC1L1	8	38187252	38187252	-1	Missense_Mutation	c.1225A>G	p.S409G
MELHO	Skin	STK31	7	23826235	23826235	1	Missense_Mutation	c.2383T>C	p.F795L
MELHO	Skin	PSIP1	9	15489991	15489991	-1	Missense_Mutation	c.281G>C	p.S94T
MELJUSO	Skin	CHD8	14	21859653	21859653	-1	Missense_Mutation	c.6197C>T	p.P2066L
MELJUSO	Skin	BRD4	19	15367797	15367797	-1	Missense_Mutation	c.1529G>A	p.R510Q
MELJUSO	Skin	TFPT	19	54611466	54611466	-1	Missense_Mutation	c.509G>A	p.R170K
MELJUSO	Skin	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
MELJUSO	Skin	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
MEWO	Skin	CHD5	1	6196922	6196922	-1	Missense_Mutation	c.2440G>A	p.E814K
MEWO	Skin	CHD5	1	6219500	6219500	-1	Missense_Mutation	c.283C>T	p.P95S
MEWO	Skin	TET1	10	70333605	70333605	1	Missense_Mutation	c.1510C>T	p.H504Y
MEWO	Skin	TET1	10	70405356	70405356	1	Missense_Mutation	c.2870C>T	p.P957L
MEWO	Skin	KAT6B	10	76789456	76789456	1	Missense_Mutation	c.4874G>A	p.S1625N
MEWO	Skin	CHD8	14	21894367	21894367	-1	Missense_Mutation	c.799C>T	p.R267C
MEWO	Skin	MGA	15	42040874	42040874	1	Missense_Mutation	c.5252C>T	p.S1751F
MEWO	Skin	MGA	15	42054441	42054441	1	Missense_Mutation	c.7625C>T	p.P2542L
MEWO	Skin	MGA	15	42058601	42058601	1	Missense_Mutation	c.8321C>T	p.S2774L
MEWO	Skin	BRD4	19	15354169	15354169	-1	Missense_Mutation	c.2711C>T	p.P904L
MEWO	Skin	BRD4	19	15366270	15366270	-1	Nonsense_Mutation	c.1885A>T	p.K629*
MEWO	Skin	HDAC4	2	240002825	240002825	-1	Missense_Mutation	c.2701C>T	p.P901S
MEWO	Skin	HDAC4	2	240024509	240024510	-1	Missense_Mutation	c.2180_2181CC>TT	p.P727L
MEWO	Skin	NCOA1	2	24974968	24974968	1	Missense_Mutation	c.3824C>T	p.S1275F
MEWO	Skin	MSH6	2	48033789	48033789	1	Missense_Mutation	c.4000C>T	p.R1334W
MEWO	Skin	PCNA	20	5099494	5099494	-1	Missense_Mutation	c.240A>T	p.K80N
MEWO	Skin	NIPBL	5	37002781	37002781	1	Missense_Mutation	c.3682C>T	p.P1228S
MEWO	Skin	DAXX	6	33288893	33288893	-1	Missense_Mutation	c.695C>T	p.S232F
MEWO	Skin	PHF3	6	64394958	64394959	1	Nonsense_Mutation	c.1335_1336CC>TT	p.Q446*
MEWO	Skin	PHF3	6	64422810	64422810	1	Missense_Mutation	c.5326C>T	p.P1776S
MEWO	Skin	PHIP	6	79672937	79672937	-1	Missense_Mutation	c.3412C>T	p.P1138S
MEWO	Skin	STK31	7	23825131	23825131	1	Missense_Mutation	c.2183G>A	p.R728Q
MEWO	Skin	KAT6A	8	41790402	41790402	-1	Missense_Mutation	c.5336C>T	p.S1779F
MEWO	Skin	KAT6A	8	41790861	41790861	-1	Missense_Mutation	c.4877C>T	p.P1626L
MEWO	Skin	KAT6A	8	41906248	41906248	-1	Missense_Mutation	c.248C>T	p.P83L
MEWO	Skin	BRD3	9	136913227	136913228	-1	Missense_Mutation	c.1063_1064CC>TT	p.P355L
MEWO	Skin	TAF1L	9	32631806	32631806	-1	Missense_Mutation	c.3772G>A	p.E1258K
MEWO	Skin	TAF1L	9	32634818	32634818	-1	Nonsense_Mutation	c.760C>T	p.R254*
MFE280	Endometrium	LMNA	1	156106047	156106047	1	Silent	c.1200C>T	p.G400G
MFE280	Endometrium	MLLT10	10	22016857	22016857	1	Missense_Mutation	c.2111G>T	p.R704L
MFE296	Endometrium	ARID1A	1	27023716	27023716	1	Frame_Shift_Del	c.822_822delG	p.M274fs
MFE296	Endometrium	CHD5	1	6196688	6196688	-1	Missense_Mutation	c.2585T>C	p.V862A
MFE296	Endometrium	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
MFE296	Endometrium	CHD9	16	53348351	53348351	1	Frame_Shift_Del	c.7285_7285delA	p.K2429fs
MFE296	Endometrium	MSH6	2	48028286	48028286	1	Missense_Mutation	c.3164C>T	p.A1055V
MFE296	Endometrium	EP300	22	41572465	41572465	1	Missense_Mutation	c.4994G>A	p.R1665H
MFE296	Endometrium	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
MFE296	Endometrium	ARID1B	6	157099403	157099405	1	In_Frame_Del	c.166_168delCAG	p.Q73del
MFE296	Endometrium	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
MFE296	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
MFE296	Endometrium	KDM6A	X	44922929	44922930	1	Frame_Shift_Del	c.1946_1947delAT	p.H649fs
MFE319	Endometrium	ARID1A	1	27101434	27101434	1	Silent	c.4716C>T	p.Y1572Y
MFE319	Endometrium	ARID1A	1	27101445	27101445	1	Missense_Mutation	c.4727C>T	p.P1576L
MFE319	Endometrium	ARID1A	1	27107219	27107219	1	Missense_Mutation	c.6830A>G	p.D2277G
MFE319	Endometrium	PRDM16	1	3102863	3102863	1	Missense_Mutation	c.212C>T	p.P71L
MFE319	Endometrium	PRDM16	1	3322147	3322147	1	Missense_Mutation	c.1121C>T	p.T374I
MFE319	Endometrium	BRDT	1	92446865	92446866	1	Frame_Shift_Ins	c.1803_1804insA	p.Q601fs
MFE319	Endometrium	COMMD3-BMI1	10	22615362	22615362	1	Frame_Shift_Del	c.413_413delT	p.I138fs
MFE319	Endometrium	KAT6B	10	76788700	76788700	1	Missense_Mutation	c.4118A>G	p.E1373G
MFE319	Endometrium	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
MFE319	Endometrium	ZMYM2	13	20600764	20600764	1	Silent	c.1597C>T	p.L533L
MFE319	Endometrium	ZMYM2	13	20657133	20657133	1	Nonsense_Mutation	c.3781C>T	p.R1261*
MFE319	Endometrium	ZMYM2	13	20657864	20657864	1	Missense_Mutation	c.3889G>A	p.A1297T
MFE319	Endometrium	CHD8	14	21871750	21871750	-1	Missense_Mutation	c.2543C>T	p.A848V
MFE319	Endometrium	CHD8	14	21874004	21874004	-1	Missense_Mutation	c.2090C>T	p.T697I
MFE319	Endometrium	CHD8	14	21883097	21883097	-1	Missense_Mutation	c.1187A>G	p.Y396C
MFE319	Endometrium	CREBBP	16	3777936	3777936	-1	Missense_Mutation	c.7112C>T	p.P2371L
MFE319	Endometrium	CREBBP	16	3820666	3820666	-1	Nonsense_Mutation	c.2785C>T	p.Q929*
MFE319	Endometrium	CREBBP	16	3820836	3820836	-1	Missense_Mutation	c.2615C>A	p.T872K
MFE319	Endometrium	CBX8	17	77769121	77769138	-1	In_Frame_Del	c.466_483delAGGGACCGGGAGCGGGAT	p.RDRERD156del
MFE319	Endometrium	CHD3	17	7797756	7797756	1	Frame_Shift_Del	c.1276_1276delG	p.G426fs
MFE319	Endometrium	DNMT1	19	10250975	10250975	-1	Missense_Mutation	c.3553A>G	p.M1185V
MFE319	Endometrium	DNMT1	19	10262204	10262204	-1	Missense_Mutation	c.2135T>C	p.M712T
MFE319	Endometrium	BRD4	19	15375357	15375357	-1	Missense_Mutation	c.1070G>A	p.C357Y
MFE319	Endometrium	MSH6	2	48026852	48026852	1	Missense_Mutation	c.1730G>A	p.R577H
MFE319	Endometrium	DNMT3B	20	31388000	31388000	1	Missense_Mutation	c.1801T>C	p.Y601H
MFE319	Endometrium	NCOA3	20	46252779	46252779	1	Missense_Mutation	c.208G>A	p.A70T
MFE319	Endometrium	NCOA3	20	46262816	46262816	1	Frame_Shift_Del	c.989_989delC	p.T330fs
MFE319	Endometrium	SMARCB1	22	24175788	24175788	1	Missense_Mutation	c.1043C>T	p.A348V
MFE319	Endometrium	EP300	22	41572452	41572452	1	Nonsense_Mutation	c.4981C>T	p.Q1661*
MFE319	Endometrium	EP300	22	41573420	41573420	1	Missense_Mutation	c.5705C>T	p.A1902V
MFE319	Endometrium	EP300	22	41573728	41573728	1	Nonsense_Mutation	c.6013C>T	p.Q2005*
MFE319	Endometrium	WHSC1	4	1952838	1952838	1	Missense_Mutation	c.1921T>C	p.Y641H
MFE319	Endometrium	BAG6	6	31612922	31612923	-1	Frame_Shift_Ins	c.1187_1188insC	p.P396fs
MFE319	Endometrium	DAXX	6	33289026	33289026	-1	Missense_Mutation	c.562T>G	p.S188A
MFE319	Endometrium	KMT2C	7	151835909	151835909	-1	Missense_Mutation	c.14615C>T	p.S4872F
MFE319	Endometrium	KMT2C	7	151845419	151845419	-1	Missense_Mutation	c.13593G>T	p.E4531D
MFE319	Endometrium	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
MFE319	Endometrium	TNRC18	7	5352791	5352793	-1	In_Frame_Del	c.7729_7731delAGC	p.S2577del
MFE319	Endometrium	KAT6A	8	41790562	41790562	-1	Missense_Mutation	c.5176A>T	p.T1726S
MFE319	Endometrium	BRD3	9	136918528	136918529	-1	Frame_Shift_Ins	c.71_72insC	p.P24fs
MFE319	Endometrium	TAF1L	9	32633584	32633584	-1	Frame_Shift_Del	c.1994_1994delA	p.K665fs
MG63	Bone	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
MHHCALL2	Haematopoietic and lymphoid tissue	TET1	10	70333081	70333081	1	Missense_Mutation	c.986T>G	p.F329C
MHHCALL3	Haematopoietic and lymphoid tissue	LMNB1	5	126147515	126147515	1	Missense_Mutation	c.864T>A	p.S288R
MHHES1	Bone	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
MHHES1	Bone	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
MHHES1	Bone	TRRAP	7	98535325	98535325	1	Missense_Mutation	c.4286C>G	p.P1429R
MHHES1	Bone	TAF1L	9	32630172	32630172	-1	Nonsense_Mutation	c.5406T>G	p.Y1802*
MHHNB11	Autonomic ganglia	CHD5	1	6202503	6202503	-1	Missense_Mutation	c.2206A>G	p.I736V
MHHNB11	Autonomic ganglia	PHIP	6	79655116	79655116	-1	Nonsense_Mutation	c.4729G>T	p.E1577*
MHHNB11	Autonomic ganglia	TRRAP	7	98562317	98562317	1	Missense_Mutation	c.6874G>A	p.V2292I
MIAPACA2	Pancreas	LMNA	1	156106982	156106982	1	Missense_Mutation	c.1567G>A	p.G523R
MIAPACA2	Pancreas	ARID1A	1	27106208	27106208	1	Missense_Mutation	c.5819C>T	p.P1940L
MIAPACA2	Pancreas	ZMYM2	13	20656233	20656233	1	Missense_Mutation	c.3531A>C	p.K1177N
MIAPACA2	Pancreas	NCOA3	20	46252797	46252797	1	Missense_Mutation	c.226G>T	p.V76L
MIAPACA2	Pancreas	NCOA3	20	46252805	46252806	1	Missense_Mutation	c.234_235GA>AT	p.I79L
MIAPACA2	Pancreas	KMT2C	7	152012305	152012305	-1	Missense_Mutation	c.508A>G	p.K170E
MINO	Haematopoietic and lymphoid tissue	TRIM33	1	114944012	114944012	-1	Missense_Mutation	c.2966C>T	p.S989L
MINO	Haematopoietic and lymphoid tissue	MGA	15	42003014	42003015	1	Frame_Shift_Ins	c.2551_2552insC	p.S851fs
MINO	Haematopoietic and lymphoid tissue	DNMT3B	20	31386366	31386366	1	Missense_Mutation	c.1591C>T	p.R531C
MJ	Haematopoietic and lymphoid tissue	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
MJ	Haematopoietic and lymphoid tissue	NIPBL	5	37000636	37000636	1	Missense_Mutation	c.3466A>G	p.M1156V
MJ	Haematopoietic and lymphoid tissue	PHIP	6	79671443	79671443	-1	Frame_Shift_Del	c.3620_3620delG	p.S1207fs
MKN1	Stomach	TRIM24	7	138189146	138189146	1	Nonsense_Mutation	c.476C>G	p.S159*
MKN74	Stomach	SETDB1	1	150933278	150933278	1	Missense_Mutation	c.2740G>A	p.E914K
MKN74	Stomach	CHD5	1	6171872	6171872	-1	Missense_Mutation	c.5212C>T	p.R1738W
MKN74	Stomach	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
MKN7	Stomach	HNF1A	12	121437271	121437271	1	Intron	c.1630G>A	p.A544T
MKN7	Stomach	NCOA1	2	24930342	24930342	1	Missense_Mutation	c.2003C>T	p.S668F
MKN7	Stomach	DAXX	6	33287881	33287883	-1	In_Frame_Del	c.1406_1408delAGG	p.E469del
MKN7	Stomach	TRRAP	7	98490140	98490140	1	Missense_Mutation	c.355C>T	p.R119C
ML1	Thyroid	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
ML1	Thyroid	PSIP1	9	15474026	15474030	-1	Frame_Shift_Del	c.835_839delGGAGA	p.G279fs
MM1S	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
MM1S	Haematopoietic and lymphoid tissue	CHD9	16	53348840	53348840	1	Missense_Mutation	c.7468A>T	p.I2490F
MM1S	Haematopoietic and lymphoid tissue	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
MM1S	Haematopoietic and lymphoid tissue	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
MM1S	Haematopoietic and lymphoid tissue	TNRC18	7	5352659	5352660	-1	In_Frame_Ins	c.7862_7863insATC	p.2621_2621S>SS
MM1S	Haematopoietic and lymphoid tissue	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
MOGGUVW	Central nervous system	BRDT	1	92446535	92446535	1	Missense_Mutation	c.1562A>G	p.Q521R
MOGGUVW	Central nervous system	MGA	15	42041782	42041782	1	Missense_Mutation	c.5977G>T	p.V1993F
MOGGUVW	Central nervous system	KAT6A	8	41906296	41906296	-1	Missense_Mutation	c.200G>A	p.G67E
MOLM13	Haematopoietic and lymphoid tissue	KMT2A	11	118362596	118362596	1	Missense_Mutation	c.4957G>A	p.A1653T
MOLM13	Haematopoietic and lymphoid tissue	NCOA3	20	46262885	46262885	1	Missense_Mutation	c.1058G>T	p.R353L
MOLM16	Haematopoietic and lymphoid tissue	KMT2A	11	118354913	118354913	1	Missense_Mutation	c.4102G>C	p.V1368L
MOLM16	Haematopoietic and lymphoid tissue	CREBBP	16	3778410	3778415	-1	In_Frame_Del	c.6633_6638delACAGCA	p.2211_2213QQQ>Q
MOLM16	Haematopoietic and lymphoid tissue	KAT6A	8	41790829	41790829	-1	Missense_Mutation	c.4909A>T	p.S1637C
MOLM6	Haematopoietic and lymphoid tissue	WHSC1	4	1920021	1920021	1	Missense_Mutation	c.1081A>C	p.K361Q
MOLM6	Haematopoietic and lymphoid tissue	TRRAP	7	98547146	98547146	1	Missense_Mutation	c.4874G>T	p.R1625L
MOLP2	Haematopoietic and lymphoid tissue	KDM5A	12	416960	416960	-1	Missense_Mutation	c.3590A>C	p.Q1197P
MOLP2	Haematopoietic and lymphoid tissue	KDM5A	12	498170	498170	-1	Missense_Mutation	c.88A>G	p.T30A
MOLP2	Haematopoietic and lymphoid tissue	CREBBP	16	3828783	3828783	-1	Missense_Mutation	c.1859C>T	p.A620V
MOLP2	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
MOLP2	Haematopoietic and lymphoid tissue	NIPBL	5	37022203	37022203	1	Missense_Mutation	c.5379G>A	p.M1793I
MOLP2	Haematopoietic and lymphoid tissue	KMT2C	7	151946973	151946973	-1	Missense_Mutation	c.1801C>G	p.L601V
MOLP8	Haematopoietic and lymphoid tissue	LMNA	1	156105772	156105772	1	Silent	c.1017G>A	p.A339A
MOLP8	Haematopoietic and lymphoid tissue	KMT2A	11	118376140	118376140	1	Missense_Mutation	c.9533C>T	p.P3178L
MOLP8	Haematopoietic and lymphoid tissue	TRIM28	19	59060108	59060108	1	Missense_Mutation	c.1325C>T	p.P442L
MOLP8	Haematopoietic and lymphoid tissue	NCOA3	20	46262365	46262365	1	Missense_Mutation	c.949C>T	p.R317C
MOLP8	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
MOLT13	Haematopoietic and lymphoid tissue	KMT2A	11	118348712	118348712	1	Missense_Mutation	c.3365C>T	p.A1122V
MOLT13	Haematopoietic and lymphoid tissue	MGA	15	42032291	42032291	1	Missense_Mutation	c.4475G>A	p.R1492H
MOLT13	Haematopoietic and lymphoid tissue	CHD9	16	53348351	53348351	1	Frame_Shift_Del	c.7285_7285delA	p.K2429fs
MOLT13	Haematopoietic and lymphoid tissue	MLLT6	17	36865505	36865505	1	Missense_Mutation	c.434G>A	p.C145Y
MOLT13	Haematopoietic and lymphoid tissue	DNMT1	19	10250831	10250831	-1	Missense_Mutation	c.3697G>A	p.V1233M
MOLT13	Haematopoietic and lymphoid tissue	HDAC4	2	240098204	240098204	-1	Missense_Mutation	c.395G>A	p.R132Q
MOLT13	Haematopoietic and lymphoid tissue	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
MOLT13	Haematopoietic and lymphoid tissue	HDAC2	6	114292110	114292112	-1	5'UTR	c.243_245delCAG	p.S81del
MOLT13	Haematopoietic and lymphoid tissue	JARID2	6	15487565	15487565	1	Missense_Mutation	c.698G>A	p.R233Q
MOLT13	Haematopoietic and lymphoid tissue	TRRAP	7	98609946	98609946	1	Missense_Mutation	c.11548C>T	p.R3850C
MOLT13	Haematopoietic and lymphoid tissue	NCOA2	8	71033539	71033539	-1	Missense_Mutation	c.4381C>T	p.R1461W
MOLT13	Haematopoietic and lymphoid tissue	KDM6A	X	44942751	44942751	1	Missense_Mutation	c.3487C>T	p.R1163C
MOLT13	Haematopoietic and lymphoid tissue	TAF1	X	70608208	70608208	1	Missense_Mutation	c.2609G>A	p.C870Y
MOLT16	Haematopoietic and lymphoid tissue	HDAC1	1	32797763	32797763	1	Missense_Mutation	c.1292G>A	p.R431H
MOLT16	Haematopoietic and lymphoid tissue	BMI1	10	22617550	22617550	1	Nonsense_Mutation	c.922C>T	p.R308*
MOLT16	Haematopoietic and lymphoid tissue	KMT2A	11	118365075	118365075	1	Nonsense_Mutation	c.5251A>T	p.K1751*
MOLT16	Haematopoietic and lymphoid tissue	EP400	12	132547088	132547093	1	In_Frame_Del	c.8176_8181delCAACAA	p.QQ2746del
MOLT16	Haematopoietic and lymphoid tissue	CHD8	14	21871220	21871220	-1	Missense_Mutation	c.2833T>C	p.C945R
MOLT16	Haematopoietic and lymphoid tissue	SUZ12	17	30315486	30315486	1	Missense_Mutation	c.1171C>T	p.P391S
MOLT16	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
MOLT16	Haematopoietic and lymphoid tissue	JARID2	6	15374381	15374381	1	Missense_Mutation	c.79C>T	p.R27W
MOLT16	Haematopoietic and lymphoid tissue	PHIP	6	79679576	79679577	-1	Missense_Mutation	c.3180_3181TG>CA	p.A1061T
MOLT16	Haematopoietic and lymphoid tissue	TRRAP	7	98513412	98513412	1	Missense_Mutation	c.2266T>C	p.Y756H
MOLT16	Haematopoietic and lymphoid tissue	TRRAP	7	98591251	98591251	1	Missense_Mutation	c.9896G>A	p.R3299H
MONOMAC1	Haematopoietic and lymphoid tissue	TRIM28	19	59059922	59059922	1	Missense_Mutation	c.1286C>T	p.P429L
MONOMAC6	Haematopoietic and lymphoid tissue	KAT6B	10	76788645	76788650	1	In_Frame_Del	c.4063_4068delGAGGAG	p.EE1367del
MONOMAC6	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
MORCPR	Lung	CHD9	16	53342630	53342630	1	Missense_Mutation	c.7086A>T	p.Q2362H
MORCPR	Lung	ATF2	2	175962194	175962194	-1	Missense_Mutation	c.956C>A	p.A319D
MORCPR	Lung	EP300	22	41572888	41572888	1	Nonsense_Mutation	c.5173C>T	p.Q1725*
MORCPR	Lung	TRRAP	7	98535385	98535385	1	Missense_Mutation	c.4346C>G	p.T1449S
MORCPR	Lung	ATRX	X	76939005	76939005	-1	Missense_Mutation	c.1743A>T	p.K581N
MOTN1	Haematopoietic and lymphoid tissue	CHD9	16	53191422	53191422	1	Missense_Mutation	c.1421A>G	p.H474R
MOTN1	Haematopoietic and lymphoid tissue	TAF1L	9	32633206	32633206	-1	Missense_Mutation	c.2372A>G	p.Y791C
MPP89	Pleura	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
MPP89	Pleura	KDM6A	X	44936068	44936068	1	Missense_Mutation	c.2985T>G	p.I995M
MUTZ3	Haematopoietic and lymphoid tissue	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
MUTZ5	Haematopoietic and lymphoid tissue	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
MUTZ5	Haematopoietic and lymphoid tissue	NCOA3	20	46264085	46264085	1	Missense_Mutation	c.1132C>T	p.P378S
MUTZ5	Haematopoietic and lymphoid tissue	NSD1	5	176637415	176637415	1	Missense_Mutation	c.2015C>T	p.T672I
MUTZ5	Haematopoietic and lymphoid tissue	IKZF1	7	50444469	50444470	1	Frame_Shift_Ins	c.399_400insGGGGCTCC	p.M133fs
MUTZ5	Haematopoietic and lymphoid tissue	WHSC1L1	8	38194954	38194954	-1	Missense_Mutation	c.779C>A	p.T260K
MV411	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NALM19	Haematopoietic and lymphoid tissue	KMT2C	7	151855953	151855953	-1	Missense_Mutation	c.11665A>C	p.K3889Q
NALM19	Haematopoietic and lymphoid tissue	TAF1	X	70643066	70643066	1	Missense_Mutation	c.4612C>G	p.Q1538E
NALM1	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NALM1	Haematopoietic and lymphoid tissue	KAT6A	8	41804177	41804177	-1	Missense_Mutation	c.1928A>T	p.N643I
NALM6	Haematopoietic and lymphoid tissue	BRDT	1	92430236	92430236	1	Missense_Mutation	c.245G>A	p.R82H
NALM6	Haematopoietic and lymphoid tissue	KDM5A	12	420116	420116	-1	Missense_Mutation	c.3151C>T	p.R1051W
NALM6	Haematopoietic and lymphoid tissue	TP53BP1	15	43713332	43713333	-1	Nonsense_Mutation	c.4140_4141delTG	p.C1380fs
NALM6	Haematopoietic and lymphoid tissue	CREBBP	16	3781306	3781306	-1	Missense_Mutation	c.5059T>C	p.S1687P
NALM6	Haematopoietic and lymphoid tissue	MLLT6	17	36873007	36873007	1	Missense_Mutation	c.1424G>A	p.R475H
NALM6	Haematopoietic and lymphoid tissue	KAT7	17	47875714	47875714	1	Missense_Mutation	c.374C>T	p.P125L
NALM6	Haematopoietic and lymphoid tissue	DNMT1	19	10251513	10251513	-1	Missense_Mutation	c.3467G>A	p.R1156Q
NALM6	Haematopoietic and lymphoid tissue	SMARCA4	19	11106922	11106922	1	Missense_Mutation	c.1627G>A	p.D543N
NALM6	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NALM6	Haematopoietic and lymphoid tissue	EP300	22	41543891	41543891	1	Missense_Mutation	c.2182C>T	p.R728W
NALM6	Haematopoietic and lymphoid tissue	BAP1	3	52438571	52438571	-1	Missense_Mutation	c.1148G>A	p.R383H
NALM6	Haematopoietic and lymphoid tissue	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
NALM6	Haematopoietic and lymphoid tissue	NIPBL	5	37017185	37017185	1	Missense_Mutation	c.4841G>A	p.G1614E
NALM6	Haematopoietic and lymphoid tissue	PHIP	6	79668267	79668267	-1	Missense_Mutation	c.3707G>A	p.R1236Q
NALM6	Haematopoietic and lymphoid tissue	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
NALM6	Haematopoietic and lymphoid tissue	WHSC1L1	8	38157027	38157027	-1	Missense_Mutation	c.2693G>A	p.R898H
NALM6	Haematopoietic and lymphoid tissue	WHSC1L1	8	38173512	38173512	-1	Missense_Mutation	c.1904G>A	p.R635H
NALM6	Haematopoietic and lymphoid tissue	HDAC6	X	48674937	48674937	1	Missense_Mutation	c.1688G>C	p.S563T
NAMALWA	Haematopoietic and lymphoid tissue	ARID1A	1	27023720	27023720	1	Nonsense_Mutation	c.826G>T	p.G276*
NAMALWA	Haematopoietic and lymphoid tissue	ERCC6	10	50740667	50740667	-1	Missense_Mutation	c.344A>T	p.N115I
NAMALWA	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NAMALWA	Haematopoietic and lymphoid tissue	SP110	2	231050821	231050821	-1	Frame_Shift_Del	c.1168_1168delC	p.Q390fs
NAMALWA	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NB1	Autonomic ganglia	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
NB1	Autonomic ganglia	KMT2A	11	118392738	118392738	1	Missense_Mutation	c.11770G>T	p.D3924Y
NB1	Autonomic ganglia	KDM5A	12	438152	438152	-1	Missense_Mutation	c.1817G>T	p.R606M
NB1	Autonomic ganglia	KMT2D	12	49426754	49426759	-1	In_Frame_Del	c.11729_11734delAGCAAC	p.QQ3910del
NB1	Autonomic ganglia	SP140	2	231102991	231102991	1	Nonsense_Mutation	c.301G>T	p.E101*
NB1	Autonomic ganglia	STK31	7	23802525	23802525	1	Missense_Mutation	c.1399C>G	p.R467G
NB1	Autonomic ganglia	TAF1	X	70618475	70618475	1	Missense_Mutation	c.3734G>A	p.R1245Q
NB4	Haematopoietic and lymphoid tissue	MGA	15	42041782	42041782	1	Missense_Mutation	c.5977G>T	p.V1993F
NB4	Haematopoietic and lymphoid tissue	EP300	22	41574892	41574892	1	Missense_Mutation	c.7177C>G	p.L2393V
NB4	Haematopoietic and lymphoid tissue	KAT6A	8	41832298	41832298	-1	Missense_Mutation	c.1406G>A	p.R469Q
NCCSTCK140	Stomach	NCOA4	10	51584882	51584883	1	Frame_Shift_Ins	c.1029_1030insT	p.K343fs
NCCSTCK140	Stomach	KAT6B	10	76788645	76788647	1	In_Frame_Del	c.4063_4065delGAG	p.E1368del
NCCSTCK140	Stomach	DNMT3B	20	31389130	31389130	1	Silent	c.2043C>T	p.Y681Y
NCCSTCK140	Stomach	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCCSTCK140	Stomach	BAG6	6	31612929	31612929	-1	Missense_Mutation	c.1181C>A	p.P394H
NCIH1048	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NCIH1048	Lung	ZMYM2	13	20567561	20567561	1	Missense_Mutation	c.349A>T	p.I117F
NCIH1048	Lung	CREBBP	16	3781324	3781326	-1	In_Frame_Del	c.5039_5041delCCT	p.S1680del
NCIH1048	Lung	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
NCIH1048	Lung	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
NCIH1048	Lung	TRRAP	7	98534806	98534806	1	Missense_Mutation	c.4139C>T	p.P1380L
NCIH1048	Lung	BRD3	9	136901318	136901318	-1	Missense_Mutation	c.1772A>G	p.K591R
NCIH1092	Lung	SETDB1	1	150935173	150935173	1	Missense_Mutation	c.3269C>A	p.A1090D
NCIH1092	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH1092	Lung	SMARCA4	19	11123701	11123701	1	Missense_Mutation	c.2351G>A	p.G784E
NCIH1092	Lung	NCOA3	20	46279861	46279866	1	In_Frame_Del	c.3787_3792delCAGCAA	p.QQ1275del
NCIH1092	Lung	WHSC1	4	1953870	1953870	1	Missense_Mutation	c.2049A>T	p.E683D
NCIH1092	Lung	TRRAP	7	98553812	98553812	1	Missense_Mutation	c.5960G>A	p.S1987N
NCIH1105	Lung	BRDT	1	92441946	92441946	1	Missense_Mutation	c.581A>T	p.N194I
NCIH1105	Lung	CREBBP	16	3841985	3841985	-1	Nonsense_Mutation	c.1327C>T	p.Q443*
NCIH1105	Lung	PHF3	6	64395304	64395304	1	Missense_Mutation	c.1681T>C	p.C561R
NCIH1105	Lung	TRRAP	7	98548569	98548569	1	Missense_Mutation	c.5384G>T	p.G1795V
NCIH1184	Lung	TET1	10	70412301	70412301	1	Missense_Mutation	c.4411T>A	p.Y1471N
NCIH1184	Lung	TP53BP1	15	43749151	43749151	-1	Missense_Mutation	c.1655A>G	p.D552G
NCIH1184	Lung	KAT7	17	47904793	47904793	1	Missense_Mutation	c.1765G>T	p.A589S
NCIH1184	Lung	SP140	2	231135339	231135339	1	Missense_Mutation	c.1483C>T	p.P495S
NCIH1184	Lung	HDAC4	2	240002837	240002837	-1	Missense_Mutation	c.2689G>T	p.G897C
NCIH1184	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH1184	Lung	HDAC6	X	48681726	48681726	1	Missense_Mutation	c.2917G>C	p.G973R
NCIH1299	Lung	CHD8	14	21870168	21870168	-1	Missense_Mutation	c.3173G>A	p.R1058Q
NCIH1339	Lung	EP300	22	41537164	41537164	1	Missense_Mutation	c.1991T>G	p.M664R
NCIH1339	Lung	EP300	22	41566508	41566512	1	Frame_Shift_Del	c.4385_4389delGACTG	p.R1462fs
NCIH1339	Lung	NSD1	5	176707635	176707635	1	Nonsense_Mutation	c.5692A>T	p.K1898*
NCIH1339	Lung	NSD1	5	176719126	176719126	1	Missense_Mutation	c.6430G>T	p.A2144S
NCIH1339	Lung	PHF3	6	64394126	64394126	1	Missense_Mutation	c.503C>T	p.T168I
NCIH1339	Lung	PHF3	6	64421782	64421782	1	Missense_Mutation	c.4298A>T	p.K1433I
NCIH1339	Lung	TNRC18	7	5352791	5352799	-1	In_Frame_Del	c.7723_7731delAGCAGCAGC	p.SSS2575del
NCIH1339	Lung	NCOA2	8	71082481	71082481	-1	Missense_Mutation	c.497G>T	p.G166V
NCIH1339	Lung	TAF1	X	70601678	70601678	1	Missense_Mutation	c.1506G>T	p.E502D
NCIH1341	Lung	SETDB1	1	150936032	150936055	1	In_Frame_Del	c.3484_3507delAAATCAACCCGAGGCTTTGCTCTT	p.KSTRGFAL1162del
NCIH1355	Lung	CHD5	1	6228261	6228261	-1	Missense_Mutation	c.156A>T	p.K52N
NCIH1355	Lung	WHSC1	4	1955194	1955194	1	Missense_Mutation	c.2281C>A	p.L761I
NCIH1355	Lung	KMT2C	7	151849973	151849973	-1	Missense_Mutation	c.12343G>T	p.V4115F
NCIH1373	Lung	BRDT	1	92442850	92442850	1	Missense_Mutation	c.881C>T	p.S294L
NCIH1373	Lung	KAT6B	10	76735395	76735395	1	Missense_Mutation	c.1300C>T	p.L434F
NCIH1373	Lung	HDAC4	2	239976481	239976481	-1	Missense_Mutation	c.3037G>T	p.A1013S
NCIH1373	Lung	TAF1L	9	32630486	32630486	-1	Missense_Mutation	c.5092G>T	p.A1698S
NCIH1373	Lung	TAF1L	9	32632349	32632349	-1	Missense_Mutation	c.3229C>A	p.H1077N
NCIH1385	Lung	BRDT	1	92441987	92441987	1	Missense_Mutation	c.622G>T	p.A208S
NCIH1385	Lung	ZMYM2	13	20625619	20625619	1	Missense_Mutation	c.2339G>A	p.R780Q
NCIH1385	Lung	RAI1	17	17697094	17697099	1	In_Frame_Del	c.832_837delCAGCAG	p.QQ290del
NCIH1385	Lung	SUZ12	17	30325730	30325730	1	Missense_Mutation	c.1928A>G	p.Y643C
NCIH1385	Lung	NCOA3	20	46255814	46255814	1	Silent	c.426A>T	p.T142T
NCIH1385	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH1385	Lung	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
NCIH1385	Lung	TRRAP	7	98592282	98592282	1	Missense_Mutation	c.10078G>A	p.D3360N
NCIH1385	Lung	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
NCIH1435	Lung	KAT6B	10	76790330	76790330	1	Missense_Mutation	c.5748G>T	p.Q1916H
NCIH1435	Lung	CHD9	16	53341776	53341776	1	Missense_Mutation	c.6964G>T	p.G2322C
NCIH1435	Lung	SMARCA4	19	11141507	11141507	1	Missense_Mutation	c.3484G>T	p.G1162C
NCIH1435	Lung	SP140	2	231134624	231134624	1	Missense_Mutation	c.1400G>A	p.S467N
NCIH1435	Lung	CHD1	5	98234368	98234368	-1	Missense_Mutation	c.1186G>T	p.A396S
NCIH1435	Lung	KMT2C	7	151860480	151860480	-1	Missense_Mutation	c.10182T>A	p.S3394R
NCIH1436	Lung	TRIM33	1	114951305	114951305	-1	Missense_Mutation	c.2252G>A	p.R751Q
NCIH1436	Lung	ARID1A	1	27088682	27088682	1	Frame_Shift_Del	c.2291_2291delC	p.S764fs
NCIH1436	Lung	BRDT	1	92446562	92446562	1	Missense_Mutation	c.1589C>T	p.P530L
NCIH1436	Lung	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
NCIH1436	Lung	TP53BP1	15	43708569	43708569	-1	Missense_Mutation	c.4727G>A	p.S1576N
NCIH1436	Lung	PHIP	6	79650735	79650735	-1	Missense_Mutation	c.5141G>A	p.R1714K
NCIH1436	Lung	TAF1L	9	32631149	32631149	-1	Missense_Mutation	c.4429A>G	p.T1477A
NCIH1436	Lung	TAF1L	9	32633790	32633790	-1	Missense_Mutation	c.1788A>T	p.Q596H
NCIH1436	Lung	KDM6A	X	44966737	44966737	1	Missense_Mutation	c.4117G>T	p.G1373W
NCIH1437	Lung	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
NCIH1437	Lung	NIPBL	5	36976054	36976054	1	Missense_Mutation	c.1045A>T	p.S349C
NCIH1437	Lung	KMT2C	7	151919709	151919709	-1	Missense_Mutation	c.3382G>A	p.D1128N
NCIH1437	Lung	WHSC1L1	8	38187396	38187396	-1	Missense_Mutation	c.1081C>T	p.P361S
NCIH146	Lung	SIRT1	10	69672769	69672769	1	Missense_Mutation	c.1896G>T	p.Q632H
NCIH146	Lung	TRIM28	19	59059717	59059717	1	Missense_Mutation	c.1158T>G	p.H386Q
NCIH146	Lung	KAT6A	8	41789742	41789742	-1	Missense_Mutation	c.5996G>T	p.G1999V
NCIH1563	Lung	ARID1A	1	27100949	27100949	1	Nonsense_Mutation	c.4231C>T	p.Q1411*
NCIH1563	Lung	MLLT10	10	22002851	22002851	1	Missense_Mutation	c.1898C>G	p.S633C
NCIH1563	Lung	MSH6	2	48010561	48010561	1	Silent	c.189C>T	p.S63S
NCIH1563	Lung	TNRC18	7	5352621	5352635	-1	In_Frame_Del	c.7887_7901delATCCTCCTCTTCCTC	p.2629_2634SSSSSS>S
NCIH1568	Lung	SMARCA4	19	11152157	11152157	1	Nonsense_Mutation	c.4441G>T	p.E1481*
NCIH1568	Lung	TFPT	19	54618647	54618647	-1	Translation_Start_Site	c.3G>A	p.M1I
NCIH1568	Lung	ATF2	2	175957896	175957896	-1	Missense_Mutation	c.1078G>C	p.E360Q
NCIH1568	Lung	CHD1	5	98236602	98236602	-1	Missense_Mutation	c.772G>T	p.V258F
NCIH1568	Lung	WHSC1L1	8	38194841	38194841	-1	Missense_Mutation	c.892A>G	p.T298A
NCIH1573	Lung	PRDM16	1	3328390	3328390	1	Missense_Mutation	c.1629G>T	p.Q543H
NCIH1573	Lung	CHD8	14	21871259	21871259	-1	Missense_Mutation	c.2794G>T	p.A932S
NCIH1573	Lung	SMARCA4	19	11152007	11152007	1	Nonsense_Mutation	c.4291G>T	p.E1431*
NCIH1573	Lung	TET2	4	106156019	106156019	1	Missense_Mutation	c.983T>G	p.L328R
NCIH1573	Lung	PHIP	6	79700602	79700602	-1	Missense_Mutation	c.2302A>G	p.I768V
NCIH1573	Lung	HDAC8	X	71788640	71788640	-1	Missense_Mutation	c.259G>T	p.D87Y
NCIH1581	Lung	ARID1A	1	27105886	27105886	1	Missense_Mutation	c.5497C>T	p.R1833C
NCIH1581	Lung	NCOA1	2	24888746	24888746	1	Missense_Mutation	c.218C>T	p.T73I
NCIH1618	Lung	MLLT10	10	22024103	22024103	1	Missense_Mutation	c.2942G>A	p.R981Q
NCIH1618	Lung	MGA	15	41989180	41989180	1	Missense_Mutation	c.1972G>C	p.E658Q
NCIH1618	Lung	EP300	22	41565574	41565574	1	Missense_Mutation	c.4240T>G	p.Y1414D
NCIH1623	Lung	BRDT	1	92443813	92443813	1	Missense_Mutation	c.1070C>A	p.P357H
NCIH1623	Lung	TET1	10	70333887	70333887	1	Missense_Mutation	c.1792C>A	p.Q598K
NCIH1623	Lung	KDM5A	12	420191	420191	-1	Missense_Mutation	c.3076T>A	p.L1026M
NCIH1623	Lung	TRRAP	7	98559075	98559075	1	Missense_Mutation	c.6660G>A	p.M2220I
NCIH1648	Lung	MLLT10	10	21962354	21962354	1	Missense_Mutation	c.1127G>A	p.S376N
NCIH1648	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH1648	Lung	EP300	22	41542748	41542748	1	Missense_Mutation	c.2059C>T	p.P687S
NCIH1648	Lung	NSD1	5	176707761	176707761	1	Missense_Mutation	c.5818C>A	p.Q1940K
NCIH1648	Lung	TRRAP	7	98506579	98506579	1	Missense_Mutation	c.1344G>T	p.M448I
NCIH1650	Lung	SMARCA4	19	11141513	11141513	1	Missense_Mutation	c.3490A>T	p.N1164Y
NCIH1650	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH1651	Lung	CREBBP	16	3777786	3777786	-1	Missense_Mutation	c.7262C>T	p.S2421F
NCIH1651	Lung	DAXX	6	33289506	33289507	-1	Frame_Shift_Ins	c.232_233insC	p.L78fs
NCIH1651	Lung	KMT2C	7	151935901	151935901	-1	Missense_Mutation	c.2543G>A	p.S848N
NCIH1651	Lung	NCOA2	8	71069228	71069228	-1	Missense_Mutation	c.1372C>A	p.P458T
NCIH1651	Lung	KDM6A	X	44938537	44938537	1	Missense_Mutation	c.3241C>T	p.H1081Y
NCIH1693	Lung	SUZ12	17	30320902	30320902	1	Missense_Mutation	c.1312A>T	p.T438S
NCIH1693	Lung	SMARCA4	19	11138497	11138513	1	Frame_Shift_Del	c.3253_3269delCTTGATAGAATTCTTCC	p.L1085fs
NCIH1694	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH1694	Lung	TRRAP	7	98602852	98602852	1	Missense_Mutation	c.10592T>G	p.M3531R
NCIH1703	Lung	CREBBP	16	3778524	3778524	-1	Missense_Mutation	c.6524A>G	p.N2175S
NCIH1703	Lung	CREBBP	16	3786795	3786795	-1	Missense_Mutation	c.4416G>T	p.W1472C
NCIH1703	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH1703	Lung	EP300	22	41566433	41566433	1	Missense_Mutation	c.4310C>T	p.A1437V
NCIH1703	Lung	KMT2C	7	151933009	151933009	-1	Missense_Mutation	c.2662T>A	p.S888T
NCIH1734	Lung	SETDB1	1	150936473	150936473	1	Missense_Mutation	c.3672C>A	p.H1224Q
NCIH1734	Lung	PRDM16	1	3328826	3328826	1	Missense_Mutation	c.2065G>A	p.A689T
NCIH1734	Lung	ING1	13	111372209	111372209	1	Missense_Mutation	c.1199G>T	p.R400L
NCIH1755	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH1781	Lung	TET1	10	70451383	70451383	1	Missense_Mutation	c.6223A>T	p.N2075Y
NCIH1781	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NCIH1781	Lung	KDM5A	12	465673	465673	-1	Missense_Mutation	c.703G>C	p.E235Q
NCIH1781	Lung	MSH6	2	48030629	48030629	1	Missense_Mutation	c.3243G>T	p.L1081F
NCIH1781	Lung	KMT2C	7	151946985	151946985	-1	Missense_Mutation	c.1789G>C	p.D597H
NCIH1792	Lung	PRDM16	1	3328335	3328335	1	Missense_Mutation	c.1574G>A	p.R525Q
NCIH1792	Lung	TNRC18	7	5352635	5352636	-1	In_Frame_Ins	c.7886_7887insCTC	p.2629_2629S>SS
NCIH1793	Lung	ARID1A	1	27089696	27089696	1	Nonsense_Mutation	c.2652T>A	p.C884*
NCIH1793	Lung	ING1	13	111367947	111367947	1	Missense_Mutation	c.157G>A	p.D53N
NCIH1793	Lung	SMARCA4	19	11105624	11105624	1	Nonsense_Mutation	c.1540G>T	p.E514*
NCIH1793	Lung	NCOA3	20	46264067	46264067	1	Nonsense_Mutation	c.1114G>T	p.E372*
NCIH1793	Lung	CHD1	5	98236974	98236974	-1	Missense_Mutation	c.503A>G	p.E168G
NCIH1793	Lung	PHIP	6	79770279	79770279	-1	Missense_Mutation	c.355G>T	p.V119L
NCIH1793	Lung	TRRAP	7	98527717	98527717	1	Missense_Mutation	c.3281A>C	p.D1094A
NCIH1793	Lung	KAT6A	8	41906045	41906045	-1	Missense_Mutation	c.451A>T	p.I151F
NCIH1836	Lung	PRDM16	1	3329180	3329180	1	Missense_Mutation	c.2419A>G	p.I807V
NCIH1836	Lung	SIRT1	10	69672357	69672357	1	Missense_Mutation	c.1484G>A	p.G495D
NCIH1836	Lung	EP300	22	41565520	41565520	1	Missense_Mutation	c.4186T>C	p.S1396P
NCIH1836	Lung	TAF1	X	70597567	70597568	1	In_Frame_Ins	c.889_890insAGG	p.298_299insE
NCIH1838	Lung	TET1	10	70332144	70332144	1	Missense_Mutation	c.49G>A	p.D17N
NCIH1838	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH1838	Lung	PHF3	6	64421527	64421527	1	Missense_Mutation	c.4043G>T	p.R1348L
NCIH1869	Lung	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
NCIH1869	Lung	MLLT10	10	21906046	21906046	1	Missense_Mutation	c.609G>C	p.K203N
NCIH1869	Lung	KMT2C	7	152027725	152027725	-1	Missense_Mutation	c.350C>T	p.A117V
NCIH1876	Lung	CHD5	1	6184043	6184043	-1	Missense_Mutation	c.4664C>A	p.P1555H
NCIH1876	Lung	CREBBP	16	3808968	3808968	-1	Nonsense_Mutation	c.3256A>T	p.K1086*
NCIH1876	Lung	SP140	2	231134668	231134668	1	Missense_Mutation	c.1444G>T	p.D482Y
NCIH1876	Lung	TRRAP	7	98606063	98606063	1	Missense_Mutation	c.10775C>G	p.S3592C
NCIH1876	Lung	TAF1L	9	32631284	32631284	-1	Missense_Mutation	c.4294G>T	p.V1432F
NCIH1915	Lung	NCOA4	10	51582857	51582857	1	Missense_Mutation	c.680C>T	p.A227V
NCIH1915	Lung	HDAC4	2	240024481	240024481	-1	Missense_Mutation	c.2209A>C	p.K737Q
NCIH1915	Lung	KMT2C	7	151945033	151945033	-1	Missense_Mutation	c.2486C>A	p.A829D
NCIH1930	Lung	TRIM33	1	114970452	114970452	-1	Missense_Mutation	c.1220G>T	p.R407L
NCIH1930	Lung	MEN1	11	64574680	64574680	-1	Missense_Mutation	c.810G>T	p.W270C
NCIH1930	Lung	MGA	15	41991322	41991322	1	Frame_Shift_Del	c.2153_2153delG	p.R718fs
NCIH1930	Lung	SMARCA4	19	11141499	11141499	1	Missense_Mutation	c.3476G>T	p.G1159V
NCIH1930	Lung	ATF2	2	175957985	175957985	-1	Missense_Mutation	c.989C>G	p.A330G
NCIH1930	Lung	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
NCIH1930	Lung	DAXX	6	33287860	33287860	-1	Nonsense_Mutation	c.1429G>T	p.E477*
NCIH1930	Lung	ATRX	X	76937124	76937124	-1	Missense_Mutation	c.3624A>G	p.I1208M
NCIH1944	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH1944	Lung	SUZ12	17	30320891	30320891	1	Missense_Mutation	c.1301A>G	p.Y434C
NCIH1944	Lung	NCOA1	2	24930384	24930384	1	Missense_Mutation	c.2045C>T	p.S682L
NCIH1944	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH1944	Lung	HDAC2	6	114277240	114277240	-1	Missense_Mutation	c.716A>C	p.K239T
NCIH1944	Lung	WHSC1L1	8	38133322	38133322	-1	Nonsense_Mutation	c.4151C>G	p.S1384*
NCIH1963	Lung	KMT2A	11	118343686	118343689	1	Frame_Shift_Del	c.1812_1815delGCAA	p.M604fs
NCIH1963	Lung	CHD9	16	53358095	53358095	1	Missense_Mutation	c.7982A>G	p.N2661S
NCIH1963	Lung	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
NCIH196	Lung	SETDB1	1	150921610	150921610	1	Missense_Mutation	c.1280G>T	p.S427I
NCIH196	Lung	ZMYM2	13	20579236	20579236	1	Missense_Mutation	c.1156A>G	p.T386A
NCIH196	Lung	CHD8	14	21871778	21871778	-1	Missense_Mutation	c.2515A>G	p.I839V
NCIH196	Lung	WHSC1L1	8	38139056	38139056	-1	Missense_Mutation	c.3547G>A	p.E1183K
NCIH1975	Lung	KAT6B	10	76736061	76736061	1	Missense_Mutation	c.1966G>A	p.G656R
NCIH1975	Lung	NSD1	5	176637295	176637295	1	Missense_Mutation	c.1895G>A	p.R632Q
NCIH2009	Lung	TRIM33	1	114948369	114948369	-1	Missense_Mutation	c.2431G>A	p.E811K
NCIH2009	Lung	KAT6B	10	76784794	76784794	1	Nonsense_Mutation	c.3451G>T	p.E1151*
NCIH2009	Lung	CREBBP	16	3900896	3900896	-1	Missense_Mutation	c.200A>G	p.H67R
NCIH2009	Lung	CHD9	16	53272301	53272301	1	Missense_Mutation	c.2680C>G	p.Q894E
NCIH2009	Lung	ATF2	2	175976330	175976330	-1	Missense_Mutation	c.794C>T	p.S265F
NCIH2009	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH2009	Lung	CHD1	5	98192179	98192179	-1	Missense_Mutation	c.5038G>T	p.D1680Y
NCIH2009	Lung	NCOA2	8	71050502	71050502	-1	Missense_Mutation	c.3094C>G	p.Q1032E
NCIH2009	Lung	TAF1L	9	32633294	32633294	-1	Missense_Mutation	c.2284C>A	p.L762I
NCIH2023	Lung	CHD5	1	6202264	6202264	-1	Missense_Mutation	c.2360G>T	p.R787L
NCIH2023	Lung	SMARCA4	19	11129671	11129671	1	Frame_Shift_Del	c.2477_2477delC	p.A826fs
NCIH2023	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH2023	Lung	WHSC1	4	1902655	1902655	1	Missense_Mutation	c.274G>T	p.G92C
NCIH2023	Lung	HDAC2	6	114292110	114292112	-1	5'UTR	c.243_245delCAG	p.S81del
NCIH2023	Lung	KMT2C	7	151932957	151932957	-1	Missense_Mutation	c.2714G>C	p.G905A
NCIH2023	Lung	TAF1L	9	32633387	32633387	-1	Missense_Mutation	c.2191C>A	p.P731T
NCIH2029	Lung	BRDT	1	92443849	92443849	1	Missense_Mutation	c.1106T>C	p.L369P
NCIH2029	Lung	NCOA2	8	71050492	71050492	-1	Missense_Mutation	c.3104C>T	p.P1035L
NCIH2030	Lung	CHD5	1	6181180	6181180	-1	Nonsense_Mutation	c.4897G>T	p.E1633*
NCIH2030	Lung	KMT2C	7	151878299	151878299	-1	Missense_Mutation	c.6646G>T	p.V2216F
NCIH2030	Lung	KMT2C	7	151932955	151932955	-1	Missense_Mutation	c.2716G>T	p.G906C
NCIH2030	Lung	KAT6A	8	41801435	41801435	-1	Missense_Mutation	c.2059G>T	p.G687C
NCIH2066	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
NCIH2066	Lung	LMNB2	19	2434060	2434060	-1	Nonsense_Mutation	c.1246C>T	p.R416*
NCIH2066	Lung	LMNB2	19	2434301	2434302	-1	Missense_Mutation	c.1193_1194AG>GC	p.E398G
NCIH2066	Lung	HDAC4	2	240002862	240002862	-1	Missense_Mutation	c.2664C>G	p.F888L
NCIH2066	Lung	NCOA1	2	24930323	24930323	1	Missense_Mutation	c.1984G>T	p.G662C
NCIH2073	Lung	NCOA2	8	71068901	71068901	-1	Missense_Mutation	c.1699G>T	p.V567F
NCIH2081	Lung	NIPBL	5	37019501	37019501	1	Missense_Mutation	c.5009T>G	p.V1670G
NCIH2081	Lung	ATRX	X	76888825	76888825	-1	Missense_Mutation	c.5004G>T	p.M1668I
NCIH2081	Lung	ATRX	X	76937401	76937401	-1	Missense_Mutation	c.3347C>G	p.S1116C
NCIH2087	Lung	ERCC6	10	50679094	50679094	-1	Missense_Mutation	c.2997T>A	p.N999K
NCIH2087	Lung	MGA	15	42041782	42041782	1	Missense_Mutation	c.5977G>T	p.V1993F
NCIH2087	Lung	CREBBP	16	3779510	3779510	-1	Missense_Mutation	c.5538C>G	p.I1846M
NCIH2087	Lung	CHD1	5	98235187	98235187	-1	Missense_Mutation	c.1082G>C	p.R361T
NCIH2087	Lung	ASH2L	8	37986416	37986416	1	Missense_Mutation	c.1474C>A	p.L492I
NCIH209	Lung	MEN1	11	64575097	64575097	-1	Missense_Mutation	c.725C>T	p.A242V
NCIH209	Lung	MSH6	2	48033750	48033750	1	Missense_Mutation	c.3961A>G	p.R1321G
NCIH209	Lung	TET2	4	106156019	106156019	1	Missense_Mutation	c.983T>G	p.L328R
NCIH209	Lung	KMT2C	7	151860446	151860446	-1	Missense_Mutation	c.10216G>A	p.E3406K
NCIH2106	Lung	ARID1A	1	27092726	27092726	1	Missense_Mutation	c.2747C>T	p.P916L
NCIH2106	Lung	BRDT	1	92442843	92442843	1	Missense_Mutation	c.874C>T	p.H292Y
NCIH2106	Lung	KMT2A	11	118392625	118392625	1	Missense_Mutation	c.11657A>C	p.Y3886S
NCIH2106	Lung	CREBBP	16	3778972	3778972	-1	Missense_Mutation	c.6076C>T	p.L2026F
NCIH2106	Lung	DNMT1	19	10273370	10273370	-1	Missense_Mutation	c.981T>G	p.I327M
NCIH2106	Lung	NCOA3	20	46264449	46264449	1	Missense_Mutation	c.1496C>T	p.P499L
NCIH2106	Lung	BAP1	3	52436847	52436847	-1	Missense_Mutation	c.1931C>T	p.A644V
NCIH2106	Lung	CHD1	5	98204219	98204219	-1	Missense_Mutation	c.4228G>A	p.D1410N
NCIH2106	Lung	STK31	7	23821122	23821122	1	Missense_Mutation	c.2050C>T	p.H684Y
NCIH2110	Lung	ARID1A	1	27092965	27092965	1	Missense_Mutation	c.2896G>A	p.E966K
NCIH2110	Lung	NCOA4	10	51586298	51586298	1	Missense_Mutation	c.1774G>A	p.E592K
NCIH2110	Lung	TET1	10	70432714	70432714	1	Missense_Mutation	c.4736G>A	p.C1579Y
NCIH2110	Lung	DNMT1	19	10248627	10248627	-1	Missense_Mutation	c.4174G>C	p.E1392Q
NCIH2110	Lung	NCOA1	2	24949517	24949517	1	Missense_Mutation	c.2659G>C	p.D887H
NCIH2110	Lung	NIPBL	5	37000504	37000504	1	Missense_Mutation	c.3334G>A	p.D1112N
NCIH2110	Lung	DAXX	6	33288161	33288161	-1	Missense_Mutation	c.1283G>T	p.G428V
NCIH2110	Lung	TRIM24	7	138255719	138255719	1	Missense_Mutation	c.1849G>C	p.G617R
NCIH2110	Lung	TRIM24	7	138269668	138269668	1	Missense_Mutation	c.3125G>A	p.S1042N
NCIH211	Lung	CREBBP	16	3786075	3786075	-1	Missense_Mutation	c.4690A>G	p.K1564E
NCIH211	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH211	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
NCIH211	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH211	Lung	BAP1	3	52441237	52441237	-1	Missense_Mutation	c.533G>T	p.G178V
NCIH211	Lung	PSIP1	9	15486874	15486874	-1	Missense_Mutation	c.344C>G	p.T115S
NCIH2122	Lung	ATF2	2	175983076	175983076	-1	Missense_Mutation	c.221G>A	p.R74K
NCIH2122	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH2126	Lung	SMARCA4	19	11123640	11123640	1	Missense_Mutation	c.2290T>A	p.W764R
NCIH2126	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH2126	Lung	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
NCIH2126	Lung	IKZF1	7	50468062	50468062	1	Missense_Mutation	c.1297C>A	p.R433S
NCIH2126	Lung	TAF1L	9	32633196	32633196	-1	Missense_Mutation	c.2382A>C	p.E794D
NCIH2141	Lung	NIPBL	5	36985003	36985003	1	Missense_Mutation	c.1721A>G	p.N574S
NCIH2141	Lung	KMT2C	7	151873293	151873293	-1	Missense_Mutation	c.9245C>T	p.P3082L
NCIH2170	Lung	BRDT	1	92446243	92446243	1	Missense_Mutation	c.1343C>A	p.P448H
NCIH2170	Lung	MGA	15	42035082	42035082	1	Missense_Mutation	c.4924G>A	p.E1642K
NCIH2170	Lung	CHD9	16	53337881	53337881	1	Missense_Mutation	c.5963G>C	p.R1988P
NCIH2170	Lung	TRIM28	19	59059717	59059717	1	Missense_Mutation	c.1158T>G	p.H386Q
NCIH2170	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH2170	Lung	EP300	22	41562653	41562653	1	Missense_Mutation	c.3857A>G	p.N1286S
NCIH2171	Lung	CHD5	1	6186793	6186793	-1	Missense_Mutation	c.3917G>T	p.R1306L
NCIH2171	Lung	HNF1A	12	121434089	121434089	1	Missense_Mutation	c.980C>T	p.T327I
NCIH2171	Lung	TAF1L	9	32635438	32635438	-1	Missense_Mutation	c.140G>C	p.G47A
NCIH2172	Lung	ARID1A	1	27105549	27105549	1	Frame_Shift_Del	c.5160_5160delC	p.F1720fs
NCIH2172	Lung	CHD8	14	21871714	21871714	-1	Missense_Mutation	c.2579A>G	p.D860G
NCIH2172	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
NCIH2172	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH2196	Lung	EP300	22	41574004	41574004	1	Missense_Mutation	c.6289C>G	p.P2097A
NCIH2196	Lung	CHD1	5	98228403	98228403	-1	Missense_Mutation	c.2006A>G	p.E669G
NCIH2227	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
NCIH2227	Lung	ATF2	2	175957982	175957982	-1	Missense_Mutation	c.992A>T	p.H331L
NCIH2227	Lung	ATF2	2	176001161	176001161	-1	Missense_Mutation	c.11A>G	p.K4R
NCIH2228	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH2228	Lung	EP300	22	41574466	41574466	1	Missense_Mutation	c.6751G>A	p.A2251T
NCIH2228	Lung	KMT2C	7	151859492	151859492	-1	Missense_Mutation	c.11170G>A	p.E3724K
NCIH2228	Lung	STK31	7	23751734	23751734	1	Nonsense_Mutation	c.67C>T	p.Q23*
NCIH2228	Lung	WHSC1L1	8	38187148	38187149	-1	Frame_Shift_Ins	c.1328_1329insT	p.S443fs
NCIH2228	Lung	TAF1	X	70617145	70617145	1	Missense_Mutation	c.3509A>G	p.D1170G
NCIH2286	Lung	ARID1A	1	27092757	27092758	1	Nonsense_Mutation	c.2778_2779TG>CT	p.G927*
NCIH2286	Lung	TP53BP1	15	43748822	43748822	-1	Nonsense_Mutation	c.1984G>T	p.E662*
NCIH2286	Lung	SMARCA4	19	11141427	11141427	1	Missense_Mutation	c.3404G>A	p.R1135Q
NCIH2286	Lung	SP140	2	231134592	231134592	1	Nonsense_Mutation	c.1368T>A	p.C456*
NCIH2286	Lung	HDAC4	2	240078422	240078422	-1	Missense_Mutation	c.659G>T	p.G220V
NCIH2286	Lung	TRRAP	7	98581835	98581835	1	Missense_Mutation	c.9154G>A	p.G3052R
NCIH2286	Lung	HDAC6	X	48674895	48674895	1	Missense_Mutation	c.1646G>C	p.R549P
NCIH2291	Lung	CHD5	1	6184641	6184641	-1	Missense_Mutation	c.4475G>A	p.R1492Q
NCIH2291	Lung	MGA	15	42042673	42042673	1	Frame_Shift_Del	c.6868_6868delG	p.G2290fs
NCIH2291	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
NCIH2291	Lung	PHF3	6	64423411	64423411	1	Missense_Mutation	c.5927A>G	p.H1976R
NCIH2291	Lung	STK31	7	23775259	23775259	1	Missense_Mutation	c.586A>C	p.S196R
NCIH2342	Lung	BRDT	1	92445168	92445168	1	Missense_Mutation	c.1153G>T	p.V385F
NCIH2342	Lung	ERCC6	10	50708728	50708729	-1	Missense_Mutation	c.1540_1541GG>TT	p.G514F
NCIH2342	Lung	TET1	10	70446408	70446408	1	Missense_Mutation	c.5348G>A	p.R1783Q
NCIH2342	Lung	KMT2A	11	118362539	118362539	1	Missense_Mutation	c.4900G>A	p.E1634K
NCIH2342	Lung	KDM5A	12	463400	463400	-1	Missense_Mutation	c.871G>T	p.V291F
NCIH2342	Lung	SMARCA4	19	11130342	11130342	1	Missense_Mutation	c.2581G>A	p.E861K
NCIH2342	Lung	NCOA1	2	24929456	24929456	1	Missense_Mutation	c.1117C>T	p.P373S
NCIH2342	Lung	SMARCB1	22	24175861	24175861	1	Missense_Mutation	c.1116G>C	p.K372N
NCIH2342	Lung	BRD2	6	32944183	32944183	1	Missense_Mutation	c.767C>G	p.S256C
NCIH2342	Lung	PHIP	6	79657432	79657432	-1	Missense_Mutation	c.4114G>T	p.A1372S
NCIH2342	Lung	PHIP	6	79692634	79692634	-1	Missense_Mutation	c.2738A>T	p.K913M
NCIH2342	Lung	KMT2C	7	151970865	151970865	-1	Nonsense_Mutation	c.937G>T	p.G313*
NCIH2342	Lung	IKZF1	7	50468024	50468024	1	Missense_Mutation	c.1259C>T	p.P420L
NCIH2342	Lung	TRRAP	7	98609775	98609775	1	Missense_Mutation	c.11377C>G	p.L3793V
NCIH2342	Lung	TAF1L	9	32635174	32635174	-1	Missense_Mutation	c.404A>G	p.H135R
NCIH2342	Lung	TAF1	X	70598798	70598798	1	Missense_Mutation	c.1337G>T	p.G446V
NCIH2347	Lung	CHD8	14	21854307	21854307	-1	Missense_Mutation	c.6374G>A	p.R2125Q
NCIH2347	Lung	MGA	15	41999999	41999999	1	Frame_Shift_Del	c.2262_2262delG	p.L754fs
NCIH2347	Lung	EP300	22	41489021	41489021	1	Missense_Mutation	c.13G>T	p.V5L
NCIH2347	Lung	NSD1	5	176720911	176720911	1	Missense_Mutation	c.6542C>G	p.S2181C
NCIH2347	Lung	BRD2	6	32944062	32944062	1	Missense_Mutation	c.646C>T	p.P216S
NCIH2347	Lung	KMT2C	7	151842305	151842305	-1	Missense_Mutation	c.14107G>T	p.V4703F
NCIH2347	Lung	TRRAP	7	98515229	98515229	1	Frame_Shift_Del	c.2549_2549delA	p.E850fs
NCIH23	Lung	BMI1	10	22615403	22615403	1	Missense_Mutation	c.454A>T	p.I152F
NCIH23	Lung	KAT6B	10	76784743	76784743	1	Missense_Mutation	c.3400G>T	p.G1134C
NCIH23	Lung	ING1	13	111368310	111368310	1	Missense_Mutation	c.520G>T	p.A174S
NCIH23	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
NCIH23	Lung	SMARCA4	19	11170491	11170492	1	Nonsense_Mutation	c.4794_4795GG>TT	p.1598_1599KE>N*
NCIH23	Lung	PSIP1	9	15466825	15466825	-1	Nonsense_Mutation	c.1453C>T	p.Q485*
NCIH2444	Lung	TRIM33	1	114940597	114940597	-1	Missense_Mutation	c.3136C>G	p.Q1046E
NCIH2444	Lung	PRDM16	1	3328985	3328985	1	Missense_Mutation	c.2224G>T	p.D742Y
NCIH2444	Lung	MLLT10	10	21903784	21903784	1	Silent	c.534T>C	p.C178C
NCIH2444	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH2444	Lung	ATRX	X	76888716	76888716	-1	Missense_Mutation	c.5113A>T	p.N1705Y
NCIH2452	Pleura	ZMYM2	13	20580662	20580662	1	Frame_Shift_Del	c.1448_1448delT	p.V483fs
NCIH2452	Pleura	NCOA3	20	46256324	46256324	1	Silent	c.552A>G	p.T184T
NCIH2452	Pleura	BAP1	3	52442065	52442065	-1	Missense_Mutation	c.284C>A	p.A95D
NCIH3255	Lung	TRIM33	1	114944058	114944058	-1	Missense_Mutation	c.2920T>C	p.Y974H
NCIH3255	Lung	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
NCIH358	Lung	CHD5	1	6195338	6195338	-1	Missense_Mutation	c.2822C>A	p.P941Q
NCIH358	Lung	NCOA4	10	51585436	51585436	1	Missense_Mutation	c.1583C>A	p.P528H
NCIH358	Lung	KDM5A	12	416764	416764	-1	Missense_Mutation	c.3786G>T	p.Q1262H
NCIH358	Lung	CHD8	14	21897430	21897430	-1	Missense_Mutation	c.71G>A	p.R24Q
NCIH358	Lung	NCOA3	20	46277834	46277834	1	Missense_Mutation	c.3632A>T	p.Q1211L
NCIH358	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH441	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH441	Lung	SP110	2	231079827	231079827	-1	Missense_Mutation	c.154C>G	p.L52V
NCIH441	Lung	CHD1	5	98192169	98192169	-1	Missense_Mutation	c.5048C>T	p.S1683F
NCIH441	Lung	TRRAP	7	98491485	98491485	1	Missense_Mutation	c.431G>T	p.R144M
NCIH441	Lung	TAF1L	9	32632409	32632409	-1	Missense_Mutation	c.3169C>A	p.H1057N
NCIH446	Lung	ATF2	2	175979501	175979501	-1	Silent	c.543A>C	p.S181S
NCIH446	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH446	Lung	PHIP	6	79680499	79680499	-1	Missense_Mutation	c.2996G>T	p.R999L
NCIH446	Lung	ATRX	X	76938684	76938684	-1	Missense_Mutation	c.2064A>T	p.K688N
NCIH460	Lung	ARID1A	1	27106789	27106794	1	In_Frame_Del	c.6400_6405delCTGATT	p.LI2134del
NCIH508	Large intestine	PRDM16	1	3102833	3102833	1	Missense_Mutation	c.182C>T	p.T61I
NCIH508	Large intestine	CREBBP	16	3786145	3786145	-1	Frame_Shift_Del	c.4620_4620delT	p.F1540fs
NCIH508	Large intestine	LMNB2	19	2434413	2434413	-1	Missense_Mutation	c.1082C>T	p.T361M
NCIH510	Lung	SETDB1	1	150935505	150935505	1	Missense_Mutation	c.3347G>A	p.R1116Q
NCIH510	Lung	SETDB1	1	150936729	150936729	1	Missense_Mutation	c.3765C>G	p.I1255M
NCIH510	Lung	TET1	10	70446360	70446360	1	Missense_Mutation	c.5300C>T	p.A1767V
NCIH510	Lung	ATF2	2	175982763	175982763	-1	Missense_Mutation	c.402G>T	p.Q134H
NCIH510	Lung	MSH6	2	48027169	48027169	1	Missense_Mutation	c.2047G>T	p.A683S
NCIH510	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH510	Lung	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
NCIH510	Lung	PHF3	6	64395212	64395212	1	Missense_Mutation	c.1589G>T	p.R530L
NCIH510	Lung	TRRAP	7	98589761	98589761	1	Missense_Mutation	c.9770T>C	p.V3257A
NCIH510	Lung	KAT6A	8	41798733	41798733	-1	Missense_Mutation	c.2666A>T	p.E889V
NCIH520	Lung	CREBBP	16	3788618	3788618	-1	Missense_Mutation	c.4336C>T	p.R1446C
NCIH520	Lung	CHD9	16	53358728	53358728	1	Missense_Mutation	c.8615C>T	p.S2872L
NCIH520	Lung	KMT2C	7	151970801	151970801	-1	Missense_Mutation	c.1001C>T	p.A334V
NCIH522	Lung	SMARCA4	19	11097625	11097626	1	Frame_Shift_Del	c.805_806delCC	p.P269fs
NCIH524	Lung	KMT2A	11	118375630	118375630	1	Missense_Mutation	c.9023C>A	p.S3008Y
NCIH524	Lung	EP300	22	41542766	41542766	1	Missense_Mutation	c.2077A>G	p.M693V
NCIH524	Lung	EP300	22	41568558	41568558	1	Missense_Mutation	c.4508A>C	p.Y1503S
NCIH524	Lung	PHIP	6	79707198	79707198	-1	Missense_Mutation	c.2134A>C	p.T712P
NCIH526	Lung	TP53BP1	15	43712688	43712688	-1	Missense_Mutation	c.4496A>C	p.K1499T
NCIH526	Lung	HDAC2	6	114292110	114292112	-1	5'UTR	c.243_245delCAG	p.S81del
NCIH526	Lung	WHSC1L1	8	38188959	38188959	-1	Missense_Mutation	c.1055A>G	p.E352G
NCIH526	Lung	ATRX	X	76855005	76855005	-1	Missense_Mutation	c.5831G>A	p.S1944N
NCIH596	Lung	NSD1	5	176638410	176638410	1	Missense_Mutation	c.3010G>T	p.D1004Y
NCIH596	Lung	HDAC8	X	71715064	71715064	-1	Silent	c.492A>C	p.R164R
NCIH647	Lung	LMNA	1	156106995	156106995	1	Missense_Mutation	c.1580G>A	p.R527H
NCIH647	Lung	JARID2	6	15501410	15501410	1	Missense_Mutation	c.2218C>T	p.H740Y
NCIH647	Lung	TRRAP	7	98580890	98580890	1	Missense_Mutation	c.8809G>T	p.A2937S
NCIH650	Lung	CHD5	1	6195392	6195392	-1	Missense_Mutation	c.2768T>A	p.L923Q
NCIH650	Lung	CHD5	1	6211211	6211211	-1	Missense_Mutation	c.875A>T	p.E292V
NCIH650	Lung	KDM5A	12	438052	438052	-1	Missense_Mutation	c.1917G>T	p.L639F
NCIH650	Lung	ING1	13	111368292	111368292	1	Missense_Mutation	c.502C>T	p.R168W
NCIH650	Lung	CHD8	14	21884062	21884062	-1	Missense_Mutation	c.884G>A	p.R295K
NCIH650	Lung	CHD8	14	21896086	21896086	-1	Nonsense_Mutation	c.706A>T	p.K236*
NCIH650	Lung	CREBBP	16	3823801	3823801	-1	Missense_Mutation	c.2414C>A	p.A805E
NCIH650	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH650	Lung	KAT7	17	47895337	47895337	1	Missense_Mutation	c.1119A>C	p.K373N
NCIH650	Lung	SMARCA4	19	11132438	11132438	1	Missense_Mutation	c.2654G>T	p.R885L
NCIH650	Lung	SMARCA4	19	11144122	11144122	1	Missense_Mutation	c.3703G>T	p.D1235Y
NCIH650	Lung	HDAC4	2	240011781	240011781	-1	Missense_Mutation	c.2297A>T	p.H766L
NCIH650	Lung	MSH6	2	48010487	48010487	1	Missense_Mutation	c.115G>T	p.G39W
NCIH650	Lung	HDAC3	5	141004842	141004842	-1	Missense_Mutation	c.1150C>T	p.L384F
NCIH650	Lung	NSD1	5	176638731	176638731	1	Missense_Mutation	c.3331G>T	p.D1111Y
NCIH650	Lung	KMT2C	7	151845295	151845295	-1	Missense_Mutation	c.13717A>G	p.K4573E
NCIH650	Lung	KMT2C	7	151846151	151846151	-1	Missense_Mutation	c.12861G>T	p.L4287F
NCIH650	Lung	KMT2C	7	151871217	151871217	-1	Missense_Mutation	c.9373A>T	p.R3125W
NCIH650	Lung	IKZF1	7	50444382	50444382	1	Missense_Mutation	c.312G>T	p.L104F
NCIH650	Lung	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
NCIH660	Prostate	KAT6B	10	76736014	76736014	1	Frame_Shift_Del	c.1919_1919delC	p.T640fs
NCIH660	Prostate	ING1	13	111368124	111368124	1	Missense_Mutation	c.334C>T	p.P112S
NCIH660	Prostate	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH660	Prostate	JARID2	6	15410542	15410542	1	Missense_Mutation	c.269C>G	p.S90C
NCIH661	Lung	PRDM16	1	3342158	3342158	1	Missense_Mutation	c.2953G>T	p.D985Y
NCIH661	Lung	CHD5	1	6171845	6171845	-1	Missense_Mutation	c.5239G>T	p.G1747C
NCIH661	Lung	CHD9	16	53358251	53358251	1	Missense_Mutation	c.8138T>C	p.M2713T
NCIH661	Lung	SMARCA4	19	11141498	11141498	1	Frame_Shift_Del	c.3475_3475delG	p.G1159fs
NCIH661	Lung	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
NCIH661	Lung	KAT6A	8	41845039	41845039	-1	Missense_Mutation	c.643A>G	p.T215A
NCIH661	Lung	ATRX	X	76855979	76855979	-1	Missense_Mutation	c.5621A>C	p.Q1874P
NCIH684	Liver	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH684	Liver	MSH6	2	48025849	48025849	1	Missense_Mutation	c.727C>T	p.R243C
NCIH69	Lung	CHD9	16	53262915	53262915	1	Nonsense_Mutation	c.2189G>A	p.W730*
NCIH69	Lung	NIPBL	5	36985892	36985892	1	Missense_Mutation	c.2610C>A	p.H870Q
NCIH69	Lung	TRRAP	7	98507890	98507890	1	Missense_Mutation	c.1562C>T	p.P521L
NCIH69	Lung	TAF1	X	70618471	70618471	1	Missense_Mutation	c.3730G>A	p.E1244K
NCIH716	Large intestine	NIPBL	5	36971112	36971112	1	Missense_Mutation	c.745C>A	p.H249N
NCIH727	Lung	KDM5A	12	495082	495082	-1	Missense_Mutation	c.224A>G	p.Q75R
NCIH727	Lung	IDH2	15	90631943	90631943	-1	Frame_Shift_Del	c.410_410delG	p.G137fs
NCIH727	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH727	Lung	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
NCIH727	Lung	BRD4	19	15376409	15376409	-1	Missense_Mutation	c.605C>G	p.A202G
NCIH747	Large intestine	RERE	1	8716322	8716327	-1	In_Frame_Del	c.30_35delCAAAGA	p.DK10del
NCIH747	Large intestine	KMT2C	7	151919682	151919682	-1	Nonsense_Mutation	c.3409A>T	p.R1137*
NCIH810	Lung	ARID1A	1	27106260	27106260	1	Missense_Mutation	c.5871C>G	p.D1957E
NCIH810	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NCIH810	Lung	KAT7	17	47893260	47893260	1	Silent	c.948G>T	p.R316R
NCIH810	Lung	PHIP	6	79692796	79692796	-1	Missense_Mutation	c.2576C>G	p.A859G
NCIH810	Lung	IKZF1	7	50455144	50455144	1	Missense_Mutation	c.691G>T	p.G231C
NCIH810	Lung	WHSC1L1	8	38187218	38187218	-1	Missense_Mutation	c.1259G>T	p.R420L
NCIH810	Lung	NCOA2	8	71069147	71069147	-1	Missense_Mutation	c.1453A>T	p.M485L
NCIH82	Lung	NCOA1	2	24930100	24930100	1	Missense_Mutation	c.1761G>T	p.E587D
NCIH82	Lung	DNMT3B	20	31379439	31379439	1	Silent	c.846G>A	p.L282L
NCIH82	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH82	Lung	NCOA2	8	71040716	71040716	-1	Missense_Mutation	c.3633C>A	p.S1211R
NCIH838	Lung	ARID1A	1	27106010	27106017	1	Frame_Shift_Del	c.5621_5628delGCCCACCA	p.C1874fs
NCIH838	Lung	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
NCIH838	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NCIH838	Lung	NCOA1	2	24952371	24952371	1	Missense_Mutation	c.2888G>T	p.G963V
NCIH841	Lung	ZMYM2	13	20632746	20632746	1	Missense_Mutation	c.2525A>T	p.N842I
NCIH841	Lung	CHD9	16	53307582	53307582	1	Nonsense_Mutation	c.4762A>T	p.K1588*
NCIH841	Lung	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIH841	Lung	SMARCA4	19	11132584	11132584	1	Nonsense_Mutation	c.2800A>T	p.K934*
NCIH841	Lung	KMT2C	7	151873490	151873490	-1	Missense_Mutation	c.9048A>C	p.Q3016H
NCIH841	Lung	ATRX	X	76939650	76939650	-1	Missense_Mutation	c.1098G>T	p.M366I
NCIH854	Lung	CHD5	1	6185837	6185837	-1	Missense_Mutation	c.4160C>T	p.P1387L
NCIH854	Lung	MLLT10	10	22023013	22023013	1	Missense_Mutation	c.2861T>C	p.V954A
NCIH854	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NCIH854	Lung	EP300	22	41547891	41547891	1	Missense_Mutation	c.2872A>G	p.S958G
NCIH889	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NCIH929	Haematopoietic and lymphoid tissue	KDM5A	12	459807	459807	-1	Missense_Mutation	c.1288A>G	p.K430E
NCIH929	Haematopoietic and lymphoid tissue	MGA	15	42059075	42059075	1	Missense_Mutation	c.8795C>G	p.S2932C
NCIH929	Haematopoietic and lymphoid tissue	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
NCIN87	Stomach	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
NCIN87	Stomach	ZMYM2	13	20637004	20637004	1	Missense_Mutation	c.2930A>C	p.D977A
NCIN87	Stomach	MSH6	2	48026992	48026992	1	Missense_Mutation	c.1870G>A	p.G624S
NH6	Autonomic ganglia	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
NH6	Autonomic ganglia	CHD1	5	98208136	98208136	-1	Missense_Mutation	c.3695C>T	p.P1232L
NIHOVCAR3	Ovary	DNMT1	19	10291130	10291130	-1	Missense_Mutation	c.341G>A	p.R114K
NMCG1	Central nervous system	CHD9	16	53256603	53256603	1	Missense_Mutation	c.1832C>G	p.S611C
NUDHL1	Haematopoietic and lymphoid tissue	CREBBP	16	3788617	3788617	-1	Missense_Mutation	c.4337G>T	p.R1446L
NUDHL1	Haematopoietic and lymphoid tissue	CREBBP	16	3900588	3900588	-1	Nonsense_Mutation	c.508C>T	p.Q170*
NUDHL1	Haematopoietic and lymphoid tissue	NCOA3	20	46255875	46255875	1	Missense_Mutation	c.487G>A	p.E163K
NUDHL1	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
NUDUL1	Haematopoietic and lymphoid tissue	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
NUGC3	Stomach	TRIM33	1	114952840	114952842	-1	In_Frame_Del	c.2158_2160delTCT	p.S720del
NUGC3	Stomach	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
NUGC3	Stomach	ERCC6	10	50714033	50714033	-1	Missense_Mutation	c.1423G>T	p.D475Y
NUGC3	Stomach	KMT2D	12	49416586	49416586	-1	Frame_Shift_Del	c.16125_16125delC	p.P5375fs
NUGC3	Stomach	CHD8	14	21897204	21897204	-1	Silent	c.297A>G	p.V99V
NUGC3	Stomach	TP53BP1	15	43762136	43762136	-1	Missense_Mutation	c.1309G>A	p.A437T
NUGC3	Stomach	DNMT1	19	10248578	10248578	-1	Missense_Mutation	c.4223C>A	p.P1408H
NUGC3	Stomach	EP300	22	41558756	41558757	1	Frame_Shift_Ins	c.3701_3702insA	p.R1234fs
NUGC3	Stomach	JARID2	6	15508645	15508645	1	Missense_Mutation	c.2806C>A	p.P936T
NUGC3	Stomach	DAXX	6	33287368	33287368	-1	Missense_Mutation	c.1765G>T	p.D589Y
NUGC3	Stomach	PHF3	6	64356491	64356491	1	Missense_Mutation	c.35C>A	p.P12H
NUGC3	Stomach	TNRC18	7	5352636	5352641	-1	In_Frame_Del	c.7881_7886delCTCCTC	p.2627_2629SSS>S
NUGC3	Stomach	WHSC1L1	8	38162871	38162871	-1	Missense_Mutation	c.2335G>A	p.V779I
NUGC3	Stomach	TAF1L	9	32633297	32633297	-1	Missense_Mutation	c.2281G>A	p.A761T
OAW28	Ovary	SETDB1	1	150919453	150919453	1	Missense_Mutation	c.1232A>G	p.K411R
OAW28	Ovary	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
OAW42	Ovary	ARID1A	1	27057967	27057968	1	Frame_Shift_Del	c.1675_1676delCC	p.P559fs
OC316	Ovary	ARID1A	1	27099947	27099947	1	Nonsense_Mutation	c.3826C>T	p.R1276*
OC316	Ovary	ARID1A	1	27106228	27106228	1	Nonsense_Mutation	c.5839C>T	p.Q1947*
OC316	Ovary	TET1	10	70441245	70441245	1	Missense_Mutation	c.4914G>T	p.Q1638H
OC316	Ovary	KAT6B	10	76788814	76788814	1	Missense_Mutation	c.4232A>G	p.E1411G
OC316	Ovary	KMT2A	11	118342821	118342821	1	Missense_Mutation	c.947C>T	p.S316L
OC316	Ovary	HNF1A	12	121434172	121434172	1	Missense_Mutation	c.1063G>A	p.G355S
OC316	Ovary	KDM5A	12	417137	417137	-1	Missense_Mutation	c.3413T>C	p.I1138T
OC316	Ovary	CHD8	14	21869088	21869088	-1	Missense_Mutation	c.3479A>G	p.H1160R
OC316	Ovary	CHD8	14	21876980	21876980	-1	Missense_Mutation	c.1532G>A	p.R511H
OC316	Ovary	EP300	22	41574678	41574679	1	Frame_Shift_Ins	c.6963_6964insC	p.Q2321fs
OC316	Ovary	WHSC1	4	1976665	1976665	1	Missense_Mutation	c.3448A>G	p.T1150A
OC316	Ovary	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
OC316	Ovary	PHF3	6	64395717	64395717	1	Missense_Mutation	c.2094A>T	p.R698S
OC316	Ovary	KMT2C	7	151842343	151842343	-1	Missense_Mutation	c.14069G>A	p.R4690Q
OC316	Ovary	KMT2C	7	151845426	151845426	-1	Missense_Mutation	c.13586G>A	p.R4529H
OC316	Ovary	KMT2C	7	151845717	151845717	-1	Missense_Mutation	c.13295G>A	p.C4432Y
OC316	Ovary	KMT2C	7	151848619	151848619	-1	Missense_Mutation	c.12574G>A	p.A4192T
OC316	Ovary	IKZF1	7	50467973	50467973	1	Missense_Mutation	c.1208A>G	p.N403S
OC316	Ovary	PSIP1	9	15465555	15465556	-1	Frame_Shift_Ins	c.1555_1556insGA	p.T519fs
OC316	Ovary	HDAC6	X	48678634	48678634	1	Missense_Mutation	c.2309C>T	p.A770V
OC316	Ovary	ATRX	X	76845345	76845345	-1	Missense_Mutation	c.6176G>T	p.R2059M
OCIAML2	Haematopoietic and lymphoid tissue	SETDB1	1	150900203	150900203	1	Missense_Mutation	c.13C>T	p.P5S
OCIAML2	Haematopoietic and lymphoid tissue	KMT2A	11	118365075	118365075	1	Nonsense_Mutation	c.5251A>T	p.K1751*
OCIAML3	Haematopoietic and lymphoid tissue	TET1	10	70404968	70404968	1	Missense_Mutation	c.2482C>T	p.P828S
OCIAML5	Haematopoietic and lymphoid tissue	CREBBP	16	3900434	3900434	-1	Missense_Mutation	c.662G>T	p.G221V
OCIAML5	Haematopoietic and lymphoid tissue	NCOA3	20	46279858	46279866	1	In_Frame_Del	c.3784_3792delCAGCAGCAA	p.QQQ1274del
OCIAML5	Haematopoietic and lymphoid tissue	TET2	4	106157573	106157573	1	Nonsense_Mutation	c.2537C>A	p.S846*
OCILY10	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
OCILY10	Haematopoietic and lymphoid tissue	CREBBP	16	3801794	3801794	-1	Nonsense_Mutation	c.3712G>T	p.E1238*
OCILY10	Haematopoietic and lymphoid tissue	CREBBP	16	3820749	3820749	-1	Missense_Mutation	c.2702C>T	p.P901L
OCILY10	Haematopoietic and lymphoid tissue	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
OCILY10	Haematopoietic and lymphoid tissue	NCOA3	20	46267916	46267916	1	Missense_Mutation	c.2677G>C	p.D893H
OCILY10	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
OCILY10	Haematopoietic and lymphoid tissue	EP300	22	41513574	41513574	1	Nonsense_Mutation	c.478C>T	p.Q160*
OCILY10	Haematopoietic and lymphoid tissue	BRD3	9	136905198	136905198	-1	Missense_Mutation	c.1601A>G	p.K534R
OCILY10	Haematopoietic and lymphoid tissue	BRD3	9	136905309	136905309	-1	Missense_Mutation	c.1490A>G	p.K497R
OCILY10	Haematopoietic and lymphoid tissue	TAF1	X	70612533	70612533	1	Missense_Mutation	c.2956T>G	p.Y986D
OCILY10	Haematopoietic and lymphoid tissue	ATRX	X	76949407	76949407	-1	Silent	c.390A>G	p.P130P
OCILY19	Haematopoietic and lymphoid tissue	ARID1A	1	27089496	27089496	1	Frame_Shift_Del	c.2452_2452delT	p.L818fs
OCILY19	Haematopoietic and lymphoid tissue	CREBBP	16	3788649	3788649	-1	Missense_Mutation	c.4305T>A	p.D1435E
OCILY3	Haematopoietic and lymphoid tissue	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
OCIM1	Haematopoietic and lymphoid tissue	SMARCA4	19	11132561	11132561	1	Missense_Mutation	c.2777A>T	p.N926I
OCIM1	Haematopoietic and lymphoid tissue	PHIP	6	79668249	79668249	-1	Missense_Mutation	c.3725G>T	p.G1242V
OCUM1	Stomach	TRIM33	1	114976314	114976314	-1	Missense_Mutation	c.965C>T	p.A322V
OCUM1	Stomach	ARID1A	1	27097801	27097801	1	Frame_Shift_Del	c.3390_3390delC	p.I1130fs
OCUM1	Stomach	ERCC6	10	50682274	50682274	-1	Silent	c.2397T>C	p.L799L
OCUM1	Stomach	ERCC6	10	50740716	50740716	-1	Missense_Mutation	c.295G>A	p.V99I
OCUM1	Stomach	TP53BP1	15	43767844	43767844	-1	Missense_Mutation	c.1004C>G	p.S335C
OE19	Oesophagus	MLLT10	10	21901327	21901327	1	Silent	c.456T>G	p.G152G
OE19	Oesophagus	MSH6	2	48026896	48026896	1	Missense_Mutation	c.1774G>A	p.V592I
OE19	Oesophagus	TET2	4	106156384	106156384	1	Missense_Mutation	c.1348G>A	p.G450R
OE19	Oesophagus	PSIP1	9	15490046	15490050	-1	Frame_Shift_Del	c.222_226delAAAAG	p.R74fs
OE21	Oesophagus	KMT2A	11	118363835	118363835	1	Missense_Mutation	c.5068G>A	p.E1690K
OE21	Oesophagus	TRIM28	19	59059434	59059434	1	Missense_Mutation	c.988C>T	p.R330W
OE21	Oesophagus	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
OE33	Oesophagus	MGA	15	42040906	42040906	1	Missense_Mutation	c.5284T>A	p.L1762M
OE33	Oesophagus	LMNB2	19	2435138	2435138	-1	Missense_Mutation	c.716G>A	p.R239Q
ONCODG1	Ovary	DNMT1	19	10291130	10291130	-1	Missense_Mutation	c.341G>A	p.R114K
ONS76	Central nervous system	SETDB1	1	150933141	150933141	1	Missense_Mutation	c.2603A>C	p.E868A
ONS76	Central nervous system	MEN1	11	64572131	64572131	-1	Missense_Mutation	c.1523G>A	p.G508D
ONS76	Central nervous system	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
ONS76	Central nervous system	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
ONS76	Central nervous system	TRIM24	7	138255645	138255645	1	Missense_Mutation	c.1775C>T	p.T592M
ONS76	Central nervous system	NCOA2	8	71060605	71060605	-1	Silent	c.2508G>A	p.K836K
OPM2	Haematopoietic and lymphoid tissue	MLLT10	10	21962838	21962838	1	Silent	c.1611A>G	p.P537P
OPM2	Haematopoietic and lymphoid tissue	CHD9	16	53283818	53283818	1	Missense_Mutation	c.3701G>A	p.G1234E
OPM2	Haematopoietic and lymphoid tissue	MSH6	2	48023066	48023066	1	Missense_Mutation	c.491A>G	p.H164R
OSRC2	Kidney	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
OUMS23	Large intestine	CHD5	1	6219499	6219499	-1	Missense_Mutation	c.284C>T	p.P95L
OUMS23	Large intestine	MSH6	2	48030631	48030631	1	Missense_Mutation	c.3245C>T	p.P1082L
OV56	Ovary	ARID1A	1	27106916	27106917	1	Frame_Shift_Ins	c.6527_6528insG	p.Q2176fs
OV56	Ovary	CREBBP	16	3779193	3779193	-1	Missense_Mutation	c.5855C>T	p.P1952L
OV56	Ovary	NCOA3	20	46279837	46279851	1	In_Frame_Del	c.3763_3777delCAGCAGCAGCAGCAG	p.QQQQQ1270del
OV56	Ovary	WHSC1L1	8	38146930	38146930	-1	Missense_Mutation	c.3212C>T	p.P1071L
OV90	Ovary	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
OVCAR4	Ovary	ERCC6	10	50732331	50732331	-1	Missense_Mutation	c.1145A>T	p.E382V
OVCAR4	Ovary	MGA	15	42058324	42058324	1	Missense_Mutation	c.8044G>A	p.D2682N
OVCAR4	Ovary	EP300	22	41548014	41548014	1	Missense_Mutation	c.2995G>C	p.E999Q
OVCAR8	Ovary	CREBBP	16	3820773	3820773	-1	Nonsense_Mutation	c.2678C>A	p.S893*
OVCAR8	Ovary	EP300	22	41572902	41572902	1	Frame_Shift_Del	c.5187_5187delT	p.D1729fs
OVCAR8	Ovary	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
OVCAR8	Ovary	NCOA2	8	71082492	71082492	-1	Missense_Mutation	c.486C>G	p.I162M
OVISE	Ovary	SETDB1	1	150936110	150936110	1	Missense_Mutation	c.3562G>A	p.G1188R
OVISE	Ovary	LMNA	1	156106083	156106083	1	Silent	c.1236G>C	p.G412G
OVISE	Ovary	ARID1A	1	27023501	27023502	1	Frame_Shift_Ins	c.607_608insA	p.H203fs
OVISE	Ovary	BRD4	19	15383669	15383669	-1	Missense_Mutation	c.242G>T	p.W81L
OVISE	Ovary	TFPT	19	54611397	54611397	-1	Missense_Mutation	c.578G>A	p.R193Q
OVK18	Ovary	GATAD2B	1	153788880	153788880	-1	Frame_Shift_Del	c.1085_1085delA	p.K362fs
OVK18	Ovary	ARID1A	1	27058064	27058064	1	Frame_Shift_Del	c.1772_1772delC	p.A591fs
OVK18	Ovary	CHD5	1	6206411	6206411	-1	Missense_Mutation	c.1663G>A	p.D555N
OVK18	Ovary	ERCC6	10	50682081	50682081	-1	Missense_Mutation	c.2590T>C	p.S864P
OVK18	Ovary	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
OVK18	Ovary	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
OVK18	Ovary	ZMYM2	13	20638594	20638594	1	Missense_Mutation	c.3041C>T	p.A1014V
OVK18	Ovary	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
OVK18	Ovary	NCOA3	20	46265051	46265051	1	Missense_Mutation	c.1921C>T	p.P641S
OVK18	Ovary	NSD1	5	176638587	176638587	1	Missense_Mutation	c.3187A>G	p.T1063A
OVK18	Ovary	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
OVK18	Ovary	JARID2	6	15497273	15497273	1	Missense_Mutation	c.1817G>A	p.R606Q
OVK18	Ovary	BAG6	6	31612923	31612923	-1	Frame_Shift_Del	c.1187_1187delC	p.P396fs
OVK18	Ovary	DAXX	6	33287881	33287883	-1	In_Frame_Del	c.1406_1408delAGG	p.E469del
OVK18	Ovary	DAXX	6	33288764	33288764	-1	Missense_Mutation	c.824G>A	p.R275H
OVK18	Ovary	KMT2C	7	151845524	151845524	-1	Frame_Shift_Del	c.13488_13488delT	p.F4496fs
OVK18	Ovary	KMT2C	7	151945051	151945051	-1	Missense_Mutation	c.2468T>C	p.I823T
OVK18	Ovary	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
OVK18	Ovary	TAF1L	9	32633324	32633324	-1	Missense_Mutation	c.2254T>C	p.S752P
OVK18	Ovary	KDM6A	X	44922806	44922806	1	Missense_Mutation	c.1823C>A	p.P608H
OVK18	Ovary	TAF1	X	70678098	70678098	1	Missense_Mutation	c.5006A>T	p.D1669V
OVKATE	Ovary	TNRC18	7	5352659	5352660	-1	In_Frame_Ins	c.7862_7863insATC	p.2621_2621S>SS
OVMANA	Ovary	ARID1A	1	27100198	27100198	1	Nonsense_Mutation	c.3994C>T	p.Q1332*
OVMANA	Ovary	ARID1A	1	27107180	27107180	1	Nonsense_Mutation	c.6791C>G	p.S2264*
OVMANA	Ovary	CHD8	14	21861835	21861835	-1	Missense_Mutation	c.5282A>G	p.D1761G
OVMANA	Ovary	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
OVMANA	Ovary	HDAC3	5	141009646	141009646	-1	Missense_Mutation	c.328G>A	p.A110T
OVSAHO	Ovary	PHF23	17	7139476	7139484	-1	In_Frame_Del	c.762_770delGGAAGAGGA	p.254_257EEEE>E
OVSAHO	Ovary	TET2	4	106156468	106156468	1	Missense_Mutation	c.1432G>T	p.A478S
OVSAHO	Ovary	NSD1	5	176665503	176665503	1	Missense_Mutation	c.4187C>T	p.T1396M
OVTOKO	Ovary	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
OVTOKO	Ovary	CHD1	5	98205493	98205493	-1	Missense_Mutation	c.4072C>G	p.L1358V
P12ICHIKAWA	Haematopoietic and lymphoid tissue	KMT2D	12	49426754	49426759	-1	In_Frame_Del	c.11729_11734delAGCAAC	p.QQ3910del
P12ICHIKAWA	Haematopoietic and lymphoid tissue	WHSC1L1	8	38178631	38178631	-1	Missense_Mutation	c.1768T>G	p.S590A
P31FUJ	Haematopoietic and lymphoid tissue	ARID1A	1	27101259	27101259	1	Frame_Shift_Del	c.4541_4541delC	p.T1514fs
P31FUJ	Haematopoietic and lymphoid tissue	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
P31FUJ	Haematopoietic and lymphoid tissue	KMT2A	11	118339529	118339530	1	Frame_Shift_Ins	c.472_473insTTCC	p.R158fs
P31FUJ	Haematopoietic and lymphoid tissue	CREBBP	16	3807363	3807364	-1	Frame_Shift_Ins	c.3623_3624insC	p.P1208fs
P31FUJ	Haematopoietic and lymphoid tissue	TRIM28	19	59059245	59059245	1	Missense_Mutation	c.926G>A	p.R309Q
P31FUJ	Haematopoietic and lymphoid tissue	TAF1L	9	32633583	32633584	-1	Frame_Shift_Ins	c.1994_1995insA	p.K665fs
P31FUJ	Haematopoietic and lymphoid tissue	ATRX	X	76855019	76855019	-1	Frame_Shift_Del	c.5817_5817delA	p.K1939fs
P3HR1	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
P3HR1	Haematopoietic and lymphoid tissue	SMARCA4	19	11132426	11132426	1	Missense_Mutation	c.2642A>G	p.D881G
PANC0203	Pancreas	ARID1A	1	27058007	27058007	1	Missense_Mutation	c.1715C>T	p.T572M
PANC0203	Pancreas	ARID1A	1	27107105	27107105	1	Missense_Mutation	c.6716T>C	p.L2239P
PANC0203	Pancreas	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
PANC0203	Pancreas	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
PANC0213	Pancreas	SMARCA4	19	11132513	11132513	1	Missense_Mutation	c.2729C>T	p.T910M
PANC0213	Pancreas	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
PANC0327	Pancreas	SETDB1	1	150922972	150922972	1	Missense_Mutation	c.1619C>T	p.S540L
PANC0327	Pancreas	SETDB1	1	150922999	150922999	1	Missense_Mutation	c.1646C>G	p.P549R
PANC0327	Pancreas	SETDB1	1	150923286	150923286	1	Missense_Mutation	c.1933C>G	p.L645V
PANC0327	Pancreas	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
PANC0327	Pancreas	DAXX	6	33288240	33288240	-1	Missense_Mutation	c.1204G>C	p.E402Q
PANC0403	Pancreas	MSH6	2	48018128	48018128	1	Missense_Mutation	c.323G>C	p.C108S
PANC0403	Pancreas	NIPBL	5	37052571	37052571	1	Missense_Mutation	c.7166G>T	p.S2389I
PANC0403	Pancreas	NCOA2	8	71050492	71050492	-1	Missense_Mutation	c.3104C>T	p.P1035L
PANC0813	Pancreas	ATF2	2	175982983	175982983	-1	Missense_Mutation	c.314A>C	p.K105T
PANC0813	Pancreas	PHF3	6	64394216	64394216	1	Missense_Mutation	c.593G>A	p.R198K
PANC1005	Pancreas	KMT2B	19	36211375	36211377	1	In_Frame_Del	c.1126_1128delAAG	p.K376del
PANC1005	Pancreas	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
PATU8902	Pancreas	ZMYM2	13	20660119	20660119	1	Nonsense_Mutation	c.4099A>T	p.K1367*
PATU8902	Pancreas	EP300	22	41572420	41572420	1	Missense_Mutation	c.4949C>A	p.S1650Y
PC14	Lung	NCOA3	20	46256725	46256725	1	Missense_Mutation	c.781C>T	p.P261S
PC3	Prostate	TFPT	19	54617915	54617915	-1	Missense_Mutation	c.189G>C	p.E63D
PC3	Prostate	TRRAP	7	98509724	98509724	1	Missense_Mutation	c.2087G>A	p.R696H
PCM6	Haematopoietic and lymphoid tissue	KMT2A	11	118376479	118376479	1	Missense_Mutation	c.9872G>C	p.R3291T
PCM6	Haematopoietic and lymphoid tissue	CHD9	16	53320153	53320153	1	Missense_Mutation	c.5087A>G	p.N1696S
PCM6	Haematopoietic and lymphoid tissue	PHIP	6	79707300	79707300	-1	Missense_Mutation	c.2032A>G	p.T678A
PCM6	Haematopoietic and lymphoid tissue	KMT2C	7	151878910	151878910	-1	Missense_Mutation	c.6035C>T	p.P2012L
PCM6	Haematopoietic and lymphoid tissue	KAT6A	8	41790702	41790702	-1	Missense_Mutation	c.5036C>T	p.P1679L
PCM6	Haematopoietic and lymphoid tissue	NCOA2	8	71078831	71078831	-1	Missense_Mutation	c.700C>G	p.Q234E
PECAPJ34CLONEC12	Upper aerodigestive tract	TRRAP	7	98592320	98592320	1	Missense_Mutation	c.10116G>C	p.K3372N
PECAPJ41CLONED2	Upper aerodigestive tract	CREBBP	16	3820624	3820624	-1	Nonsense_Mutation	c.2827C>T	p.Q943*
PECAPJ41CLONED2	Upper aerodigestive tract	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
PECAPJ41CLONED2	Upper aerodigestive tract	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
PECAPJ41CLONED2	Upper aerodigestive tract	HDAC6	X	48663866	48663866	1	Silent	c.333G>A	p.R111R
PECAPJ49	Upper aerodigestive tract	ARID1A	1	27101088	27101088	1	Missense_Mutation	c.4370T>C	p.F1457S
PECAPJ49	Upper aerodigestive tract	CREBBP	16	3779766	3779766	-1	Nonsense_Mutation	c.5282C>G	p.S1761*
PECAPJ49	Upper aerodigestive tract	DNMT1	19	10273370	10273370	-1	Missense_Mutation	c.981T>G	p.I327M
PECAPJ49	Upper aerodigestive tract	CHD1	5	98235229	98235229	-1	Missense_Mutation	c.1040A>G	p.K347R
PEER	Haematopoietic and lymphoid tissue	NSD1	5	176710810	176710810	1	Missense_Mutation	c.6032C>T	p.P2011L
PEER	Haematopoietic and lymphoid tissue	TRIM24	7	138223537	138223537	1	Missense_Mutation	c.1132A>C	p.S378R
PF382	Haematopoietic and lymphoid tissue	TRIM33	1	114942108	114942108	-1	Missense_Mutation	c.3091A>G	p.I1031V
PF382	Haematopoietic and lymphoid tissue	SETDB1	1	150923560	150923560	1	Missense_Mutation	c.2207G>A	p.R736Q
PF382	Haematopoietic and lymphoid tissue	ARID1A	1	27106603	27106603	1	Missense_Mutation	c.6214G>C	p.D2072H
PF382	Haematopoietic and lymphoid tissue	CHD5	1	6214887	6214887	-1	Missense_Mutation	c.578G>A	p.R193Q
PF382	Haematopoietic and lymphoid tissue	SIRT1	10	69676055	69676055	1	Missense_Mutation	c.1949A>G	p.Y650C
PF382	Haematopoietic and lymphoid tissue	HNF1A	12	121431481	121431481	1	Nonsense_Mutation	c.685C>T	p.R229*
PF382	Haematopoietic and lymphoid tissue	CREBBP	16	3788660	3788660	-1	Missense_Mutation	c.4294T>C	p.S1432P
PF382	Haematopoietic and lymphoid tissue	CREBBP	16	3808901	3808901	-1	Missense_Mutation	c.3323C>T	p.S1108L
PF382	Haematopoietic and lymphoid tissue	CREBBP	16	3843419	3843419	-1	Missense_Mutation	c.1184T>C	p.M395T
PF382	Haematopoietic and lymphoid tissue	MSH6	2	48028138	48028138	1	Missense_Mutation	c.3016T>A	p.Y1006N
PF382	Haematopoietic and lymphoid tissue	WHSC1	4	1957836	1957836	1	Silent	c.2802G>A	p.A934A
PF382	Haematopoietic and lymphoid tissue	NIPBL	5	37064740	37064740	1	Nonsense_Mutation	c.8161C>T	p.R2721*
PF382	Haematopoietic and lymphoid tissue	DAXX	6	33287973	33287973	-1	Missense_Mutation	c.1316G>A	p.C439Y
PF382	Haematopoietic and lymphoid tissue	KAT6A	8	41805409	41805409	-1	Missense_Mutation	c.1762A>G	p.I588V
PF382	Haematopoietic and lymphoid tissue	BRD3	9	136916770	136916770	-1	Missense_Mutation	c.413C>T	p.A138V
PF382	Haematopoietic and lymphoid tissue	KDM6A	X	44950066	44950066	1	Nonsense_Mutation	c.3991C>T	p.R1331*
PF382	Haematopoietic and lymphoid tissue	TAF1	X	70602920	70602920	1	Missense_Mutation	c.1913G>A	p.R638H
PF382	Haematopoietic and lymphoid tissue	ATRX	X	76938689	76938689	-1	Missense_Mutation	c.2059G>A	p.E687K
PFEIFFER	Haematopoietic and lymphoid tissue	CREBBP	16	3786740	3786740	-1	Missense_Mutation	c.4471C>A	p.Q1491K
PFEIFFER	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
PFEIFFER	Haematopoietic and lymphoid tissue	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
PFEIFFER	Haematopoietic and lymphoid tissue	NSD1	5	176638964	176638964	1	Missense_Mutation	c.3564G>C	p.R1188S
PK1	Pancreas	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
PK45H	Pancreas	PRDM16	1	3348631	3348631	1	Missense_Mutation	c.3623T>C	p.V1208A
PK45H	Pancreas	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
PK45H	Pancreas	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
PK45H	Pancreas	KDM5A	12	432917	432917	-1	Missense_Mutation	c.1999G>C	p.E667Q
PK45H	Pancreas	PHIP	6	79692737	79692737	-1	Missense_Mutation	c.2635A>G	p.S879G
PK45H	Pancreas	SMARCA2	9	2039777	2039779	1	In_Frame_Del	c.667_669delCAG	p.Q238del
PK45H	Pancreas	TAF1	X	70598119	70598119	1	Missense_Mutation	c.1028C>T	p.S343F
PK59	Pancreas	ARID1A	1	27092849	27092849	1	Missense_Mutation	c.2870A>G	p.N957S
PK59	Pancreas	PHF3	6	64422045	64422047	1	In_Frame_Del	c.4561_4563delAAG	p.K1521del
PK59	Pancreas	ATRX	X	76907752	76907752	-1	Missense_Mutation	c.4409C>T	p.S1470F
PSN1	Pancreas	ERCC6	10	50682274	50682274	-1	Silent	c.2397T>C	p.L799L
PSN1	Pancreas	WHSC1	4	1953953	1953953	1	Missense_Mutation	c.2132C>A	p.A711D
PSN1	Pancreas	BRD3	9	136918533	136918533	-1	Missense_Mutation	c.67C>G	p.P23A
QGP1	Pancreas	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
QGP1	Pancreas	TET2	4	106157435	106157435	1	Missense_Mutation	c.2399C>G	p.T800S
RAJI	Haematopoietic and lymphoid tissue	ING1	13	111368115	111368116	1	Frame_Shift_Ins	c.325_326insC	p.S109fs
RAJI	Haematopoietic and lymphoid tissue	CHD9	16	53330902	53330902	1	Missense_Mutation	c.5545G>T	p.V1849F
RAJI	Haematopoietic and lymphoid tissue	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
RAJI	Haematopoietic and lymphoid tissue	KMT2C	7	151917634	151917634	-1	Missense_Mutation	c.3686G>T	p.R1229M
RCHACV	Haematopoietic and lymphoid tissue	PRDM16	1	3342158	3342158	1	Missense_Mutation	c.2953G>A	p.D985N
RCHACV	Haematopoietic and lymphoid tissue	HNF1A	12	121437428	121437428	1	Missense_Mutation	c.1787C>T	p.T596I
RCHACV	Haematopoietic and lymphoid tissue	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
RCHACV	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
RCHACV	Haematopoietic and lymphoid tissue	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
RCHACV	Haematopoietic and lymphoid tissue	TAF1L	9	32633083	32633083	-1	Missense_Mutation	c.2495G>A	p.R832H
RCHACV	Haematopoietic and lymphoid tissue	HDAC6	X	48664041	48664041	1	Missense_Mutation	c.400C>T	p.R134W
RCM1	Large intestine	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
RCM1	Large intestine	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
RCM1	Large intestine	BRD4	19	15366309	15366309	-1	Missense_Mutation	c.1846C>T	p.R616W
RCM1	Large intestine	EP300	22	41572933	41572933	1	Nonsense_Mutation	c.5218C>T	p.Q1740*
RCM1	Large intestine	NSD1	5	176722221	176722221	1	Missense_Mutation	c.7852G>A	p.V2618I
REC1	Haematopoietic and lymphoid tissue	PRDM16	1	3328650	3328650	1	Missense_Mutation	c.1889A>G	p.D630G
REH	Haematopoietic and lymphoid tissue	ARID1A	1	27099103	27099103	1	Frame_Shift_Del	c.3519_3519delC	p.I1173fs
REH	Haematopoietic and lymphoid tissue	BRDT	1	92445193	92445193	1	Missense_Mutation	c.1178T>A	p.I393N
REH	Haematopoietic and lymphoid tissue	NCOA4	10	51584632	51584632	1	Missense_Mutation	c.779G>A	p.C260Y
REH	Haematopoietic and lymphoid tissue	SIRT1	10	69676052	69676052	1	Missense_Mutation	c.1946G>A	p.R649H
REH	Haematopoietic and lymphoid tissue	MEN1	11	64571826	64571826	-1	Missense_Mutation	c.1828C>T	p.R610W
REH	Haematopoietic and lymphoid tissue	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
REH	Haematopoietic and lymphoid tissue	ING1	13	111371833	111371833	1	Missense_Mutation	c.823G>A	p.D275N
REH	Haematopoietic and lymphoid tissue	ZMYM2	13	20657066	20657067	1	In_Frame_Ins	c.3714_3715insTGGCCC	p.1238_1239insWP
REH	Haematopoietic and lymphoid tissue	DNMT1	19	10291143	10291143	-1	Missense_Mutation	c.328G>A	p.G110R
REH	Haematopoietic and lymphoid tissue	DNMT3B	20	31395673	31395673	1	Silent	c.2526C>T	p.L842L
REH	Haematopoietic and lymphoid tissue	NIPBL	5	36955697	36955697	1	Missense_Mutation	c.188C>T	p.S63L
REH	Haematopoietic and lymphoid tissue	NIPBL	5	36976459	36976459	1	Missense_Mutation	c.1450T>C	p.S484P
REH	Haematopoietic and lymphoid tissue	CHD1	5	98194062	98194062	-1	Missense_Mutation	c.4609G>A	p.D1537N
REH	Haematopoietic and lymphoid tissue	JARID2	6	15513220	15513220	1	Frame_Shift_Del	c.3210_3210delA	p.A1070fs
REH	Haematopoietic and lymphoid tissue	BAG6	6	31609172	31609172	-1	Missense_Mutation	c.2497G>T	p.D833Y
REH	Haematopoietic and lymphoid tissue	KMT2C	7	151860511	151860511	-1	Missense_Mutation	c.10151A>G	p.E3384G
REH	Haematopoietic and lymphoid tissue	KMT2C	7	151873587	151873588	-1	Frame_Shift_Ins	c.8950_8951insT	p.S2984fs
REH	Haematopoietic and lymphoid tissue	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
REH	Haematopoietic and lymphoid tissue	IKZF1	7	50467844	50467844	1	Missense_Mutation	c.1079G>A	p.R360H
REH	Haematopoietic and lymphoid tissue	TAF1L	9	32633635	32633635	-1	Missense_Mutation	c.1943C>G	p.S648C
REH	Haematopoietic and lymphoid tissue	ATRX	X	76812932	76812932	-1	Missense_Mutation	c.6689T>C	p.M2230T
RERFGC1B	Stomach	TET1	10	70332888	70332888	1	Missense_Mutation	c.793A>G	p.N265D
RERFGC1B	Stomach	SMARCA4	19	11132529	11132529	1	Missense_Mutation	c.2745G>C	p.Q915H
RERFGC1B	Stomach	TAF1L	9	32632867	32632867	-1	Missense_Mutation	c.2711G>A	p.C904Y
RERFLCAD1	Lung	CHD5	1	6185237	6185237	-1	Missense_Mutation	c.4317G>T	p.W1439C
RERFLCAD1	Lung	KDM5A	12	442718	442718	-1	Missense_Mutation	c.1588C>T	p.P530S
RERFLCAD1	Lung	BPTF	17	65899950	65899951	1	Frame_Shift_Ins	c.2589_2590insA	p.V863fs
RERFLCAD1	Lung	NSD1	5	176638596	176638596	1	Missense_Mutation	c.3196G>T	p.A1066S
RERFLCAD2	Lung	ARID1A	1	27089633	27089633	1	Missense_Mutation	c.2589G>T	p.M863I
RERFLCAD2	Lung	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
RERFLCAD2	Lung	CHD8	14	21860042	21860043	-1	Nonsense_Mutation	c.5997_5998TG>AT	p.1999_2000DG>E*
RERFLCAD2	Lung	MGA	15	42041605	42041605	1	Missense_Mutation	c.5800G>T	p.A1934S
RERFLCAD2	Lung	IKZF1	7	50459485	50459486	1	Frame_Shift_Del	c.774_775delAG	p.S258fs
RERFLCAI	Lung	CHD5	1	6195452	6195452	-1	Missense_Mutation	c.2708G>T	p.G903V
RERFLCAI	Lung	SMARCA4	19	11168992	11168992	1	Nonsense_Mutation	c.4582G>T	p.E1528*
RERFLCKJ	Lung	MGA	15	42040964	42040964	1	Missense_Mutation	c.5342A>T	p.Q1781L
RERFLCKJ	Lung	MLLT6	17	36878152	36878152	1	Missense_Mutation	c.2464A>T	p.S822C
RERFLCSQ1	Lung	MLLT10	10	21959572	21959572	1	Silent	c.990A>G	p.R330R
RERFLCSQ1	Lung	NCOA3	20	46281287	46281287	1	Missense_Mutation	c.4084A>G	p.M1362V
RH41	Soft tissue	MGA	15	42042258	42042258	1	Missense_Mutation	c.6453A>C	p.Q2151H
RI1	Haematopoietic and lymphoid tissue	ARID1A	1	27057712	27057712	1	Nonsense_Mutation	c.1420C>T	p.Q474*
RI1	Haematopoietic and lymphoid tissue	ZMYM2	13	20577266	20577266	1	Missense_Mutation	c.1124T>C	p.M375T
RI1	Haematopoietic and lymphoid tissue	CREBBP	16	3790455	3790455	-1	Nonsense_Mutation	c.4078C>T	p.R1360*
RI1	Haematopoietic and lymphoid tissue	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
RKN	Soft tissue	SETDB1	1	150915361	150915361	1	Missense_Mutation	c.707A>G	p.N236S
RKN	Soft tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
RKN	Soft tissue	NCOA1	2	24951212	24951212	1	Missense_Mutation	c.2753G>A	p.C918Y
RKN	Soft tissue	NIPBL	5	37024733	37024733	1	Missense_Mutation	c.5621A>C	p.D1874A
RKN	Soft tissue	NCOA2	8	71060525	71060525	-1	Missense_Mutation	c.2588T>A	p.L863Q
RKO	Large intestine	SETDB1	1	150933159	150933159	1	Frame_Shift_Del	c.2621_2621delC	p.A874fs
RKO	Large intestine	ARID1A	1	27097751	27097751	1	Frame_Shift_Del	c.3340_3340delC	p.P1114fs
RKO	Large intestine	ARID1A	1	27105931	27105931	1	Frame_Shift_Del	c.5542_5542delG	p.G1848fs
RKO	Large intestine	PRDM16	1	3342159	3342159	1	Missense_Mutation	c.2954A>G	p.D985G
RKO	Large intestine	CHD5	1	6172218	6172218	-1	Missense_Mutation	c.5122G>A	p.A1708T
RKO	Large intestine	CHD5	1	6206921	6206921	-1	Missense_Mutation	c.1394T>C	p.L465P
RKO	Large intestine	BMI1	10	22618002	22618002	1	Missense_Mutation	c.1025C>A	p.P342H
RKO	Large intestine	TET1	10	70441157	70441157	1	Frame_Shift_Del	c.4826_4826delA	p.E1609fs
RKO	Large intestine	KMT2A	11	118344186	118344186	1	Frame_Shift_Del	c.2312_2312delC	p.T771fs
RKO	Large intestine	KMT2A	11	118344494	118344495	1	Frame_Shift_Del	c.2620_2621delAG	p.R874fs
RKO	Large intestine	ING1	13	111371933	111371933	1	Missense_Mutation	c.923A>C	p.N308T
RKO	Large intestine	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
RKO	Large intestine	CHD8	14	21859176	21859176	-1	Frame_Shift_Del	c.6275_6275delA	p.N2092fs
RKO	Large intestine	TP53BP1	15	43714257	43714257	-1	Frame_Shift_Del	c.3896_3896delG	p.G1299fs
RKO	Large intestine	IDH2	15	90631700	90631700	-1	Missense_Mutation	c.569G>A	p.G190D
RKO	Large intestine	CHD9	16	53279741	53279741	1	Missense_Mutation	c.3433A>G	p.N1145D
RKO	Large intestine	BRD4	19	15367947	15367947	-1	Missense_Mutation	c.1379A>G	p.E460G
RKO	Large intestine	SP140	2	231159025	231159025	1	Frame_Shift_Del	c.2008_2008delA	p.K670fs
RKO	Large intestine	NCOA1	2	24933846	24933846	1	Missense_Mutation	c.2465A>G	p.E822G
RKO	Large intestine	NCOA1	2	24933890	24933890	1	Missense_Mutation	c.2509G>T	p.D837Y
RKO	Large intestine	DNMT3B	20	31380508	31380508	1	Missense_Mutation	c.998T>C	p.L333S
RKO	Large intestine	DNMT3B	20	31388045	31388045	1	Missense_Mutation	c.1846G>A	p.V616M
RKO	Large intestine	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
RKO	Large intestine	EP300	22	41522009	41522009	1	Frame_Shift_Del	c.871_871delA	p.K291fs
RKO	Large intestine	EP300	22	41566525	41566525	1	Frame_Shift_Del	c.4402_4402delA	p.K1468fs
RKO	Large intestine	BAP1	3	52437597	52437597	-1	Missense_Mutation	c.1564C>A	p.P522T
RKO	Large intestine	WHSC1	4	1980558	1980559	1	Frame_Shift_Ins	c.4020_4021insC	p.K1340fs
RKO	Large intestine	NSD1	5	176696691	176696691	1	Frame_Shift_Del	c.5392_5392delT	p.F1798fs
RKO	Large intestine	NSD1	5	176721499	176721499	1	Missense_Mutation	c.7130A>C	p.K2377T
RKO	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
RKO	Large intestine	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
RKO	Large intestine	JARID2	6	15520469	15520469	1	Nonsense_Mutation	c.3728C>A	p.S1243*
RKO	Large intestine	KMT2C	7	151856061	151856061	-1	Missense_Mutation	c.11557C>T	p.R3853W
RKO	Large intestine	KMT2C	7	151874632	151874632	-1	Missense_Mutation	c.7906G>T	p.G2636C
RKO	Large intestine	TRRAP	7	98581868	98581868	1	Missense_Mutation	c.9187C>T	p.R3063W
RKO	Large intestine	KAT6A	8	41906024	41906024	-1	Missense_Mutation	c.472G>A	p.G158S
RKO	Large intestine	PSIP1	9	15466818	15466818	-1	Missense_Mutation	c.1460G>A	p.G487D
RKO	Large intestine	TAF1	X	70603000	70603000	1	Frame_Shift_Del	c.1993_1993delA	p.K665fs
RL952	Endometrium	ARID1A	1	27087373	27087373	1	Frame_Shift_Del	c.1947_1947delC	p.L649fs
RL952	Endometrium	ARID1A	1	27087503	27087503	1	Nonsense_Mutation	c.2077C>T	p.R693*
RL952	Endometrium	KAT6B	10	76603180	76603180	1	Missense_Mutation	c.565A>G	p.S189G
RL952	Endometrium	ZMYM2	13	20580671	20580671	1	Missense_Mutation	c.1457T>C	p.I486T
RL952	Endometrium	CHD8	14	21859176	21859176	-1	Frame_Shift_Del	c.6275_6275delA	p.N2092fs
RL952	Endometrium	MGA	15	42003414	42003414	1	Missense_Mutation	c.2951G>A	p.R984H
RL952	Endometrium	MGA	15	42041704	42041704	1	Nonsense_Mutation	c.5899C>T	p.Q1967*
RL952	Endometrium	TP53BP1	15	43720218	43720218	-1	Missense_Mutation	c.3824C>T	p.T1275I
RL952	Endometrium	IDH2	15	90627521	90627521	-1	Missense_Mutation	c.1336G>C	p.D446H
RL952	Endometrium	CHD9	16	53243644	53243644	1	Missense_Mutation	c.1703G>A	p.R568K
RL952	Endometrium	CHD9	16	53338226	53338226	1	Missense_Mutation	c.6308G>A	p.R2103H
RL952	Endometrium	SMARCA4	19	11132442	11132444	1	In_Frame_Del	c.2658_2660delGAA	p.K887del
RL952	Endometrium	SMARCA4	19	11170523	11170523	1	Missense_Mutation	c.4826A>G	p.E1609G
RL952	Endometrium	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
RL952	Endometrium	EP300	22	41527514	41527514	1	Missense_Mutation	c.1405G>A	p.A469T
RL952	Endometrium	EP300	22	41574638	41574638	1	Missense_Mutation	c.6923G>A	p.R2308H
RL952	Endometrium	EP300	22	41574678	41574679	1	Frame_Shift_Ins	c.6963_6964insC	p.Q2321fs
RL952	Endometrium	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
RL952	Endometrium	PHF3	6	64394228	64394228	1	Missense_Mutation	c.605G>A	p.R202Q
RL952	Endometrium	KMT2C	7	151874710	151874710	-1	Nonsense_Mutation	c.7828C>T	p.R2610*
RL952	Endometrium	BRD3	9	136913440	136913440	-1	Missense_Mutation	c.851G>A	p.R284H
RL952	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
RL952	Endometrium	TAF1L	9	32633584	32633584	-1	Frame_Shift_Del	c.1994_1994delA	p.K665fs
RL	Haematopoietic and lymphoid tissue	EP300	22	41548243	41548243	1	Nonsense_Mutation	c.3031G>T	p.E1011*
RL	Haematopoietic and lymphoid tissue	EP300	22	41565578	41565578	1	Missense_Mutation	c.4244A>C	p.H1415P
RL	Haematopoietic and lymphoid tissue	JARID2	6	15496438	15496438	1	Missense_Mutation	c.982G>A	p.V328I
RL	Haematopoietic and lymphoid tissue	PHIP	6	79688374	79688374	-1	Missense_Mutation	c.2824C>G	p.P942A
RL	Haematopoietic and lymphoid tissue	KMT2C	7	151849898	151849898	-1	Nonsense_Mutation	c.12418C>T	p.Q4140*
RL	Haematopoietic and lymphoid tissue	KMT2C	7	151945444	151945445	-1	Frame_Shift_Del	c.2074_2075delGT	p.V692fs
RL	Haematopoietic and lymphoid tissue	TRRAP	7	98519541	98519541	1	Missense_Mutation	c.2788G>A	p.D930N
RMGI	Ovary	KMT2C	7	152008960	152008960	-1	Missense_Mutation	c.662C>A	p.A221D
RMGI	Ovary	TAF1L	9	32631218	32631218	-1	Missense_Mutation	c.4360C>T	p.R1454C
RMUGS	Ovary	CHD8	14	21869656	21869656	-1	Missense_Mutation	c.3242C>G	p.S1081C
RMUGS	Ovary	CHD1	5	98215345	98215345	-1	Missense_Mutation	c.3148G>A	p.D1050N
RMUGS	Ovary	TAF1	X	70643035	70643035	1	Silent	c.4581G>A	p.A1527A
RPMI7951	Skin	TRIM33	1	114969867	114969867	-1	Missense_Mutation	c.1352C>T	p.P451L
RPMI7951	Skin	MGA	15	41989031	41989031	1	Missense_Mutation	c.1823C>A	p.P608Q
RPMI7951	Skin	HDAC4	2	240085586	240085586	-1	Nonsense_Mutation	c.524T>G	p.L175*
RPMI8226	Haematopoietic and lymphoid tissue	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
RPMI8226	Haematopoietic and lymphoid tissue	TAF1L	9	32631253	32631253	-1	Missense_Mutation	c.4325G>A	p.R1442Q
RPMI8226	Haematopoietic and lymphoid tissue	KDM6A	X	44920663	44920663	1	Missense_Mutation	c.1580A>C	p.Q527P
RPMI8402	Haematopoietic and lymphoid tissue	MGA	15	42003164	42003164	1	Nonsense_Mutation	c.2701C>T	p.Q901*
RPMI8402	Haematopoietic and lymphoid tissue	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
RPMI8402	Haematopoietic and lymphoid tissue	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
RS411	Haematopoietic and lymphoid tissue	ARID1A	1	27097737	27097737	1	Missense_Mutation	c.3326G>A	p.R1109Q
RS411	Haematopoietic and lymphoid tissue	ERCC6	10	50667043	50667043	-1	Missense_Mutation	c.4300T>C	p.F1434L
RS411	Haematopoietic and lymphoid tissue	KMT2A	11	118354949	118354949	1	Missense_Mutation	c.4138C>T	p.L1380F
RS411	Haematopoietic and lymphoid tissue	TP53BP1	15	43707822	43707822	-1	Nonsense_Mutation	c.5059C>T	p.R1687*
RS411	Haematopoietic and lymphoid tissue	SP140	2	231106154	231106154	1	Missense_Mutation	c.442G>T	p.V148L
RS411	Haematopoietic and lymphoid tissue	DNMT3B	20	31387128	31387128	1	Missense_Mutation	c.1753G>A	p.A585T
RS411	Haematopoietic and lymphoid tissue	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
RS411	Haematopoietic and lymphoid tissue	LMNB1	5	126156688	126156688	1	Missense_Mutation	c.1247G>A	p.R416Q
RS411	Haematopoietic and lymphoid tissue	HDAC2	6	114264518	114264518	-1	Frame_Shift_Del	c.1657_1657delA	p.T553fs
RS411	Haematopoietic and lymphoid tissue	KMT2C	7	151845229	151845229	-1	Missense_Mutation	c.13783C>T	p.R4595C
RS411	Haematopoietic and lymphoid tissue	KMT2C	7	151875060	151875060	-1	Missense_Mutation	c.7478C>T	p.P2493L
RS411	Haematopoietic and lymphoid tissue	TRRAP	7	98479625	98479625	1	Missense_Mutation	c.128A>G	p.Q43R
RS5	Pleura	NCOA4	10	51585207	51585207	1	Missense_Mutation	c.1354G>A	p.G452R
RS5	Pleura	BRD4	19	15366173	15366173	-1	Missense_Mutation	c.1982C>A	p.P661Q
RT11284	Urinary tract	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
RT11284	Urinary tract	KMT2C	7	151882654	151882654	-1	Missense_Mutation	c.5071G>A	p.A1691T
RT11284	Urinary tract	KDM6A	X	44942835	44942835	1	Frame_Shift_Del	c.3571_3571delC	p.P1191fs
RT112	Urinary tract	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
RT112	Urinary tract	KMT2C	7	151882654	151882654	-1	Missense_Mutation	c.5071G>A	p.A1691T
RT112	Urinary tract	KDM6A	X	44942835	44942835	1	Frame_Shift_Del	c.3571_3571delC	p.P1191fs
RT4	Urinary tract	MGA	15	42041782	42041782	1	Missense_Mutation	c.5977G>T	p.V1993F
RT4	Urinary tract	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
RT4	Urinary tract	BAP1	3	52438516	52438516	-1	Nonsense_Mutation	c.1203T>G	p.Y401*
RT4	Urinary tract	BAP1	3	52438518	52438518	-1	Missense_Mutation	c.1201T>G	p.Y401D
RT4	Urinary tract	BRD2	6	32942382	32942382	1	Missense_Mutation	c.173C>A	p.P58H
S117	Soft tissue	MLLT10	10	21906076	21906076	1	Missense_Mutation	c.639T>G	p.D213E
S117	Soft tissue	MLLT10	10	21906091	21906091	1	Silent	c.654T>C	p.D218D
S117	Soft tissue	MGA	15	42041782	42041782	1	Missense_Mutation	c.5977G>T	p.V1993F
S117	Soft tissue	TAF1L	9	32631781	32631781	-1	Missense_Mutation	c.3797C>T	p.P1266L
SAOS2	Bone	MSH6	2	48027268	48027268	1	Missense_Mutation	c.2146A>G	p.T716A
SAOS2	Bone	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
SAOS2	Bone	WHSC1	4	1932444	1932444	1	Missense_Mutation	c.1502G>A	p.R501H
SAOS2	Bone	NIPBL	5	36985576	36985576	1	Missense_Mutation	c.2294G>A	p.R765K
SBC5	Lung	SUZ12	17	30323859	30323859	1	Missense_Mutation	c.1837G>T	p.V613L
SBC5	Lung	SMARCA4	19	11144148	11144149	1	Frame_Shift_Del	c.3729_3730delGC	p.R1243fs
SBC5	Lung	TRIM24	7	138204030	138204030	1	Missense_Mutation	c.728G>A	p.C243Y
SCABER	Urinary tract	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SCABER	Urinary tract	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
SCABER	Urinary tract	SMARCA2	9	2039774	2039776	1	In_Frame_Del	c.664_666delCAA	p.Q238del
SCC15	Upper aerodigestive tract	ERCC6	10	50736484	50736484	-1	Missense_Mutation	c.631G>A	p.A211T
SCC15	Upper aerodigestive tract	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
SCC25	Upper aerodigestive tract	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
SCC4	Upper aerodigestive tract	LMNA	1	156106966	156106966	1	Silent	c.1551G>A	p.Q517Q
SCC4	Upper aerodigestive tract	SIRT1	10	69651179	69651179	1	Missense_Mutation	c.809T>A	p.I270K
SCC4	Upper aerodigestive tract	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
SCC4	Upper aerodigestive tract	NSD1	5	176637654	176637654	1	Frame_Shift_Del	c.2254_2254delT	p.S752fs
SCC9	Upper aerodigestive tract	TP53BP1	15	43720315	43720315	-1	Missense_Mutation	c.3727C>T	p.R1243C
SCC9	Upper aerodigestive tract	NSD1	5	176684152	176684152	1	Missense_Mutation	c.4966G>T	p.G1656C
SCC9	Upper aerodigestive tract	NIPBL	5	36984975	36984975	1	Missense_Mutation	c.1693A>G	p.K565E
SCLC21H	Lung	PRDM16	1	3313094	3313094	1	Nonsense_Mutation	c.613G>T	p.E205*
SCLC21H	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SCLC21H	Lung	SUZ12	17	30320906	30320906	1	Missense_Mutation	c.1316G>T	p.R439M
SCLC21H	Lung	SUZ12	17	30323851	30323851	1	Missense_Mutation	c.1829A>T	p.E610V
SCLC21H	Lung	KAT6A	8	41790687	41790698	-1	In_Frame_Del	c.5040_5051delACAGCAGCCGCA	p.1680_1684QQQPQ>Q
SCLC21H	Lung	TAF1L	9	32634793	32634793	-1	Missense_Mutation	c.785T>C	p.L262P
SEM	Haematopoietic and lymphoid tissue	KAT6B	10	76784753	76784753	1	Missense_Mutation	c.3410G>A	p.R1137H
SEM	Haematopoietic and lymphoid tissue	MGA	15	41961201	41961201	1	Missense_Mutation	c.109G>A	p.D37N
SEM	Haematopoietic and lymphoid tissue	MGA	15	42058964	42058964	1	Frame_Shift_Del	c.8684_8684delA	p.D2895fs
SEM	Haematopoietic and lymphoid tissue	CHD9	16	53352166	53352166	1	Missense_Mutation	c.7627C>T	p.R2543C
SEM	Haematopoietic and lymphoid tissue	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
SEM	Haematopoietic and lymphoid tissue	KMT2C	7	151845524	151845524	-1	Frame_Shift_Del	c.13488_13488delT	p.F4496fs
SEM	Haematopoietic and lymphoid tissue	KMT2C	7	151874147	151874148	-1	Frame_Shift_Ins	c.8390_8391insA	p.K2797fs
SET2	Haematopoietic and lymphoid tissue	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
SF126	Central nervous system	ATF2	2	175982790	175982790	-1	Silent	c.375G>A	p.E125E
SF295	Central nervous system	BRDT	1	92442768	92442768	1	Missense_Mutation	c.799G>A	p.V267I
SF295	Central nervous system	KAT6B	10	76781852	76781863	1	In_Frame_Del	c.3235_3246delGAGGAGGAAGAA	p.EEEE1083del
SF295	Central nervous system	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SF295	Central nervous system	WHSC1	4	1956963	1956963	1	Missense_Mutation	c.2414T>C	p.V805A
SF295	Central nervous system	NIPBL	5	37024780	37024780	1	Missense_Mutation	c.5668G>T	p.V1890L
SH10TC	Stomach	SP140	2	231106184	231106184	1	Frame_Shift_Del	c.472_472delC	p.L158fs
SH10TC	Stomach	NIPBL	5	36986061	36986061	1	Missense_Mutation	c.2779A>G	p.K927E
SH10TC	Stomach	STK31	7	23808693	23808693	1	Missense_Mutation	c.1496A>G	p.Y499C
SH10TC	Stomach	ATRX	X	76938976	76938976	-1	Missense_Mutation	c.1772C>T	p.T591I
SH4	Skin	NCOA2	8	71078921	71078921	-1	Missense_Mutation	c.610G>A	p.V204I
SHP77	Lung	ARID1A	1	27023651	27023651	1	Missense_Mutation	c.757C>T	p.P253S
SHP77	Lung	MGA	15	41961438	41961438	1	Missense_Mutation	c.346G>T	p.D116Y
SHP77	Lung	TRIM28	19	59059876	59059876	1	Missense_Mutation	c.1240G>A	p.G414S
SHP77	Lung	HDAC3	5	141004821	141004822	-1	Missense_Mutation	c.1170_1171TG>CA	p.D391N
SHP77	Lung	NIPBL	5	36985932	36985932	1	Missense_Mutation	c.2650G>T	p.G884W
SHP77	Lung	DAXX	6	33288219	33288219	-1	Missense_Mutation	c.1225C>T	p.R409W
SHSY5Y	Autonomic ganglia	ARID1A	1	27099883	27099883	1	Silent	c.3762C>T	p.G1254G
SHSY5Y	Autonomic ganglia	SMARCA4	19	11134251	11134251	1	Missense_Mutation	c.2917C>T	p.R973W
SHSY5Y	Autonomic ganglia	KMT2C	7	151876961	151876961	-1	Missense_Mutation	c.7400C>G	p.P2467R
SHSY5Y	Autonomic ganglia	KAT6A	8	41905903	41905903	-1	Missense_Mutation	c.593A>G	p.K198R
SIGM5	Haematopoietic and lymphoid tissue	KAT6B	10	76735344	76735344	1	Missense_Mutation	c.1249T>A	p.S417T
SIMA	Autonomic ganglia	KMT2A	11	118344671	118344671	1	Missense_Mutation	c.2797C>T	p.R933W
SIMA	Autonomic ganglia	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
SIMA	Autonomic ganglia	LMNB2	19	2431857	2431857	-1	Missense_Mutation	c.1634C>T	p.T545M
SJRH30	Soft tissue	NCOA1	2	24930662	24930662	1	Missense_Mutation	c.2323G>C	p.V775L
SJRH30	Soft tissue	TRIM24	7	138252253	138252253	1	Missense_Mutation	c.1558C>G	p.Q520E
SJSA1	Bone	EP300	22	41546056	41546056	1	Missense_Mutation	c.2671A>C	p.T891P
SKBR3	Breast	KMT2C	7	151878785	151878785	-1	Missense_Mutation	c.6160C>G	p.Q2054E
SKCO1	Large intestine	HNF1A	12	121432117	121432118	1	Frame_Shift_Ins	c.864_865insC	p.G288fs
SKCO1	Large intestine	TRIM28	19	59061847	59061847	1	Missense_Mutation	c.2435C>G	p.P812R
SKCO1	Large intestine	EP300	22	41545908	41545909	1	Missense_Mutation	c.2523_2524CC>TT	p.P842S
SKES1	Bone	CHD5	1	6228277	6228277	-1	Missense_Mutation	c.140T>A	p.L47H
SKES1	Bone	DNMT1	19	10257106	10257110	-1	Frame_Shift_Del	c.2811_2815delCCTCT	p.V937fs
SKHEP1	Liver	SMARCA4	19	11170537	11170537	1	Nonsense_Mutation	c.4840G>T	p.E1614*
SKLMS1	Soft tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SKLU1	Lung	TRIM33	1	114945462	114945462	-1	Missense_Mutation	c.2812G>C	p.E938Q
SKLU1	Lung	ARID1A	1	27099874	27099874	1	Frame_Shift_Del	c.3753_3753delC	p.G1251fs
SKLU1	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
SKLU1	Lung	HDAC3	5	141005278	141005278	-1	Missense_Mutation	c.1033C>T	p.R345C
SKLU1	Lung	KMT2C	7	151970830	151970830	-1	Missense_Mutation	c.972C>A	p.F324L
SKLU1	Lung	TAF1L	9	32635406	32635406	-1	Missense_Mutation	c.172G>C	p.D58H
SKLU1	Lung	KDM6A	X	44928929	44928929	1	Nonsense_Mutation	c.2185C>T	p.Q729*
SKMEL1	Skin	MEN1	11	64575065	64575065	-1	Missense_Mutation	c.757G>A	p.D253N
SKMEL1	Skin	ING1	13	111372003	111372004	1	Frame_Shift_Del	c.993_994delGC	p.K331fs
SKMEL1	Skin	KAT6A	8	41832259	41832259	-1	Missense_Mutation	c.1445T>A	p.M482K
SKMEL24	Skin	TRIM33	1	114948207	114948207	-1	Nonsense_Mutation	c.2593C>T	p.R865*
SKMEL24	Skin	PRDM16	1	3328353	3328353	1	Missense_Mutation	c.1592C>T	p.P531L
SKMEL24	Skin	ERCC6	10	50713973	50713973	-1	Missense_Mutation	c.1483G>A	p.E495K
SKMEL24	Skin	NIPBL	5	37022436	37022436	1	Missense_Mutation	c.5518C>T	p.L1840F
SKMEL24	Skin	TAF1	X	70602956	70602956	1	Missense_Mutation	c.1949C>T	p.S650F
SKMEL28	Skin	ARID1A	1	27101085	27101085	1	Missense_Mutation	c.4367C>T	p.P1456L
SKMEL28	Skin	HDAC1	1	32798622	32798622	1	Missense_Mutation	c.1426A>C	p.K476Q
SKMEL2	Skin	TET1	10	70412302	70412302	1	Missense_Mutation	c.4412A>G	p.Y1471C
SKMEL2	Skin	ZMYM2	13	20657094	20657094	1	Frame_Shift_Del	c.3742_3742delA	p.K1248fs
SKMEL2	Skin	CREBBP	16	3779611	3779611	-1	Missense_Mutation	c.5437A>G	p.N1813D
SKMEL2	Skin	CHD9	16	53190449	53190449	1	Missense_Mutation	c.448A>G	p.M150V
SKMEL2	Skin	KAT7	17	47895300	47895300	1	Missense_Mutation	c.1082G>A	p.R361Q
SKMEL2	Skin	BRD4	19	15383693	15383693	-1	Missense_Mutation	c.218C>T	p.T73I
SKMEL2	Skin	KMT2C	7	151848637	151848637	-1	Missense_Mutation	c.12556G>T	p.G4186C
SKMEL2	Skin	TAF1L	9	32630954	32630954	-1	Missense_Mutation	c.4624C>T	p.P1542S
SKMEL2	Skin	ATRX	X	76845355	76845355	-1	Missense_Mutation	c.6166T>A	p.L2056I
SKMEL30	Skin	KAT6A	8	41836202	41836202	-1	Missense_Mutation	c.1001C>T	p.P334L
SKMEL3	Skin	MEN1	11	64571924	64571924	-1	Missense_Mutation	c.1730C>T	p.S577L
SKMEL5	Skin	TET2	4	106156529	106156529	1	Missense_Mutation	c.1493C>T	p.S498F
SKMEL5	Skin	WHSC1	4	1902487	1902487	1	Missense_Mutation	c.106C>T	p.P36S
SKMEL5	Skin	BRD3	9	136899904	136899904	-1	Nonsense_Mutation	c.1984C>T	p.Q662*
SKMES1	Lung	SP140	2	231109753	231109753	1	Missense_Mutation	c.622G>C	p.G208R
SKNDZ	Autonomic ganglia	EP300	22	41546032	41546032	1	Missense_Mutation	c.2647A>G	p.R883G
SKNDZ	Autonomic ganglia	TET2	4	106155467	106155467	1	Missense_Mutation	c.431G>A	p.R144H
SKNDZ	Autonomic ganglia	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
SKNFI	Autonomic ganglia	NCOA3	20	46279860	46279861	1	In_Frame_Ins	c.3786_3787insCAA	p.1276_1277insQ
SKNFI	Autonomic ganglia	NIPBL	5	36985885	36985885	1	Missense_Mutation	c.2603G>A	p.R868Q
SKNFI	Autonomic ganglia	TAF1L	9	32632940	32632940	-1	Missense_Mutation	c.2638T>C	p.W880R
SKNMC	Bone	KMT2A	11	118307615	118307615	1	Missense_Mutation	c.388C>T	p.R130W
SKNMC	Bone	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
SKNSH	Autonomic ganglia	ARID1A	1	27099883	27099883	1	Silent	c.3762C>T	p.G1254G
SKNSH	Autonomic ganglia	MLLT10	10	22022502	22022502	1	Missense_Mutation	c.2525C>T	p.S842F
SKNSH	Autonomic ganglia	CHD9	16	53352248	53352248	1	Missense_Mutation	c.7709G>T	p.R2570I
SKNSH	Autonomic ganglia	SMARCA4	19	11134251	11134251	1	Missense_Mutation	c.2917C>T	p.R973W
SKNSH	Autonomic ganglia	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
SKNSH	Autonomic ganglia	KMT2C	7	151876961	151876961	-1	Missense_Mutation	c.7400C>G	p.P2467R
SKNSH	Autonomic ganglia	KAT6A	8	41905903	41905903	-1	Missense_Mutation	c.593A>G	p.K198R
SKOV3	Ovary	ARID1A	1	27058048	27058048	1	Nonsense_Mutation	c.1756C>T	p.Q586*
SKOV3	Ovary	ING1	13	111372179	111372179	1	Missense_Mutation	c.1169C>A	p.P390H
SKOV3	Ovary	NCOA1	2	24974868	24974868	1	Missense_Mutation	c.3724G>A	p.E1242K
SKOV3	Ovary	NCOA3	20	46262371	46262371	1	Missense_Mutation	c.955T>G	p.Y319D
SKOV3	Ovary	EP300	22	41565575	41565575	1	Missense_Mutation	c.4241A>G	p.Y1414C
SKOV3	Ovary	PHF3	6	64422202	64422202	1	Nonsense_Mutation	c.4718T>A	p.L1573*
SKOV3	Ovary	PHIP	6	79650825	79650825	-1	Missense_Mutation	c.5051A>T	p.D1684V
SKUT1	Soft tissue	ARID1A	1	27023716	27023716	1	Frame_Shift_Del	c.822_822delG	p.M274fs
SKUT1	Soft tissue	TET1	10	70332153	70332153	1	Frame_Shift_Del	c.58_58delA	p.K20fs
SKUT1	Soft tissue	KMT2A	11	118344185	118344186	1	Frame_Shift_Ins	c.2311_2312insC	p.T771fs
SKUT1	Soft tissue	ZMYM2	13	20657094	20657094	1	Frame_Shift_Del	c.3742_3742delA	p.K1248fs
SKUT1	Soft tissue	CHD8	14	21861824	21861824	-1	Nonsense_Mutation	c.5293C>T	p.R1765*
SKUT1	Soft tissue	TP53BP1	15	43730536	43730536	-1	Frame_Shift_Del	c.3177_3177delC	p.P1059fs
SKUT1	Soft tissue	MLLT6	17	36872047	36872048	1	In_Frame_Ins	c.1002_1003insTCC	p.338_339insS
SKUT1	Soft tissue	ATF2	2	175957949	175957949	-1	Missense_Mutation	c.1025G>A	p.R342H
SKUT1	Soft tissue	NCOA1	2	24964951	24964951	1	Missense_Mutation	c.3602G>A	p.R1201H
SKUT1	Soft tissue	WHSC1	4	1980559	1980559	1	Frame_Shift_Del	c.4021_4021delC	p.P1341fs
SKUT1	Soft tissue	NSD1	5	176721892	176721892	1	Missense_Mutation	c.7523G>A	p.C2508Y
SKUT1	Soft tissue	CHD1	5	98199128	98199128	-1	Missense_Mutation	c.4411A>T	p.I1471F
SKUT1	Soft tissue	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
SKUT1	Soft tissue	BAG6	6	31610842	31610842	-1	Missense_Mutation	c.1717G>A	p.A573T
SKUT1	Soft tissue	PHF3	6	64389991	64389991	1	Missense_Mutation	c.335G>A	p.R112K
SKUT1	Soft tissue	KMT2C	7	151864331	151864331	-1	Missense_Mutation	c.9650G>A	p.R3217H
SKUT1	Soft tissue	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
SNGM	Endometrium	SETDB1	1	150935538	150935538	1	Missense_Mutation	c.3380C>T	p.A1127V
SNGM	Endometrium	LMNA	1	156105772	156105772	1	Silent	c.1017G>A	p.A339A
SNGM	Endometrium	ARID1A	1	27105931	27105931	1	Frame_Shift_Del	c.5542_5542delG	p.G1848fs
SNGM	Endometrium	ARID1A	1	27106804	27106804	1	Frame_Shift_Del	c.6415_6415delC	p.P2139fs
SNGM	Endometrium	ERCC6	10	50667133	50667133	-1	Missense_Mutation	c.4210C>T	p.R1404C
SNGM	Endometrium	SIRT1	10	69648688	69648688	1	Missense_Mutation	c.596G>A	p.R199Q
SNGM	Endometrium	CREBBP	16	3781374	3781374	-1	Missense_Mutation	c.4991G>A	p.R1664H
SNGM	Endometrium	CREBBP	16	3900365	3900365	-1	Missense_Mutation	c.731C>T	p.T244M
SNGM	Endometrium	CHD9	16	53288510	53288510	1	Missense_Mutation	c.4022T>G	p.V1341G
SNGM	Endometrium	CHD9	16	53348351	53348351	1	Frame_Shift_Del	c.7285_7285delA	p.K2429fs
SNGM	Endometrium	SMARCA4	19	11152176	11152176	1	Missense_Mutation	c.4460C>A	p.P1487Q
SNGM	Endometrium	BRD4	19	15355372	15355372	-1	Missense_Mutation	c.2251G>A	p.A751T
SNGM	Endometrium	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
SNGM	Endometrium	MSH6	2	48033352	48033352	1	Missense_Mutation	c.3656C>T	p.T1219I
SNGM	Endometrium	NCOA3	20	46279750	46279750	1	Missense_Mutation	c.3676G>A	p.V1226I
SNGM	Endometrium	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
SNGM	Endometrium	BAP1	3	52438469	52438469	-1	Missense_Mutation	c.1250G>T	p.R417M
SNGM	Endometrium	BAP1	3	52443759	52443759	-1	Missense_Mutation	c.38G>A	p.G13D
SNGM	Endometrium	NSD1	5	176562538	176562538	1	Missense_Mutation	c.434C>T	p.T145I
SNGM	Endometrium	NSD1	5	176721172	176721172	1	Missense_Mutation	c.6803C>T	p.A2268V
SNGM	Endometrium	HDAC2	6	114292052	114292052	-1	Silent	c.303C>T	p.G101G
SNGM	Endometrium	JARID2	6	15507482	15507482	1	Missense_Mutation	c.2657C>T	p.S886L
SNGM	Endometrium	JARID2	6	15512496	15512496	1	Missense_Mutation	c.3010A>G	p.S1004G
SNGM	Endometrium	TRRAP	7	98528336	98528336	1	Frame_Shift_Del	c.3474_3474delG	p.L1158fs
SNGM	Endometrium	TRRAP	7	98609024	98609024	1	Missense_Mutation	c.11161C>A	p.L3721M
SNGM	Endometrium	NCOA2	8	71037032	71037032	-1	Nonsense_Mutation	c.3985C>T	p.R1329*
SNGM	Endometrium	NCOA2	8	71057009	71057009	-1	Nonsense_Mutation	c.2680C>T	p.Q894*
SNGM	Endometrium	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
SNGM	Endometrium	ATRX	X	76890149	76890150	-1	Frame_Shift_Ins	c.4744_4745insA	p.T1582fs
SNU1033	Large intestine	KMT2A	11	118380737	118380737	1	Missense_Mutation	c.10975C>T	p.R3659W
SNU1033	Large intestine	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SNU1033	Large intestine	HDAC10	22	50688506	50688506	-1	Frame_Shift_Del	c.375_375delG	p.G125fs
SNU1033	Large intestine	NSD1	5	176707634	176707634	1	Missense_Mutation	c.5691T>G	p.C1897W
SNU1040	Large intestine	LMNA	1	156104245	156104245	1	Missense_Mutation	c.565C>T	p.R189W
SNU1040	Large intestine	ARID1A	1	27088711	27088711	1	Missense_Mutation	c.2320C>T	p.R774C
SNU1040	Large intestine	HDAC1	1	32796197	32796197	1	Missense_Mutation	c.748G>A	p.E250K
SNU1040	Large intestine	PRDM16	1	3334548	3334548	1	Nonsense_Mutation	c.2848C>T	p.R950*
SNU1040	Large intestine	MLLT10	10	21962815	21962815	1	Missense_Mutation	c.1588A>T	p.S530C
SNU1040	Large intestine	ERCC6	10	50681626	50681626	-1	Missense_Mutation	c.2606A>G	p.D869G
SNU1040	Large intestine	ERCC6	10	50691462	50691462	-1	Missense_Mutation	c.1922A>G	p.H641R
SNU1040	Large intestine	NCOA4	10	51579277	51579277	1	Nonsense_Mutation	c.184C>T	p.R62*
SNU1040	Large intestine	NCOA4	10	51585582	51585582	1	Missense_Mutation	c.1729C>T	p.L577F
SNU1040	Large intestine	TET1	10	70406178	70406178	1	Missense_Mutation	c.3692A>G	p.Q1231R
SNU1040	Large intestine	TET1	10	70450774	70450774	1	Missense_Mutation	c.5614T>G	p.F1872V
SNU1040	Large intestine	KAT6B	10	76602719	76602719	1	Missense_Mutation	c.104C>T	p.A35V
SNU1040	Large intestine	KMT2A	11	118344161	118344161	1	Missense_Mutation	c.2287A>G	p.S763G
SNU1040	Large intestine	KMT2A	11	118373226	118373226	1	Missense_Mutation	c.6619C>T	p.R2207W
SNU1040	Large intestine	HNF1A	12	121431969	121431969	1	Missense_Mutation	c.716C>T	p.A239V
SNU1040	Large intestine	KDM5A	12	404794	404794	-1	Missense_Mutation	c.4400G>A	p.R1467Q
SNU1040	Large intestine	KDM5A	12	417152	417152	-1	Missense_Mutation	c.3398G>A	p.R1133Q
SNU1040	Large intestine	KDM5A	12	420062	420062	-1	Missense_Mutation	c.3205A>G	p.T1069A
SNU1040	Large intestine	KDM5A	12	432368	432368	-1	Missense_Mutation	c.2155C>T	p.R719C
SNU1040	Large intestine	MBD6	12	57919306	57919306	1	Frame_Shift_Del	c.555_555delC	p.F185fs
SNU1040	Large intestine	ING1	13	111371678	111371678	1	Missense_Mutation	c.668G>A	p.R223H
SNU1040	Large intestine	ING1	13	111372194	111372194	1	Missense_Mutation	c.1184A>G	p.Y395C
SNU1040	Large intestine	ZMYM2	13	20638677	20638678	1	Frame_Shift_Del	c.3124_3125delAA	p.K1042fs
SNU1040	Large intestine	CHD8	14	21859176	21859176	-1	Frame_Shift_Del	c.6275_6275delA	p.N2092fs
SNU1040	Large intestine	CHD8	14	21861788	21861788	-1	Missense_Mutation	c.5329C>T	p.R1777W
SNU1040	Large intestine	CHD8	14	21863126	21863126	-1	Missense_Mutation	c.4498C>T	p.R1500C
SNU1040	Large intestine	CHD8	14	21897407	21897407	-1	Missense_Mutation	c.94C>T	p.P32S
SNU1040	Large intestine	MGA	15	42034831	42034831	1	Missense_Mutation	c.4673C>T	p.T1558I
SNU1040	Large intestine	MGA	15	42040948	42040948	1	Missense_Mutation	c.5326C>T	p.P1776S
SNU1040	Large intestine	TP53BP1	15	43749241	43749241	-1	Missense_Mutation	c.1565T>A	p.L522H
SNU1040	Large intestine	TP53BP1	15	43749351	43749351	-1	Missense_Mutation	c.1455G>A	p.M485I
SNU1040	Large intestine	IDH2	15	90628091	90628091	-1	Missense_Mutation	c.1228G>T	p.A410S
SNU1040	Large intestine	CREBBP	16	3786128	3786128	-1	Missense_Mutation	c.4637C>A	p.P1546H
SNU1040	Large intestine	CREBBP	16	3789645	3789645	-1	Missense_Mutation	c.4214T>C	p.V1405A
SNU1040	Large intestine	CREBBP	16	3807913	3807913	-1	Missense_Mutation	c.3506G>A	p.R1169H
SNU1040	Large intestine	CREBBP	16	3808952	3808952	-1	Missense_Mutation	c.3272G>A	p.R1091H
SNU1040	Large intestine	CHD9	16	53191448	53191448	1	Nonsense_Mutation	c.1447C>T	p.R483*
SNU1040	Large intestine	CHD9	16	53263000	53263000	1	Frame_Shift_Del	c.2274_2274delT	p.H758fs
SNU1040	Large intestine	CHD9	16	53265368	53265368	1	Missense_Mutation	c.2324T>C	p.V775A
SNU1040	Large intestine	CHD9	16	53283791	53283791	1	Missense_Mutation	c.3674A>G	p.Y1225C
SNU1040	Large intestine	CHD9	16	53341596	53341596	1	Missense_Mutation	c.6784C>T	p.R2262C
SNU1040	Large intestine	MLLT6	17	36873802	36873802	1	Missense_Mutation	c.1769G>A	p.R590H
SNU1040	Large intestine	SMARCA4	19	11121131	11121131	1	Missense_Mutation	c.2198C>T	p.A733V
SNU1040	Large intestine	SMARCA4	19	11169474	11169474	1	Missense_Mutation	c.4640G>A	p.R1547H
SNU1040	Large intestine	BRD4	19	15349771	15349771	-1	Missense_Mutation	c.3803C>T	p.A1268V
SNU1040	Large intestine	BRD4	19	15349886	15349886	-1	Missense_Mutation	c.3766C>T	p.R1256W
SNU1040	Large intestine	TFPT	19	54611407	54611407	-1	Missense_Mutation	c.568C>T	p.R190W
SNU1040	Large intestine	TFPT	19	54617841	54617841	-1	Missense_Mutation	c.263G>A	p.R88H
SNU1040	Large intestine	TFPT	19	54617868	54617868	-1	Missense_Mutation	c.236G>A	p.R79H
SNU1040	Large intestine	TRIM28	19	59059026	59059026	1	Missense_Mutation	c.785G>A	p.R262H
SNU1040	Large intestine	MSH6	2	48025850	48025850	1	Missense_Mutation	c.728G>A	p.R243H
SNU1040	Large intestine	MSH6	2	48032814	48032814	1	Missense_Mutation	c.3614C>T	p.T1205I
SNU1040	Large intestine	DNMT3B	20	31383281	31383281	1	Missense_Mutation	c.1193G>A	p.R398H
SNU1040	Large intestine	DNMT3B	20	31383290	31383290	1	Missense_Mutation	c.1202C>T	p.T401I
SNU1040	Large intestine	DNMT3B	20	31384997	31384997	1	Missense_Mutation	c.1382G>A	p.R461H
SNU1040	Large intestine	EP300	22	41566525	41566525	1	Frame_Shift_Del	c.4402_4402delA	p.K1468fs
SNU1040	Large intestine	EP300	22	41572266	41572266	1	Missense_Mutation	c.4795C>T	p.R1599C
SNU1040	Large intestine	EP300	22	41574775	41574775	1	Missense_Mutation	c.7060G>A	p.A2354T
SNU1040	Large intestine	TET2	4	106155386	106155386	1	Missense_Mutation	c.350G>A	p.R117H
SNU1040	Large intestine	WHSC1	4	1918633	1918633	1	Missense_Mutation	c.796T>C	p.F266L
SNU1040	Large intestine	WHSC1	4	1953898	1953898	1	Missense_Mutation	c.2077G>A	p.A693T
SNU1040	Large intestine	WHSC1	4	1980463	1980463	1	Missense_Mutation	c.3925G>A	p.D1309N
SNU1040	Large intestine	WHSC1	4	1980559	1980559	1	Frame_Shift_Del	c.4021_4021delC	p.P1341fs
SNU1040	Large intestine	LMNB1	5	126141328	126141328	1	Silent	c.582G>A	p.L194L
SNU1040	Large intestine	NSD1	5	176638998	176638998	1	Missense_Mutation	c.3598C>T	p.R1200W
SNU1040	Large intestine	NSD1	5	176721048	176721048	1	Missense_Mutation	c.6679C>T	p.P2227S
SNU1040	Large intestine	NSD1	5	176721706	176721706	1	Missense_Mutation	c.7337C>A	p.T2446N
SNU1040	Large intestine	NIPBL	5	36962359	36962359	1	Missense_Mutation	c.593A>G	p.H198R
SNU1040	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
SNU1040	Large intestine	NIPBL	5	37024793	37024793	1	Missense_Mutation	c.5681G>A	p.R1894H
SNU1040	Large intestine	NIPBL	5	37059164	37059164	1	Nonsense_Mutation	c.7582G>T	p.E2528*
SNU1040	Large intestine	NIPBL	5	37063985	37063985	1	Missense_Mutation	c.7954T>C	p.S2652P
SNU1040	Large intestine	NIPBL	5	37064899	37064899	1	Frame_Shift_Del	c.8320_8320delA	p.K2774fs
SNU1040	Large intestine	CHD1	5	98194022	98194022	-1	Missense_Mutation	c.4649T>C	p.L1550S
SNU1040	Large intestine	HDAC2	6	114279864	114279864	-1	Missense_Mutation	c.514C>T	p.R172W
SNU1040	Large intestine	HDAC2	6	114281125	114281125	-1	Missense_Mutation	c.392G>A	p.R131H
SNU1040	Large intestine	BAG6	6	31608644	31608644	-1	Missense_Mutation	c.2769G>T	p.Q923H
SNU1040	Large intestine	BAG6	6	31608715	31608715	-1	Missense_Mutation	c.2698C>T	p.R900C
SNU1040	Large intestine	PHF3	6	64394047	64394047	1	Nonsense_Mutation	c.424C>T	p.R142*
SNU1040	Large intestine	PHIP	6	79707228	79707228	-1	Missense_Mutation	c.2104C>T	p.H702Y
SNU1040	Large intestine	PHIP	6	79713554	79713554	-1	Missense_Mutation	c.1546G>A	p.A516T
SNU1040	Large intestine	PHIP	6	79770257	79770257	-1	Missense_Mutation	c.377C>T	p.A126V
SNU1040	Large intestine	PHIP	6	79770396	79770396	-1	Missense_Mutation	c.329G>A	p.R110H
SNU1040	Large intestine	TRIM24	7	138213951	138213951	1	Frame_Shift_Del	c.972_972delA	p.G324fs
SNU1040	Large intestine	KMT2C	7	151845378	151845378	-1	Missense_Mutation	c.13634A>G	p.D4545G
SNU1040	Large intestine	KMT2C	7	151845642	151845642	-1	Missense_Mutation	c.13370G>A	p.G4457D
SNU1040	Large intestine	KMT2C	7	151846095	151846095	-1	Missense_Mutation	c.12917C>T	p.P4306L
SNU1040	Large intestine	KMT2C	7	151860449	151860449	-1	Nonsense_Mutation	c.10213C>T	p.R3405*
SNU1040	Large intestine	KMT2C	7	151873707	151873707	-1	Missense_Mutation	c.8831C>T	p.P2944L
SNU1040	Large intestine	KMT2C	7	151921230	151921230	-1	Missense_Mutation	c.3193G>A	p.A1065T
SNU1040	Large intestine	IKZF1	7	50444317	50444317	1	Nonsense_Mutation	c.247C>T	p.R83*
SNU1040	Large intestine	TRRAP	7	98498324	98498324	1	Missense_Mutation	c.878A>G	p.Y293C
SNU1040	Large intestine	TRRAP	7	98519386	98519386	1	Missense_Mutation	c.2633G>A	p.R878H
SNU1040	Large intestine	TRRAP	7	98569537	98569537	1	Missense_Mutation	c.7787A>G	p.D2596G
SNU1040	Large intestine	TRRAP	7	98574581	98574581	1	Missense_Mutation	c.8246C>T	p.A2749V
SNU1040	Large intestine	TRRAP	7	98579408	98579408	1	Missense_Mutation	c.8630C>T	p.P2877L
SNU1040	Large intestine	TRRAP	7	98608681	98608681	1	Missense_Mutation	c.10903C>T	p.R3635C
SNU1040	Large intestine	TRRAP	7	98608823	98608823	1	Missense_Mutation	c.11045C>T	p.A3682V
SNU1040	Large intestine	TRRAP	7	98609908	98609908	1	Missense_Mutation	c.11510C>T	p.T3837I
SNU1040	Large intestine	ASH2L	8	37964587	37964587	1	Missense_Mutation	c.304G>A	p.V102M
SNU1040	Large intestine	KAT6A	8	41794935	41794935	-1	Missense_Mutation	c.3191C>T	p.T1064M
SNU1040	Large intestine	KAT6A	8	41836184	41836184	-1	Frame_Shift_Del	c.1019_1019delA	p.N340fs
SNU1040	Large intestine	NCOA2	8	71057027	71057027	-1	Missense_Mutation	c.2662C>T	p.P888S
SNU1040	Large intestine	NCOA2	8	71069140	71069140	-1	Missense_Mutation	c.1460C>T	p.S487L
SNU1040	Large intestine	NCOA2	8	71069464	71069464	-1	Missense_Mutation	c.1136T>C	p.V379A
SNU1040	Large intestine	SET	9	131456321	131456321	1	Missense_Mutation	c.849G>T	p.E283D
SNU1040	Large intestine	PSIP1	9	15468835	15468835	-1	Nonsense_Mutation	c.1213C>T	p.R405*
SNU1040	Large intestine	TAF1L	9	32630119	32630119	-1	Missense_Mutation	c.5459A>G	p.H1820R
SNU1040	Large intestine	TAF1L	9	32630942	32630942	-1	Missense_Mutation	c.4636C>T	p.P1546S
SNU1040	Large intestine	TAF1L	9	32631568	32631568	-1	Missense_Mutation	c.4010T>C	p.V1337A
SNU1040	Large intestine	TAF1L	9	32631624	32631624	-1	Missense_Mutation	c.3954G>C	p.Q1318H
SNU1040	Large intestine	TAF1L	9	32634043	32634043	-1	Missense_Mutation	c.1535G>A	p.R512Q
SNU1041	Upper aerodigestive tract	ERCC6	10	50686482	50686482	-1	Missense_Mutation	c.2204G>T	p.R735L
SNU1041	Upper aerodigestive tract	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SNU1041	Upper aerodigestive tract	CHD8	14	21861835	21861835	-1	Missense_Mutation	c.5282A>G	p.D1761G
SNU1041	Upper aerodigestive tract	CHD8	14	21861955	21861955	-1	Missense_Mutation	c.5162G>A	p.R1721H
SNU1066	Upper aerodigestive tract	KMT2A	11	118373837	118373837	1	Missense_Mutation	c.7230G>T	p.M2410I
SNU1066	Upper aerodigestive tract	KMT2A	11	118373982	118373982	1	Missense_Mutation	c.7375G>A	p.E2459K
SNU1066	Upper aerodigestive tract	IDH2	15	90634800	90634800	-1	Missense_Mutation	c.192G>T	p.Q64H
SNU1077	Endometrium	KDM5A	12	431713	431713	-1	Missense_Mutation	c.2296A>T	p.M766L
SNU1077	Endometrium	CHD9	16	53358353	53358353	1	Missense_Mutation	c.8240C>G	p.S2747C
SNU1077	Endometrium	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
SNU1077	Endometrium	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
SNU1077	Endometrium	EP300	22	41536160	41536160	1	Missense_Mutation	c.1777C>T	p.P593S
SNU1077	Endometrium	BRD2	6	32944480	32944480	1	Missense_Mutation	c.967C>T	p.P323S
SNU1077	Endometrium	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
SNU1079	Biliary tract	SIRT1	10	69647185	69647185	1	Silent	c.441G>T	p.L147L
SNU1079	Biliary tract	IDH1	2	209113113	209113113	-1	Missense_Mutation	c.394C>T	p.R132C
SNU1079	Biliary tract	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
SNU1079	Biliary tract	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SNU1196	Biliary tract	TAF1L	9	32633535	32633535	-1	Missense_Mutation	c.2043G>T	p.L681F
SNU1197	Large intestine	SIRT1	10	69676240	69676240	1	Missense_Mutation	c.2134G>A	p.A712T
SNU1197	Large intestine	KDM5A	12	404912	404912	-1	Nonsense_Mutation	c.4282C>T	p.R1428*
SNU1197	Large intestine	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
SNU119	Ovary	CHD5	1	6209416	6209416	-1	Missense_Mutation	c.1051C>G	p.Q351E
SNU119	Ovary	MSH6	2	48033981	48033982	1	Frame_Shift_Ins	c.4065_4066insTTGA	p.T1355fs
SNU1214	Upper aerodigestive tract	BRD2	6	32945673	32945673	1	Missense_Mutation	c.1469C>T	p.S490F
SNU1272	Kidney	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
SNU1272	Kidney	NCOA3	20	46279864	46279878	1	In_Frame_Del	c.3790_3804delCAACAGCAACAGCAA	p.QQQQQ1269del
SNU175	Large intestine	ARID1A	1	27099952	27099952	1	Silent	c.3831G>A	p.Q1277Q
SNU175	Large intestine	ARID1A	1	27100888	27100888	1	Silent	c.4170C>T	p.S1390S
SNU175	Large intestine	ARID1A	1	27105974	27105974	1	Missense_Mutation	c.5585A>G	p.K1862R
SNU175	Large intestine	HDAC1	1	32797735	32797735	1	Missense_Mutation	c.1264G>A	p.D422N
SNU175	Large intestine	MLLT10	10	22015191	22015191	1	Missense_Mutation	c.1945T>A	p.S649T
SNU175	Large intestine	ERCC6	10	50738782	50738782	-1	Missense_Mutation	c.527G>A	p.R176Q
SNU175	Large intestine	TET1	10	70446282	70446282	1	Missense_Mutation	c.5222G>A	p.R1741H
SNU175	Large intestine	KDM5A	12	416953	416953	-1	Frame_Shift_Del	c.3597_3597delA	p.K1199fs
SNU175	Large intestine	KDM5A	12	443491	443491	-1	Missense_Mutation	c.1406C>T	p.P469L
SNU175	Large intestine	KDM5A	12	472142	472142	-1	Missense_Mutation	c.659G>A	p.R220H
SNU175	Large intestine	CHD8	14	21884031	21884031	-1	Frame_Shift_Del	c.915_915delA	p.K305fs
SNU175	Large intestine	CREBBP	16	3778339	3778339	-1	Missense_Mutation	c.6709C>A	p.P2237T
SNU175	Large intestine	CHD9	16	53326835	53326835	1	Missense_Mutation	c.5381G>A	p.R1794H
SNU175	Large intestine	SUZ12	17	30315393	30315393	1	Missense_Mutation	c.1078C>T	p.R360C
SNU175	Large intestine	SMARCA4	19	11134230	11134230	1	Missense_Mutation	c.2896C>T	p.R966W
SNU175	Large intestine	SMARCA4	19	11152215	11152215	1	Missense_Mutation	c.4499C>G	p.A1500G
SNU175	Large intestine	BRD4	19	15350045	15350045	-1	Missense_Mutation	c.3607G>A	p.A1203T
SNU175	Large intestine	TFPT	19	54617842	54617842	-1	Missense_Mutation	c.262C>T	p.R88C
SNU175	Large intestine	IDH1	2	209110051	209110051	-1	Missense_Mutation	c.512A>G	p.N171S
SNU175	Large intestine	SP110	2	231042289	231042289	-1	Missense_Mutation	c.1555C>T	p.R519C
SNU175	Large intestine	SP110	2	231079668	231079668	-1	Missense_Mutation	c.313C>T	p.R105C
SNU175	Large intestine	HDAC4	2	240024579	240024579	-1	Missense_Mutation	c.2111G>A	p.R704H
SNU175	Large intestine	NCOA1	2	24930413	24930413	1	Missense_Mutation	c.2074C>T	p.R692W
SNU175	Large intestine	NCOA1	2	24975010	24975010	1	Missense_Mutation	c.3866C>T	p.A1289V
SNU175	Large intestine	MSH6	2	48032085	48032086	1	Nonsense_Mutation	c.3475_3476insA	p.Y1159fs
SNU175	Large intestine	SMARCB1	22	24134007	24134007	1	Missense_Mutation	c.158G>A	p.R53Q
SNU175	Large intestine	HDAC3	5	141008779	141008779	-1	Missense_Mutation	c.571T>C	p.S191P
SNU175	Large intestine	NIPBL	5	37006526	37006526	1	Missense_Mutation	c.3923C>T	p.A1308V
SNU175	Large intestine	NIPBL	5	37059192	37059192	1	Missense_Mutation	c.7610C>T	p.A2537V
SNU175	Large intestine	HDAC2	6	114270155	114270155	-1	Missense_Mutation	c.1111C>A	p.L371I
SNU175	Large intestine	JARID2	6	15504761	15504761	1	Nonsense_Mutation	c.2479C>T	p.R827*
SNU175	Large intestine	BRD2	6	32945769	32945769	1	Missense_Mutation	c.1565A>G	p.E522G
SNU175	Large intestine	PHIP	6	79725354	79725354	-1	Missense_Mutation	c.1382T>C	p.V461A
SNU175	Large intestine	PHIP	6	79735761	79735761	-1	Missense_Mutation	c.721G>A	p.A241T
SNU175	Large intestine	KMT2C	7	151874713	151874713	-1	Nonsense_Mutation	c.7825C>T	p.R2609*
SNU175	Large intestine	KMT2C	7	151935866	151935866	-1	Missense_Mutation	c.2578C>T	p.P860S
SNU175	Large intestine	KMT2C	7	152012386	152012386	-1	Frame_Shift_Del	c.427_427delA	p.S143fs
SNU175	Large intestine	TRRAP	7	98592274	98592274	1	Missense_Mutation	c.10070C>T	p.A3357V
SNU175	Large intestine	TRRAP	7	98609124	98609124	1	Missense_Mutation	c.11261C>T	p.A3754V
SNU175	Large intestine	WHSC1L1	8	38162269	38162269	-1	Missense_Mutation	c.2447T>C	p.M816T
SNU175	Large intestine	KAT6A	8	41791132	41791132	-1	Missense_Mutation	c.4606C>T	p.P1536S
SNU175	Large intestine	KAT6A	8	41839358	41839358	-1	Missense_Mutation	c.824C>T	p.A275V
SNU175	Large intestine	BRD3	9	136905376	136905376	-1	Missense_Mutation	c.1423G>A	p.E475K
SNU175	Large intestine	HDAC6	X	48673809	48673809	1	Missense_Mutation	c.1168G>A	p.A390T
SNU175	Large intestine	HDAC6	X	48675790	48675790	1	Missense_Mutation	c.1849G>A	p.A617T
SNU182	Liver	EP400	12	132547088	132547093	1	In_Frame_Del	c.8176_8181delCAACAA	p.QQ2746del
SNU182	Liver	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
SNU1	Stomach	LMNA	1	156106054	156106054	1	Missense_Mutation	c.1207T>C	p.S403P
SNU1	Stomach	ARID1A	1	27101268	27101268	1	Frame_Shift_Del	c.4550_4550delC	p.A1517fs
SNU1	Stomach	ARID1A	1	27105930	27105931	1	Frame_Shift_Ins	c.5541_5542insG	p.G1847fs
SNU1	Stomach	BRDT	1	92428328	92428328	1	Missense_Mutation	c.17G>A	p.R6Q
SNU1	Stomach	BMI1	10	22616692	22616692	1	Missense_Mutation	c.716A>T	p.D239V
SNU1	Stomach	KMT2A	11	118375057	118375057	1	Frame_Shift_Del	c.8450_8450delC	p.T2817fs
SNU1	Stomach	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
SNU1	Stomach	CHD9	16	53263000	53263000	1	Frame_Shift_Del	c.2274_2274delT	p.H758fs
SNU1	Stomach	SUZ12	17	30300171	30300171	1	Missense_Mutation	c.512C>A	p.P171Q
SNU1	Stomach	MLLT6	17	36881841	36881841	1	Frame_Shift_Del	c.3272_3272delA	p.E1091fs
SNU1	Stomach	NIPBL	5	37008134	37008134	1	Frame_Shift_Del	c.4264_4264delT	p.F1422fs
SNU1	Stomach	JARID2	6	15496723	15496723	1	Missense_Mutation	c.1267G>T	p.G423W
SNU1	Stomach	BAG6	6	31607981	31607981	-1	Missense_Mutation	c.3151C>T	p.R1051C
SNU1	Stomach	PHF3	6	64401710	64401710	1	Missense_Mutation	c.2273G>A	p.G758D
SNU1	Stomach	KMT2C	7	151874148	151874149	-1	Frame_Shift_Del	c.8389_8390delAA	p.K2797fs
SNU1	Stomach	TRRAP	7	98527662	98527662	1	Missense_Mutation	c.3226A>G	p.M1076V
SNU1	Stomach	ASH2L	8	37963917	37963917	1	Silent	c.210A>G	p.V70V
SNU1	Stomach	PSIP1	9	15474027	15474029	-1	In_Frame_Del	c.836_838delGAG	p.G279del
SNU1	Stomach	TAF1	X	70598858	70598858	1	Missense_Mutation	c.1397C>T	p.A466V
SNU201	Central nervous system	TP53BP1	15	43748804	43748804	-1	Missense_Mutation	c.2002G>C	p.E668Q
SNU201	Central nervous system	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SNU213	Pancreas	ERCC6	10	50686482	50686482	-1	Missense_Mutation	c.2204G>T	p.R735L
SNU213	Pancreas	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
SNU216	Stomach	TRIM33	1	114976314	114976314	-1	Missense_Mutation	c.965C>T	p.A322V
SNU216	Stomach	ARID1A	1	27101090	27101090	1	Nonsense_Mutation	c.4372C>T	p.Q1458*
SNU216	Stomach	NCOA4	10	51579232	51579232	1	Missense_Mutation	c.139A>G	p.I47V
SNU216	Stomach	NCOA3	20	46279861	46279866	1	In_Frame_Del	c.3787_3792delCAGCAA	p.QQ1275del
SNU216	Stomach	NIPBL	5	37000571	37000571	1	Missense_Mutation	c.3401C>T	p.S1134F
SNU245	Biliary tract	DAXX	6	33288363	33288363	-1	Missense_Mutation	c.1081G>C	p.D361H
SNU283	Large intestine	KMT2C	7	151878974	151878974	-1	Frame_Shift_Del	c.5971_5971delT	p.S1991fs
SNU283	Large intestine	IKZF1	7	50367257	50367257	1	Missense_Mutation	c.64G>A	p.D22N
SNU308	Biliary tract	LMNA	1	156105772	156105772	1	Silent	c.1017G>A	p.A339A
SNU308	Biliary tract	EP400	12	132547088	132547093	1	In_Frame_Del	c.8176_8181delCAACAA	p.QQ2746del
SNU308	Biliary tract	BRD2	6	32948443	32948443	1	Missense_Mutation	c.2459C>G	p.S820C
SNU324	Pancreas	ARID1A	1	27106100	27106100	1	Frame_Shift_Del	c.5711_5711delA	p.E1904fs
SNU324	Pancreas	CHD5	1	6184614	6184614	-1	Missense_Mutation	c.4502T>C	p.L1501P
SNU324	Pancreas	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
SNU324	Pancreas	CHD8	14	21868203	21868203	-1	Missense_Mutation	c.3917A>G	p.Y1306C
SNU324	Pancreas	TP53BP1	15	43699735	43699735	-1	Missense_Mutation	c.5780C>T	p.T1927M
SNU324	Pancreas	KAT7	17	47898741	47898741	1	Missense_Mutation	c.1198C>A	p.R400S
SNU324	Pancreas	HDAC4	2	240024543	240024543	-1	Missense_Mutation	c.2147C>T	p.S716L
SNU324	Pancreas	DNMT3B	20	31393148	31393148	1	Missense_Mutation	c.2236G>A	p.V746M
SNU324	Pancreas	HDAC2	6	114264518	114264518	-1	Frame_Shift_Del	c.1657_1657delA	p.T553fs
SNU324	Pancreas	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
SNU324	Pancreas	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
SNU324	Pancreas	KMT2C	7	151921209	151921209	-1	Nonsense_Mutation	c.3214C>T	p.Q1072*
SNU324	Pancreas	KDM6A	X	44949175	44949175	1	Missense_Mutation	c.3892G>A	p.A1298T
SNU349	Kidney	SETDB1	1	150931776	150931776	1	Missense_Mutation	c.2453G>A	p.R818H
SNU349	Kidney	KMT2A	11	118344633	118344633	1	Missense_Mutation	c.2759A>G	p.D920G
SNU349	Kidney	KDM5A	12	459813	459813	-1	Missense_Mutation	c.1282C>T	p.R428W
SNU349	Kidney	WHSC1	4	1980559	1980559	1	Frame_Shift_Del	c.4021_4021delC	p.P1341fs
SNU349	Kidney	DAXX	6	33287881	33287883	-1	In_Frame_Del	c.1406_1408delAGG	p.E469del
SNU349	Kidney	TRRAP	7	98524893	98524893	1	Missense_Mutation	c.3079A>G	p.M1027V
SNU349	Kidney	TRRAP	7	98524917	98524917	1	Missense_Mutation	c.3103C>T	p.R1035W
SNU387	Liver	ATF2	2	175962302	175962302	-1	Missense_Mutation	c.848C>G	p.T283S
SNU387	Liver	TRRAP	7	98507917	98507917	1	Missense_Mutation	c.1589A>C	p.Q530P
SNU398	Liver	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
SNU407	Large intestine	TRIM33	1	114948107	114948107	-1	Missense_Mutation	c.2693A>T	p.D898V
SNU407	Large intestine	LMNA	1	156106127	156106127	1	Missense_Mutation	c.1280G>A	p.R427H
SNU407	Large intestine	SETD1B	12	122242657	122242658	1	Frame_Shift_Ins	c.14_15insC	p.H5fs
SNU407	Large intestine	CHD8	14	21866056	21866056	-1	Missense_Mutation	c.4140G>T	p.K1380N
SNU407	Large intestine	SUZ12	17	30315375	30315375	1	Missense_Mutation	c.1060A>G	p.T354A
SNU407	Large intestine	SUZ12	17	30315461	30315462	1	Frame_Shift_Del	c.1146_1147delAG	p.S382fs
SNU407	Large intestine	SMARCA4	19	11105603	11105603	1	Missense_Mutation	c.1519T>C	p.Y507H
SNU407	Large intestine	SMARCA4	19	11138569	11138569	1	Missense_Mutation	c.3325A>G	p.M1109V
SNU407	Large intestine	TFPT	19	54617881	54617881	-1	Missense_Mutation	c.223C>T	p.R75W
SNU407	Large intestine	SP140	2	231159025	231159025	1	Frame_Shift_Del	c.2008_2008delA	p.K670fs
SNU407	Large intestine	NCOA1	2	24933951	24933951	1	Missense_Mutation	c.2570C>T	p.A857V
SNU407	Large intestine	EP300	22	41513638	41513638	1	Missense_Mutation	c.542G>T	p.G181V
SNU407	Large intestine	WHSC1	4	1952820	1952820	1	Missense_Mutation	c.1903G>A	p.E635K
SNU407	Large intestine	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
SNU407	Large intestine	WHSC1	4	1961204	1961204	1	Missense_Mutation	c.2992A>G	p.K998E
SNU407	Large intestine	WHSC1	4	1962781	1962781	1	Missense_Mutation	c.3275A>G	p.Y1092C
SNU407	Large intestine	KMT2C	7	151845192	151845192	-1	Missense_Mutation	c.13820G>T	p.G4607V
SNU407	Large intestine	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
SNU407	Large intestine	TRRAP	7	98506367	98506367	1	Missense_Mutation	c.1132A>G	p.T378A
SNU407	Large intestine	KAT6A	8	41791423	41791423	-1	Missense_Mutation	c.4315C>T	p.H1439Y
SNU407	Large intestine	KAT6A	8	41791563	41791563	-1	Missense_Mutation	c.4175C>A	p.S1392Y
SNU407	Large intestine	TAF1L	9	32631824	32631824	-1	Missense_Mutation	c.3754C>T	p.R1252W
SNU407	Large intestine	TAF1L	9	32633002	32633002	-1	Missense_Mutation	c.2576G>A	p.S859N
SNU407	Large intestine	TAF1L	9	32633671	32633671	-1	Missense_Mutation	c.1907G>A	p.R636H
SNU407	Large intestine	TAF1	X	70621393	70621393	1	Missense_Mutation	c.3862T>C	p.C1288R
SNU407	Large intestine	ATRX	X	76937241	76937243	-1	In_Frame_Del	c.3505_3507delAAG	p.K1169del
SNU410	Pancreas	TDG	12	104373728	104373729	1	Frame_Shift_Ins	c.286_287insA	p.E96fs
SNU410	Pancreas	KMT2C	7	151859354	151859354	-1	Missense_Mutation	c.11308G>A	p.G3770R
SNU410	Pancreas	KAT6A	8	41798814	41798814	-1	Missense_Mutation	c.2585C>T	p.P862L
SNU410	Pancreas	NCOA2	8	71068402	71068402	-1	Missense_Mutation	c.2198A>T	p.E733V
SNU423	Liver	ARID1A	1	27059230	27059230	1	Nonsense_Mutation	c.1867G>T	p.G623*
SNU423	Liver	KDM5A	12	431713	431713	-1	Missense_Mutation	c.2296A>T	p.M766L
SNU449	Liver	ARID1A	1	27100181	27100182	1	In_Frame_Ins	c.3977_3978insGCA	p.1334_1335insQ
SNU449	Liver	ARID1A	1	27107135	27107136	1	Frame_Shift_Ins	c.6746_6747insA	p.S2249fs
SNU449	Liver	HNF1A	12	121434456	121434456	1	Missense_Mutation	c.1220C>T	p.S407L
SNU466	Central nervous system	KMT2C	7	151877190	151877190	-1	Missense_Mutation	c.7171A>G	p.I2391V
SNU466	Central nervous system	TAF1L	9	32634430	32634430	-1	Missense_Mutation	c.1148A>G	p.Y383C
SNU46	Upper aerodigestive tract	TET1	10	70332127	70332127	1	Missense_Mutation	c.32G>C	p.R11T
SNU46	Upper aerodigestive tract	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
SNU46	Upper aerodigestive tract	HDAC3	5	141004803	141004803	-1	Nonsense_Mutation	c.1189G>T	p.E397*
SNU46	Upper aerodigestive tract	KMT2C	7	151848636	151848636	-1	Missense_Mutation	c.12557G>A	p.G4186D
SNU475	Liver	TET1	10	70404467	70404467	1	Missense_Mutation	c.1981A>C	p.N661H
SNU475	Liver	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
SNU478	Biliary tract	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
SNU478	Biliary tract	NSD1	5	176722221	176722221	1	Missense_Mutation	c.7852G>A	p.V2618I
SNU489	Central nervous system	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
SNU503	Large intestine	KDM5A	12	498170	498170	-1	Missense_Mutation	c.88A>G	p.T30A
SNU503	Large intestine	MSH6	2	48033981	48033982	1	Frame_Shift_Ins	c.4065_4066insTTGA	p.T1355fs
SNU503	Large intestine	KMT2C	7	151860373	151860374	-1	Missense_Mutation	c.10288_10289GA>TT	p.E3430L
SNU520	Stomach	KDM5A	12	438026	438026	-1	Missense_Mutation	c.1943G>A	p.R648Q
SNU520	Stomach	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
SNU520	Stomach	TP53BP1	15	43699718	43699718	-1	Missense_Mutation	c.5797G>T	p.A1933S
SNU520	Stomach	TP53BP1	15	43749143	43749143	-1	Missense_Mutation	c.1663C>G	p.P555A
SNU520	Stomach	CREBBP	16	3832780	3832780	-1	Missense_Mutation	c.1478T>C	p.M493T
SNU520	Stomach	CHD9	16	53301389	53301389	1	Silent	c.4504C>T	p.L1502L
SNU520	Stomach	HDAC4	2	240002823	240002823	-1	Frame_Shift_Del	c.2703_2703delC	p.P901fs
SNU520	Stomach	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
SNU520	Stomach	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
SNU520	Stomach	EP300	22	41523720	41523720	1	Missense_Mutation	c.1136T>C	p.M379T
SNU520	Stomach	WHSC1	4	1980559	1980559	1	Frame_Shift_Del	c.4021_4021delC	p.P1341fs
SNU520	Stomach	NIPBL	5	36985083	36985084	1	Frame_Shift_Del	c.1801_1802delAA	p.K601fs
SNU520	Stomach	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
SNU520	Stomach	KMT2C	7	152012356	152012356	-1	Missense_Mutation	c.457T>G	p.F153V
SNU520	Stomach	KAT6A	8	41801431	41801431	-1	Missense_Mutation	c.2063G>A	p.R688H
SNU520	Stomach	KDM6A	X	44949994	44949994	1	Missense_Mutation	c.3919C>T	p.R1307W
SNU520	Stomach	HDAC6	X	48682691	48682691	1	Missense_Mutation	c.3566A>G	p.Y1189C
SNU520	Stomach	TAF1	X	70608152	70608152	1	Frame_Shift_Del	c.2553_2553delA	p.I851fs
SNU520	Stomach	ATRX	X	76778785	76778787	-1	In_Frame_Del	c.6792_6794delAGA	p.2264_2265EE>E
SNU5	Stomach	IDH2	15	90628112	90628112	-1	Missense_Mutation	c.1207G>T	p.V403L
SNU5	Stomach	MSH6	2	48033981	48033982	1	Frame_Shift_Ins	c.4065_4066insTTGA	p.T1355fs
SNU5	Stomach	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SNU601	Stomach	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SNU601	Stomach	CHD9	16	53289542	53289542	1	Missense_Mutation	c.4060G>A	p.D1354N
SNU601	Stomach	EP300	22	41568518	41568518	1	Missense_Mutation	c.4468G>C	p.A1490P
SNU601	Stomach	KMT2C	7	151932927	151932928	-1	Missense_Mutation	c.2743_2744GG>TT	p.G915L
SNU601	Stomach	NCOA2	8	71056879	71056879	-1	Missense_Mutation	c.2810C>A	p.T937K
SNU620	Stomach	SETDB1	1	150915361	150915361	1	Missense_Mutation	c.707A>G	p.N236S
SNU620	Stomach	ERCC6	10	50667028	50667028	-1	Missense_Mutation	c.4315G>C	p.A1439P
SNU620	Stomach	KDM5A	12	427530	427530	-1	Missense_Mutation	c.2639T>C	p.M880T
SNU620	Stomach	NCOA2	8	71044205	71044205	-1	Missense_Mutation	c.3191T>C	p.L1064P
SNU620	Stomach	TAF1L	9	32632748	32632748	-1	Missense_Mutation	c.2830G>A	p.D944N
SNU620	Stomach	HDAC6	X	48666465	48666465	1	Missense_Mutation	c.658A>G	p.S220G
SNU626	Central nervous system	ZMYM2	13	20600757	20600757	1	Silent	c.1590T>C	p.Y530Y
SNU668	Stomach	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SNU668	Stomach	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
SNU685	Endometrium	ZMYM2	13	20567463	20567463	1	Missense_Mutation	c.251T>C	p.F84S
SNU685	Endometrium	SET	9	131456213	131456214	1	In_Frame_Ins	c.741_742insGAT	p.252_253insD
SNU685	Endometrium	TAF1	X	70613299	70613299	1	Missense_Mutation	c.3260G>T	p.C1087F
SNU719	Stomach	KMT2A	11	118354961	118354961	1	Missense_Mutation	c.4150T>C	p.S1384P
SNU719	Stomach	MGA	15	42059339	42059339	1	Missense_Mutation	c.9059A>C	p.K3020T
SNU719	Stomach	NCOA1	2	24896269	24896269	1	Silent	c.291A>G	p.S97S
SNU719	Stomach	MSH6	2	48026196	48026196	1	Missense_Mutation	c.1074C>G	p.D358E
SNU719	Stomach	EP300	22	41513302	41513302	1	Missense_Mutation	c.206G>T	p.G69V
SNU719	Stomach	NIPBL	5	37044795	37044795	1	Missense_Mutation	c.6307T>G	p.F2103V
SNU738	Central nervous system	SMARCA4	19	11134267	11134267	1	Missense_Mutation	c.2933G>T	p.R978L
SNU738	Central nervous system	TRRAP	7	98534830	98534830	1	Missense_Mutation	c.4163C>T	p.A1388V
SNU761	Liver	ARID1A	1	27099311	27099311	1	Missense_Mutation	c.3548A>G	p.N1183S
SNU761	Liver	EP300	22	41536149	41536149	1	Missense_Mutation	c.1766A>G	p.Q589R
SNU81	Large intestine	ARID1A	1	27106582	27106582	1	Missense_Mutation	c.6193G>A	p.A2065T
SNU81	Large intestine	HDAC1	1	32798310	32798310	1	Missense_Mutation	c.1381G>A	p.E461K
SNU81	Large intestine	PRDM16	1	3328769	3328769	1	Missense_Mutation	c.2008T>C	p.S670P
SNU81	Large intestine	CHD5	1	6228223	6228223	-1	Missense_Mutation	c.194G>A	p.R65Q
SNU81	Large intestine	CHD5	1	6228233	6228233	-1	Missense_Mutation	c.184A>G	p.K62E
SNU81	Large intestine	SIRT1	10	69648805	69648805	1	Missense_Mutation	c.713A>C	p.K238T
SNU81	Large intestine	SIRT1	10	69676280	69676280	1	Missense_Mutation	c.2174A>G	p.E725G
SNU81	Large intestine	TET1	10	70333068	70333068	1	Missense_Mutation	c.973T>C	p.S325P
SNU81	Large intestine	TET1	10	70446192	70446192	1	Missense_Mutation	c.5132A>G	p.Y1711C
SNU81	Large intestine	TET1	10	70451546	70451546	1	Missense_Mutation	c.6386C>T	p.A2129V
SNU81	Large intestine	KMT2A	11	118344623	118344623	1	Missense_Mutation	c.2749G>A	p.V917I
SNU81	Large intestine	KDM5A	12	402323	402323	-1	Nonsense_Mutation	c.4468G>T	p.E1490*
SNU81	Large intestine	KDM5A	12	404944	404944	-1	Missense_Mutation	c.4250G>T	p.R1417M
SNU81	Large intestine	KDM5A	12	431664	431664	-1	Missense_Mutation	c.2345G>A	p.R782Q
SNU81	Large intestine	CHD8	14	21869062	21869062	-1	Missense_Mutation	c.3505C>T	p.R1169W
SNU81	Large intestine	MGA	15	41961999	41961999	1	Missense_Mutation	c.907C>A	p.Q303K
SNU81	Large intestine	MGA	15	42005666	42005666	1	Missense_Mutation	c.3402G>T	p.E1134D
SNU81	Large intestine	MGA	15	42050033	42050033	1	Missense_Mutation	c.7187G>A	p.R2396Q
SNU81	Large intestine	TP53BP1	15	43699699	43699699	-1	Missense_Mutation	c.5816C>T	p.A1939V
SNU81	Large intestine	TP53BP1	15	43738624	43738624	-1	Missense_Mutation	c.3001A>G	p.T1001A
SNU81	Large intestine	CREBBP	16	3788617	3788617	-1	Missense_Mutation	c.4337G>A	p.R1446H
SNU81	Large intestine	CHD9	16	53190756	53190756	1	Missense_Mutation	c.755T>G	p.F252C
SNU81	Large intestine	CHD9	16	53337880	53337880	1	Missense_Mutation	c.5962C>T	p.R1988C
SNU81	Large intestine	KAT7	17	47875720	47875720	1	Missense_Mutation	c.380G>A	p.R127Q
SNU81	Large intestine	KAT7	17	47900569	47900569	1	Missense_Mutation	c.1392G>T	p.K464N
SNU81	Large intestine	SMARCA4	19	11105651	11105651	1	Missense_Mutation	c.1567G>A	p.E523K
SNU81	Large intestine	SP110	2	231065661	231065661	-1	Nonsense_Mutation	c.1069G>T	p.E357*
SNU81	Large intestine	SP110	2	231074722	231074722	-1	Missense_Mutation	c.753G>T	p.E251D
SNU81	Large intestine	MSH6	2	48027887	48027887	1	Missense_Mutation	c.2765G>A	p.R922Q
SNU81	Large intestine	MSH6	2	48027964	48027964	1	Nonsense_Mutation	c.2842G>T	p.E948*
SNU81	Large intestine	DNMT3B	20	31389107	31389107	1	Missense_Mutation	c.2020G>A	p.E674K
SNU81	Large intestine	DNMT3B	20	31395628	31395628	1	Missense_Mutation	c.2481G>T	p.Q827H
SNU81	Large intestine	NCOA3	20	46268399	46268399	1	Missense_Mutation	c.2786G>T	p.R929I
SNU81	Large intestine	EP300	22	41537100	41537100	1	Nonsense_Mutation	c.1927G>T	p.E643*
SNU81	Large intestine	EP300	22	41558740	41558740	1	Nonsense_Mutation	c.3685G>T	p.E1229*
SNU81	Large intestine	EP300	22	41558756	41558756	1	Missense_Mutation	c.3701G>T	p.R1234I
SNU81	Large intestine	TET2	4	106155928	106155928	1	Missense_Mutation	c.892G>A	p.A298T
SNU81	Large intestine	WHSC1	4	1955072	1955072	1	Missense_Mutation	c.2159G>C	p.C720S
SNU81	Large intestine	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
SNU81	Large intestine	NSD1	5	176687037	176687037	1	Missense_Mutation	c.5014G>T	p.D1672Y
SNU81	Large intestine	NIPBL	5	36976018	36976018	1	Nonsense_Mutation	c.1009G>T	p.E337*
SNU81	Large intestine	NIPBL	5	36986329	36986329	1	Missense_Mutation	c.3047T>G	p.L1016R
SNU81	Large intestine	NIPBL	5	37064738	37064738	1	Missense_Mutation	c.8159A>G	p.D2720G
SNU81	Large intestine	CHD1	5	98193950	98193950	-1	Missense_Mutation	c.4721G>T	p.R1574I
SNU81	Large intestine	CHD1	5	98218811	98218811	-1	Missense_Mutation	c.2699G>A	p.R900Q
SNU81	Large intestine	HDAC2	6	114264668	114264668	-1	Nonsense_Mutation	c.1507C>T	p.R503*
SNU81	Large intestine	JARID2	6	15452403	15452403	1	Nonsense_Mutation	c.490C>T	p.R164*
SNU81	Large intestine	PHF3	6	64395419	64395419	1	Missense_Mutation	c.1796A>C	p.K599T
SNU81	Large intestine	TRIM24	7	138269595	138269595	1	Nonsense_Mutation	c.3052G>T	p.E1018*
SNU81	Large intestine	KMT2C	7	151860908	151860908	-1	Missense_Mutation	c.9754C>A	p.R3252S
SNU81	Large intestine	TRRAP	7	98547771	98547771	1	Missense_Mutation	c.5199A>T	p.K1733N
SNU81	Large intestine	WHSC1L1	8	38187206	38187206	-1	Missense_Mutation	c.1271C>A	p.S424Y
SNU81	Large intestine	KAT6A	8	41801290	41801290	-1	Missense_Mutation	c.2204G>T	p.R735L
SNU81	Large intestine	KAT6A	8	41801318	41801318	-1	Missense_Mutation	c.2176G>T	p.D726Y
SNU81	Large intestine	NCOA2	8	71044086	71044086	-1	Missense_Mutation	c.3310G>A	p.E1104K
SNU81	Large intestine	NCOA2	8	71126266	71126266	-1	Missense_Mutation	c.131A>C	p.K44T
SNU81	Large intestine	BRD3	9	136905367	136905367	-1	Missense_Mutation	c.1432G>A	p.A478T
SNU81	Large intestine	ATRX	X	76938462	76938462	-1	Missense_Mutation	c.2286G>T	p.K762N
SNU840	Ovary	KAT6B	10	76735279	76735279	1	Missense_Mutation	c.1184C>T	p.S395L
SNU840	Ovary	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
SNU869	Biliary tract	CREBBP	16	3778479	3778479	-1	Missense_Mutation	c.6569G>A	p.R2190Q
SNU869	Biliary tract	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
SNU869	Biliary tract	TRRAP	7	98547146	98547146	1	Missense_Mutation	c.4874G>T	p.R1625L
SNU878	Liver	SETDB1	1	150923536	150923536	1	Missense_Mutation	c.2183G>T	p.G728V
SNU878	Liver	ZMYM2	13	20635364	20635364	1	Missense_Mutation	c.2911A>G	p.S971G
SNU878	Liver	TFPT	19	54610388	54610388	-1	Missense_Mutation	c.731A>G	p.Y244C
SNU878	Liver	SMARCB1	22	24143309	24143309	1	Intron	c.514G>A	p.A172T
SNU886	Liver	TET1	10	70333443	70333443	1	Missense_Mutation	c.1348C>G	p.P450A
SNU886	Liver	DNMT1	19	10291061	10291061	-1	Missense_Mutation	c.410C>G	p.T137R
SNU886	Liver	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SNU886	Liver	WHSC1	4	1957868	1957869	1	Frame_Shift_Ins	c.2834_2835insC	p.G945fs
SNU886	Liver	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
SNU899	Upper aerodigestive tract	ARID4B	1	235377279	235377281	-1	In_Frame_Del	c.1644_1646delGGA	p.548_549EE>E
SNU899	Upper aerodigestive tract	SP140	2	231149115	231149115	1	Missense_Mutation	c.1553G>A	p.S518N
SNU899	Upper aerodigestive tract	NSD1	5	176720888	176720890	1	In_Frame_Del	c.6519_6521delCTT	p.F2174del
SNU899	Upper aerodigestive tract	KDM6A	X	44929163	44929163	1	Missense_Mutation	c.2419A>G	p.T807A
SNU8	Ovary	TFPT	19	54611376	54611376	-1	Missense_Mutation	c.599G>A	p.R200H
SNUC2A	Large intestine	ARID1A	1	27101509	27101509	1	Silent	c.4791C>T	p.N1597N
SNUC2A	Large intestine	PRDM16	1	3328266	3328266	1	Missense_Mutation	c.1505C>T	p.T502M
SNUC2A	Large intestine	PRDM16	1	3334509	3334509	1	Missense_Mutation	c.2809C>G	p.P937A
SNUC2A	Large intestine	MLLT10	10	21903760	21903760	1	Splice_Region	c.510C>T	p.C170C
SNUC2A	Large intestine	ERCC6	10	50691549	50691549	-1	Missense_Mutation	c.1835G>A	p.R612Q
SNUC2A	Large intestine	KAT6B	10	76744938	76744938	1	Frame_Shift_Del	c.2474_2474delT	p.L825fs
SNUC2A	Large intestine	KMT2A	11	118343306	118343306	1	Nonsense_Mutation	c.1432C>T	p.R478*
SNUC2A	Large intestine	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SNUC2A	Large intestine	YY1	14	100705708	100705710	1	In_Frame_Del	c.127_129delGAG	p.E47del
SNUC2A	Large intestine	CHD8	14	21861813	21861813	-1	Frame_Shift_Del	c.5304_5304delC	p.P1768fs
SNUC2A	Large intestine	MGA	15	42052632	42052632	1	Missense_Mutation	c.7303C>T	p.R2435W
SNUC2A	Large intestine	MGA	15	42053971	42053971	1	Missense_Mutation	c.7433C>T	p.A2478V
SNUC2A	Large intestine	CREBBP	16	3900479	3900479	-1	Missense_Mutation	c.617C>T	p.A206V
SNUC2A	Large intestine	CHD9	16	53337697	53337697	1	Missense_Mutation	c.5779C>T	p.R1927C
SNUC2A	Large intestine	CHD9	16	53340227	53340228	1	Frame_Shift_Ins	c.6698_6699insT	p.S2233fs
SNUC2A	Large intestine	MLLT6	17	36872044	36872044	1	Silent	c.999C>T	p.S333S
SNUC2A	Large intestine	SMARCA4	19	11143976	11143976	1	Missense_Mutation	c.3557C>T	p.A1186V
SNUC2A	Large intestine	TRIM28	19	59059764	59059764	1	Missense_Mutation	c.1205C>T	p.A402V
SNUC2A	Large intestine	TRIM28	19	59061557	59061557	1	Missense_Mutation	c.2237G>A	p.R746H
SNUC2A	Large intestine	IDH1	2	209116263	209116263	-1	Frame_Shift_Del	c.13_13delA	p.I5fs
SNUC2A	Large intestine	SP140	2	231102961	231102961	1	Missense_Mutation	c.271G>A	p.V91M
SNUC2A	Large intestine	NCOA1	2	24952626	24952626	1	Missense_Mutation	c.3143C>T	p.P1048L
SNUC2A	Large intestine	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
SNUC2A	Large intestine	DNMT3B	20	31386388	31386388	1	Missense_Mutation	c.1613G>A	p.R538H
SNUC2A	Large intestine	TET2	4	106156196	106156196	1	Missense_Mutation	c.1160G>T	p.S387I
SNUC2A	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
SNUC2A	Large intestine	NIPBL	5	37064899	37064899	1	Frame_Shift_Del	c.8320_8320delA	p.K2774fs
SNUC2A	Large intestine	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
SNUC2A	Large intestine	JARID2	6	15468851	15468851	1	Missense_Mutation	c.572A>G	p.E191G
SNUC2A	Large intestine	BRD2	6	32944387	32944387	1	Missense_Mutation	c.874G>A	p.A292T
SNUC2A	Large intestine	PHF3	6	64410321	64410321	1	Nonsense_Mutation	c.3064G>T	p.E1022*
SNUC2A	Large intestine	TRIM24	7	138265390	138265390	1	Frame_Shift_Del	c.2669_2669delA	p.E890fs
SNUC2A	Large intestine	KMT2C	7	151874147	151874148	-1	Frame_Shift_Ins	c.8390_8391insA	p.K2797fs
SNUC2A	Large intestine	KMT2C	7	151945346	151945346	-1	Missense_Mutation	c.2173G>A	p.E725K
SNUC2A	Large intestine	KMT2C	7	151962157	151962157	-1	Nonsense_Mutation	c.1150C>T	p.Q384*
SNUC2A	Large intestine	TRRAP	7	98528268	98528268	1	Missense_Mutation	c.3406C>T	p.P1136S
SNUC2A	Large intestine	TRRAP	7	98609058	98609058	1	Missense_Mutation	c.11195C>T	p.T3732M
SNUC2A	Large intestine	WHSC1L1	8	38146945	38146945	-1	Frame_Shift_Del	c.3197_3197delA	p.N1066fs
SNUC2A	Large intestine	KAT6A	8	41791311	41791311	-1	Missense_Mutation	c.4427C>T	p.A1476V
SNUC2A	Large intestine	NCOA2	8	71044119	71044119	-1	Missense_Mutation	c.3277C>A	p.L1093M
SNUC2A	Large intestine	NCOA2	8	71053503	71053503	-1	Missense_Mutation	c.2944C>T	p.R982W
SNUC2A	Large intestine	BRD3	9	136918529	136918530	-1	Frame_Shift_Del	c.70_71delCC	p.P24fs
SNUC2A	Large intestine	TAF1L	9	32630960	32630960	-1	Missense_Mutation	c.4618G>A	p.A1540T
SNUC2A	Large intestine	TAF1L	9	32633584	32633584	-1	Frame_Shift_Del	c.1994_1994delA	p.K665fs
SNUC2A	Large intestine	KDM6A	X	44870215	44870215	1	Frame_Shift_Del	c.394_394delT	p.F132fs
SNUC2A	Large intestine	KDM6A	X	44945195	44945196	1	Frame_Shift_Ins	c.3675_3676insT	p.Y1225fs
SNUC2A	Large intestine	HDAC6	X	48674388	48674388	1	Nonsense_Mutation	c.1422G>A	p.W474*
SNUC2A	Large intestine	TAF1	X	70617286	70617286	1	Missense_Mutation	c.3650G>A	p.R1217H
SNUC2A	Large intestine	ATRX	X	76763887	76763887	-1	Missense_Mutation	c.7421G>A	p.R2474H
SNUC2A	Large intestine	ATRX	X	76938748	76938748	-1	Missense_Mutation	c.2000C>T	p.P667L
SNUC4	Large intestine	LMNA	1	156106818	156106818	1	Missense_Mutation	c.1487C>T	p.T496M
SNUC4	Large intestine	LMNA	1	156108877	156108877	1	Nonsense_Mutation	c.1975C>T	p.Q659*
SNUC4	Large intestine	ARID1A	1	27099937	27099937	1	Silent	c.3816G>A	p.A1272A
SNUC4	Large intestine	KDM5A	12	416952	416953	-1	Frame_Shift_Ins	c.3597_3598insA	p.K1199fs
SNUC4	Large intestine	ING1	13	111368275	111368275	1	Missense_Mutation	c.485G>C	p.R162P
SNUC4	Large intestine	CHD8	14	21859176	21859176	-1	Frame_Shift_Del	c.6275_6275delA	p.N2092fs
SNUC4	Large intestine	CHD8	14	21862588	21862588	-1	Missense_Mutation	c.4610A>G	p.E1537G
SNUC4	Large intestine	CHD8	14	21871652	21871653	-1	Missense_Mutation	c.2640_2641GC>AT	p.R881C
SNUC4	Large intestine	CHD8	14	21896142	21896142	-1	Missense_Mutation	c.650A>G	p.E217G
SNUC4	Large intestine	MGA	15	42046720	42046720	1	Missense_Mutation	c.7094C>A	p.A2365D
SNUC4	Large intestine	CHD9	16	53243678	53243679	1	Frame_Shift_Ins	c.1737_1738insA	p.S579fs
SNUC4	Large intestine	CHD9	16	53263000	53263000	1	Frame_Shift_Del	c.2274_2274delT	p.H758fs
SNUC4	Large intestine	CHD9	16	53276755	53276755	1	Missense_Mutation	c.2881C>T	p.R961C
SNUC4	Large intestine	MLLT6	17	36871867	36871869	1	In_Frame_Del	c.822_824delCTC	p.S277del
SNUC4	Large intestine	MLLT6	17	36872036	36872038	1	In_Frame_Del	c.991_993delTCC	p.S338del
SNUC4	Large intestine	IDH1	2	209108185	209108185	-1	Missense_Mutation	c.664C>T	p.R222C
SNUC4	Large intestine	MSH6	2	48027436	48027436	1	Missense_Mutation	c.2314C>T	p.R772W
SNUC4	Large intestine	MSH6	2	48030640	48030640	1	Frame_Shift_Del	c.3254_3254delC	p.T1085fs
SNUC4	Large intestine	WHSC1	4	1957716	1957716	1	Nonsense_Mutation	c.2682G>A	p.W894*
SNUC4	Large intestine	NSD1	5	176638458	176638458	1	Missense_Mutation	c.3058A>G	p.N1020D
SNUC4	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
SNUC4	Large intestine	CHD1	5	98235340	98235340	-1	Frame_Shift_Del	c.929_929delA	p.N310fs
SNUC4	Large intestine	HDAC2	6	114292110	114292112	-1	5'UTR	c.243_245delCAG	p.S81del
SNUC4	Large intestine	PHF3	6	64415953	64415953	1	Frame_Shift_Del	c.3402_3402delA	p.P1134fs
SNUC4	Large intestine	TRIM24	7	138239670	138239670	1	Missense_Mutation	c.1489A>G	p.R497G
SNUC4	Large intestine	KMT2C	7	151874148	151874149	-1	Frame_Shift_Del	c.8389_8390delAA	p.K2797fs
SNUC4	Large intestine	TRRAP	7	98559095	98559095	1	Missense_Mutation	c.6680C>A	p.P2227Q
SNUC4	Large intestine	TRRAP	7	98574585	98574585	1	Missense_Mutation	c.8250G>C	p.E2750D
SNUC4	Large intestine	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
SNUC5	Large intestine	ARID1A	1	27088682	27088682	1	Frame_Shift_Del	c.2291_2291delC	p.S764fs
SNUC5	Large intestine	PRDM16	1	3342671	3342671	1	Missense_Mutation	c.3166A>T	p.T1056S
SNUC5	Large intestine	MEN1	11	64572610	64572610	-1	Missense_Mutation	c.1261T>C	p.F421L
SNUC5	Large intestine	MEN1	11	64575565	64575565	-1	Missense_Mutation	c.467A>T	p.K156I
SNUC5	Large intestine	HNF1A	12	121432118	121432118	1	Frame_Shift_Del	c.865_865delC	p.P289fs
SNUC5	Large intestine	KDM5A	12	416952	416953	-1	Frame_Shift_Ins	c.3597_3598insA	p.K1199fs
SNUC5	Large intestine	ZMYM2	13	20638677	20638677	1	Frame_Shift_Del	c.3124_3124delA	p.K1042fs
SNUC5	Large intestine	MGA	15	41991274	41991274	1	Missense_Mutation	c.2105G>A	p.R702K
SNUC5	Large intestine	CREBBP	16	3786045	3786045	-1	Missense_Mutation	c.4720A>G	p.T1574A
SNUC5	Large intestine	CREBBP	16	3807860	3807860	-1	Nonsense_Mutation	c.3559C>T	p.Q1187*
SNUC5	Large intestine	CHD9	16	53289656	53289656	1	Missense_Mutation	c.4174A>G	p.I1392V
SNUC5	Large intestine	EP300	22	41553195	41553196	1	Frame_Shift_Ins	c.3284_3285insC	p.S1095fs
SNUC5	Large intestine	EP300	22	41566436	41566436	1	Missense_Mutation	c.4313G>A	p.C1438Y
SNUC5	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
SNUC5	Large intestine	NIPBL	5	37006585	37006585	1	Missense_Mutation	c.3982T>C	p.Y1328H
SNUC5	Large intestine	CHD1	5	98194688	98194688	-1	Missense_Mutation	c.4556C>G	p.P1519R
SNUC5	Large intestine	CHD1	5	98228382	98228382	-1	Missense_Mutation	c.2027G>A	p.G676D
SNUC5	Large intestine	JARID2	6	15468839	15468839	1	Missense_Mutation	c.560A>C	p.E187A
SNUC5	Large intestine	PHIP	6	79655085	79655085	-1	Missense_Mutation	c.4760G>A	p.R1587H
SNUC5	Large intestine	KMT2C	7	151879235	151879235	-1	Missense_Mutation	c.5710A>G	p.T1904A
SNUC5	Large intestine	KMT2C	7	151949174	151949174	-1	Missense_Mutation	c.1471T>C	p.W491R
SNUC5	Large intestine	IKZF1	7	50455151	50455151	1	Missense_Mutation	c.698C>T	p.P233L
SNUC5	Large intestine	TRRAP	7	98495436	98495436	1	Missense_Mutation	c.580A>G	p.T194A
SNUC5	Large intestine	TRRAP	7	98522741	98522741	1	Missense_Mutation	c.2830G>A	p.E944K
SNUC5	Large intestine	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
SNUC5	Large intestine	PSIP1	9	15486026	15486026	-1	Missense_Mutation	c.434C>T	p.A145V
SQ1	Lung	KMT2A	11	118375062	118375062	1	Missense_Mutation	c.8455T>C	p.S2819P
SQ1	Lung	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SQ1	Lung	MGA	15	42058861	42058861	1	Missense_Mutation	c.8581C>T	p.R2861W
SQ1	Lung	BRD4	19	15374344	15374344	-1	Missense_Mutation	c.1228C>T	p.R410C
SQ1	Lung	NCOA1	2	24929814	24929814	1	Missense_Mutation	c.1475A>T	p.Q492L
SQ1	Lung	TRRAP	7	98491430	98491430	1	Nonsense_Mutation	c.376G>T	p.E126*
SR786	Haematopoietic and lymphoid tissue	MLLT10	10	21901327	21901327	1	Silent	c.456T>G	p.G152G
SR786	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
SR786	Haematopoietic and lymphoid tissue	MGA	15	42003468	42003468	1	Missense_Mutation	c.3005C>A	p.A1002E
SR786	Haematopoietic and lymphoid tissue	CREBBP	16	3820669	3820669	-1	Missense_Mutation	c.2782C>G	p.P928A
SR786	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SR786	Haematopoietic and lymphoid tissue	TRRAP	7	98574280	98574280	1	Missense_Mutation	c.8113C>T	p.R2705W
SR786	Haematopoietic and lymphoid tissue	TAF1L	9	32635187	32635187	-1	Missense_Mutation	c.391C>A	p.Q131K
ST486	Haematopoietic and lymphoid tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
ST486	Haematopoietic and lymphoid tissue	CHD9	16	53261320	53261320	1	Nonsense_Mutation	c.2056G>T	p.E686*
SU8686	Pancreas	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
SUDHL10	Haematopoietic and lymphoid tissue	KAT6B	10	76784719	76784719	1	Missense_Mutation	c.3376C>A	p.P1126T
SUDHL10	Haematopoietic and lymphoid tissue	CHD8	14	21868659	21868659	-1	Missense_Mutation	c.3646C>T	p.R1216C
SUDHL10	Haematopoietic and lymphoid tissue	EP300	22	41525969	41525969	1	Missense_Mutation	c.1244T>C	p.L415P
SUDHL1	Haematopoietic and lymphoid tissue	TP53BP1	15	43773116	43773116	-1	Missense_Mutation	c.476C>T	p.T159I
SUDHL1	Haematopoietic and lymphoid tissue	HDAC4	2	239976454	239976454	-1	Missense_Mutation	c.3064G>A	p.E1022K
SUDHL1	Haematopoietic and lymphoid tissue	DNMT3B	20	31383319	31383319	1	Missense_Mutation	c.1231G>A	p.G411R
SUDHL1	Haematopoietic and lymphoid tissue	DNMT3B	20	31387102	31387102	1	Missense_Mutation	c.1727G>A	p.R576Q
SUDHL1	Haematopoietic and lymphoid tissue	TRRAP	7	98548536	98548536	1	Missense_Mutation	c.5351G>A	p.S1784N
SUDHL4	Haematopoietic and lymphoid tissue	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
SUDHL4	Haematopoietic and lymphoid tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SUDHL4	Haematopoietic and lymphoid tissue	TRRAP	7	98575906	98575906	1	Missense_Mutation	c.8437A>G	p.I2813V
SUDHL5	Haematopoietic and lymphoid tissue	ARID1A	1	27023425	27023425	1	Missense_Mutation	c.531A>T	p.Q177H
SUDHL5	Haematopoietic and lymphoid tissue	ARID1A	1	27023747	27023747	1	Nonsense_Mutation	c.853G>T	p.G285*
SUDHL5	Haematopoietic and lymphoid tissue	JARID2	6	15520402	15520402	1	Missense_Mutation	c.3661C>T	p.R1221C
SUDHL6	Haematopoietic and lymphoid tissue	CREBBP	16	3832849	3832849	-1	Frame_Shift_Del	c.1409_1409delT	p.L470fs
SUDHL6	Haematopoietic and lymphoid tissue	EP300	22	41572350	41572350	1	Missense_Mutation	c.4879C>T	p.R1627W
SUDHL6	Haematopoietic and lymphoid tissue	WHSC1	4	1919914	1919914	1	Missense_Mutation	c.974G>A	p.G325D
SUDHL8	Haematopoietic and lymphoid tissue	CREBBP	16	3788634	3788634	-1	Missense_Mutation	c.4320C>A	p.F1440L
SUDHL8	Haematopoietic and lymphoid tissue	EP300	22	41574815	41574815	1	Missense_Mutation	c.7100C>T	p.P2367L
SUPB15	Haematopoietic and lymphoid tissue	CHD9	16	53338483	53338488	1	In_Frame_Del	c.6565_6570delTCTTCA	p.SS2191del
SUPB15	Haematopoietic and lymphoid tissue	TAF1	X	70587371	70587371	1	Missense_Mutation	c.203G>A	p.G68D
SUPHD1	Haematopoietic and lymphoid tissue	CREBBP	16	3823847	3823847	-1	Nonsense_Mutation	c.2368C>T	p.Q790*
SUPHD1	Haematopoietic and lymphoid tissue	EP300	22	41574788	41574788	1	Missense_Mutation	c.7073C>T	p.P2358L
SUPHD1	Haematopoietic and lymphoid tissue	CHD1	5	98193929	98193929	-1	Missense_Mutation	c.4742A>G	p.N1581S
SUPHD1	Haematopoietic and lymphoid tissue	PHIP	6	79650450	79650450	-1	Frame_Shift_Del	c.5426_5426delA	p.K1809fs
SUPHD1	Haematopoietic and lymphoid tissue	TRRAP	7	98490054	98490054	1	Missense_Mutation	c.269G>A	p.R90Q
SUPHD1	Haematopoietic and lymphoid tissue	KAT6A	8	41832259	41832259	-1	Missense_Mutation	c.1445T>A	p.M482K
SUPM2	Haematopoietic and lymphoid tissue	EP300	22	41573426	41573426	1	Missense_Mutation	c.5711A>C	p.Q1904P
SUPT11	Haematopoietic and lymphoid tissue	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
SUPT11	Haematopoietic and lymphoid tissue	KAT6A	8	41812883	41812883	-1	Missense_Mutation	c.1529C>G	p.S510C
SW1088	Central nervous system	IDH2	15	90628514	90628514	-1	Missense_Mutation	c.1073A>G	p.H358R
SW1088	Central nervous system	CREBBP	16	3778440	3778448	-1	In_Frame_Del	c.6600_6608delGCAGCAGCA	p.2200_2203QQQQ>Q
SW1088	Central nervous system	CREBBP	16	3807919	3807919	-1	Missense_Mutation	c.3500A>G	p.Y1167C
SW1088	Central nervous system	TET2	4	106157219	106157219	1	Missense_Mutation	c.2183C>A	p.A728D
SW1088	Central nervous system	NCOA2	8	71033566	71033566	-1	Missense_Mutation	c.4354A>G	p.M1452V
SW1088	Central nervous system	TAF1L	9	32633574	32633574	-1	Missense_Mutation	c.2004G>A	p.M668I
SW1116	Large intestine	MBD6	12	57919455	57919455	1	Frame_Shift_Del	c.704_704delC	p.S235fs
SW1116	Large intestine	JARID2	6	15452379	15452379	1	Missense_Mutation	c.466G>A	p.D156N
SW1116	Large intestine	SMARCA2	9	2039777	2039791	1	In_Frame_Del	c.667_681delCAGCAGCAGCAGCAG	p.QQQQQ233del
SW1271	Lung	SMARCA4	19	11123672	11123672	1	Missense_Mutation	c.2322C>A	p.N774K
SW1271	Lung	DNMT3B	20	31394062	31394062	1	Missense_Mutation	c.2349G>T	p.Q783H
SW1271	Lung	TAF1L	9	32630729	32630729	-1	Missense_Mutation	c.4849A>G	p.N1617D
SW1271	Lung	TAF1L	9	32635019	32635019	-1	Missense_Mutation	c.559C>A	p.P187T
SW1271	Lung	ATRX	X	76849256	76849257	-1	Missense_Mutation	c.6019_6020AC>TT	p.T2007L
SW1353	Bone	IDH2	15	90631837	90631837	-1	Missense_Mutation	c.516G>T	p.R172S
SW1417	Large intestine	KAT6B	10	76788660	76788668	1	In_Frame_Del	c.4078_4086delGAAGAGGAA	p.EEE1366del
SW1417	Large intestine	WHSC1	4	1957865	1957865	1	Missense_Mutation	c.2831G>A	p.R944Q
SW1417	Large intestine	KMT2C	7	151878796	151878796	-1	Missense_Mutation	c.6149C>T	p.P2050L
SW1417	Large intestine	KMT2C	7	151896390	151896390	-1	Missense_Mutation	c.4247C>T	p.S1416L
SW1463	Large intestine	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
SW1463	Large intestine	SUZ12	17	30321667	30321667	1	Missense_Mutation	c.1522C>T	p.R508C
SW1463	Large intestine	ATRX	X	76813017	76813017	-1	Missense_Mutation	c.6604A>T	p.N2202Y
SW1463	Large intestine	ATRX	X	76907782	76907784	-1	In_Frame_Del	c.4377_4379delGGA	p.1459_1460EE>E
SW1573	Lung	SETDB1	1	150923439	150923439	1	Missense_Mutation	c.2086G>A	p.E696K
SW1573	Lung	NIPBL	5	37044510	37044510	1	Missense_Mutation	c.6170T>C	p.L2057P
SW1573	Lung	PHF3	6	64401647	64401647	1	Missense_Mutation	c.2210G>C	p.R737T
SW1573	Lung	KMT2C	7	151871316	151871316	-1	Missense_Mutation	c.9274A>G	p.I3092V
SW1710	Urinary tract	ERCC6	10	50713957	50713957	-1	Missense_Mutation	c.1499C>G	p.P500R
SW1710	Urinary tract	WHSC1L1	8	38188999	38188999	-1	Missense_Mutation	c.1015T>A	p.L339I
SW1783	Central nervous system	CHD5	1	6211106	6211106	-1	Missense_Mutation	c.980G>A	p.R327H
SW1783	Central nervous system	HNF1A	12	121431488	121431488	1	Missense_Mutation	c.692C>T	p.T231M
SW1783	Central nervous system	HDAC4	2	240085508	240085508	-1	Missense_Mutation	c.602A>G	p.Y201C
SW1783	Central nervous system	BRD3	9	136901357	136901357	-1	Missense_Mutation	c.1733G>A	p.R578H
SW1783	Central nervous system	TAF1L	9	32635568	32635568	-1	Missense_Mutation	c.10G>A	p.G4S
SW1990	Pancreas	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SW1990	Pancreas	NIPBL	5	37000954	37000954	1	Nonsense_Mutation	c.3538A>T	p.K1180*
SW403	Large intestine	KAT6B	10	76735609	76735609	1	Missense_Mutation	c.1514C>T	p.P505L
SW403	Large intestine	CREBBP	16	3823890	3823890	-1	Missense_Mutation	c.2325G>A	p.M775I
SW403	Large intestine	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
SW403	Large intestine	NIPBL	5	36995790	36995790	1	Missense_Mutation	c.3188T>C	p.M1063T
SW403	Large intestine	NIPBL	5	37038739	37038739	1	Missense_Mutation	c.6007G>A	p.V2003I
SW403	Large intestine	TAF1	X	70595095	70595095	1	Missense_Mutation	c.491G>A	p.G164E
SW403	Large intestine	TAF1	X	70612423	70612423	1	Missense_Mutation	c.2846G>A	p.R949H
SW480	Large intestine	TET1	10	70332814	70332814	1	Missense_Mutation	c.719C>A	p.P240Q
SW480	Large intestine	KAT6B	10	76781905	76781906	1	In_Frame_Ins	c.3288_3289insGAA	p.1104_1105insE
SW480	Large intestine	CHD9	16	53326804	53326804	1	Missense_Mutation	c.5350C>T	p.R1784C
SW480	Large intestine	MSH6	2	48025785	48025785	1	Missense_Mutation	c.663A>C	p.E221D
SW480	Large intestine	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SW480	Large intestine	STK31	7	23823244	23823244	1	Missense_Mutation	c.2110C>T	p.P704S
SW48	Large intestine	ARID1A	1	27101402	27101402	1	Frame_Shift_Del	c.4684_4684delC	p.P1562fs
SW48	Large intestine	HDAC1	1	32782335	32782335	1	Missense_Mutation	c.232T>C	p.S78P
SW48	Large intestine	HDAC1	1	32796374	32796374	1	Missense_Mutation	c.844G>A	p.A282T
SW48	Large intestine	CHD5	1	6194862	6194863	-1	Frame_Shift_Ins	c.2927_2928insG	p.G976fs
SW48	Large intestine	TET1	10	70405805	70405805	1	Missense_Mutation	c.3319C>T	p.L1107F
SW48	Large intestine	ZMYM2	13	20567907	20567907	1	Missense_Mutation	c.695T>A	p.L232Q
SW48	Large intestine	CHD8	14	21869077	21869077	-1	Missense_Mutation	c.3490C>T	p.R1164C
SW48	Large intestine	MGA	15	42035073	42035073	1	Missense_Mutation	c.4915G>A	p.E1639K
SW48	Large intestine	CREBBP	16	3779211	3779211	-1	Frame_Shift_Del	c.5837_5837delC	p.P1946fs
SW48	Large intestine	CREBBP	16	3817721	3817721	-1	Frame_Shift_Del	c.3250_3250delA	p.I1084fs
SW48	Large intestine	SUZ12	17	30310119	30310119	1	Missense_Mutation	c.1019G>T	p.G340V
SW48	Large intestine	SUZ12	17	30321697	30321697	1	Missense_Mutation	c.1552G>A	p.G518R
SW48	Large intestine	SMARCA4	19	11118684	11118684	1	Missense_Mutation	c.2108C>T	p.A703V
SW48	Large intestine	BRD4	19	15366939	15366939	-1	Frame_Shift_Del	c.1687_1687delA	p.S563fs
SW48	Large intestine	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
SW48	Large intestine	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
SW48	Large intestine	DNMT3B	20	31393184	31393184	1	Missense_Mutation	c.2272G>A	p.D758N
SW48	Large intestine	EP300	22	41536164	41536164	1	Missense_Mutation	c.1781C>T	p.T594M
SW48	Large intestine	EP300	22	41566525	41566525	1	Frame_Shift_Del	c.4402_4402delA	p.K1468fs
SW48	Large intestine	WHSC1	4	1957720	1957720	1	Missense_Mutation	c.2686G>A	p.A896T
SW48	Large intestine	NIPBL	5	36985083	36985083	1	Frame_Shift_Del	c.1801_1801delA	p.K601fs
SW48	Large intestine	HDAC2	6	114292039	114292040	-1	Frame_Shift_Ins	c.315_316insA	p.K105fs
SW48	Large intestine	JARID2	6	15410504	15410504	1	Missense_Mutation	c.231G>T	p.Q77H
SW48	Large intestine	JARID2	6	15497226	15497226	1	Frame_Shift_Del	c.1770_1770delC	p.I590fs
SW48	Large intestine	JARID2	6	15507590	15507590	1	Missense_Mutation	c.2674C>A	p.L892I
SW48	Large intestine	BAG6	6	31616734	31616734	-1	Missense_Mutation	c.431G>A	p.G144D
SW48	Large intestine	KMT2C	7	151845382	151845382	-1	Missense_Mutation	c.13630C>T	p.R4544W
SW48	Large intestine	KMT2C	7	151874148	151874148	-1	Frame_Shift_Del	c.8390_8390delA	p.K2797fs
SW48	Large intestine	IKZF1	7	50444272	50444272	1	Missense_Mutation	c.202G>A	p.G68R
SW48	Large intestine	TRRAP	7	98557001	98557001	1	Missense_Mutation	c.6356G>A	p.G2119E
SW48	Large intestine	WHSC1L1	8	38133981	38133981	-1	Frame_Shift_Del	c.3905_3905delA	p.N1302fs
SW48	Large intestine	NCOA2	8	71040717	71040717	-1	Missense_Mutation	c.3632G>A	p.S1211N
SW48	Large intestine	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
SW48	Large intestine	KDM6A	X	44923035	44923036	1	Frame_Shift_Ins	c.2052_2053insA	p.W684fs
SW48	Large intestine	HDAC6	X	48661110	48661110	1	Missense_Mutation	c.11C>T	p.T4I
SW48	Large intestine	HDAC6	X	48673824	48673824	1	Missense_Mutation	c.1183G>A	p.V395I
SW48	Large intestine	ATRX	X	76938089	76938090	-1	Frame_Shift_Del	c.2658_2659delGA	p.E886fs
SW579	Thyroid	CHD9	16	53358095	53358095	1	Missense_Mutation	c.7982A>G	p.N2661S
SW579	Thyroid	RAI1	17	17697094	17697105	1	In_Frame_Del	c.832_843delCAGCAGCAGCAG	p.QQQQ286del
SW579	Thyroid	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SW579	Thyroid	WHSC1	4	1962801	1962801	1	Missense_Mutation	c.3295G>A	p.E1099K
SW579	Thyroid	PHF3	6	64422589	64422589	1	Missense_Mutation	c.5105G>A	p.C1702Y
SW620	Large intestine	SIRT1	10	69667859	69667859	1	Missense_Mutation	c.1147G>A	p.V383I
SW620	Large intestine	KAT6B	10	76781905	76781906	1	In_Frame_Ins	c.3288_3289insGAA	p.1104_1105insE
SW620	Large intestine	DNMT1	19	10265287	10265287	-1	Missense_Mutation	c.1807C>A	p.L603M
SW620	Large intestine	MSH6	2	48025785	48025785	1	Missense_Mutation	c.663A>C	p.E221D
SW620	Large intestine	EP300	22	41566442	41566442	1	Missense_Mutation	c.4319C>T	p.P1440L
SW620	Large intestine	KMT2C	7	151945025	151945025	-1	Missense_Mutation	c.2494A>G	p.K832E
SW780	Urinary tract	CREBBP	16	3781324	3781326	-1	In_Frame_Del	c.5039_5041delCCT	p.S1680del
SW780	Urinary tract	HDAC2	6	114292109	114292110	-1	5'UTR	c.245_246insCAG	p.81_82insS
SW837	Large intestine	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
SW900	Lung	ERCC6	10	50667034	50667034	-1	Missense_Mutation	c.4309T>A	p.F1437I
SW948	Large intestine	ARID1A	1	27087528	27087528	1	Missense_Mutation	c.2102G>C	p.G701A
SW948	Large intestine	ATRX	X	76972663	76972663	-1	Silent	c.78A>T	p.S26S
T3M10	Lung	MGA	15	41988850	41988850	1	Nonsense_Mutation	c.1642G>T	p.E548*
T3M10	Lung	TP53BP1	15	43748809	43748809	-1	Missense_Mutation	c.1997G>T	p.G666V
T3M10	Lung	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
T3M10	Lung	KAT6A	8	41791167	41791167	-1	Missense_Mutation	c.4571T>C	p.M1524T
T3M4	Pancreas	MEN1	11	64572092	64572093	-1	Frame_Shift_Ins	c.1561_1562insC	p.R521fs
T3M4	Pancreas	BAG6	6	31609669	31609669	-1	Missense_Mutation	c.2299G>A	p.V767I
T3M4	Pancreas	KMT2C	7	151873549	151873549	-1	Nonsense_Mutation	c.8989C>T	p.Q2997*
T47D	Breast	ARID1A	1	27092809	27092809	1	Nonsense_Mutation	c.2830C>T	p.Q944*
T47D	Breast	KMT2C	7	151932996	151932996	-1	Missense_Mutation	c.2675G>A	p.G892E
T47D	Breast	STK31	7	23794011	23794011	1	Missense_Mutation	c.1211C>G	p.T404S
T84	Large intestine	SIRT1	10	69667847	69667847	1	Missense_Mutation	c.1135G>A	p.D379N
T98G	Central nervous system	KDM5A	12	417047	417047	-1	Missense_Mutation	c.3503A>G	p.K1168R
T98G	Central nervous system	ING1	13	111367955	111367955	1	Missense_Mutation	c.165C>A	p.N55K
T98G	Central nervous system	NCOA1	2	24980955	24980955	1	Missense_Mutation	c.3995A>G	p.N1332S
T98G	Central nervous system	KMT2C	7	151932996	151932996	-1	Missense_Mutation	c.2675G>A	p.G892E
TC71	Bone	KMT2C	7	151841965	151841965	-1	Missense_Mutation	c.14176C>T	p.P4726S
TE10	Oesophagus	PRDM16	1	3301748	3301748	1	Silent	c.471C>T	p.C157C
TE10	Oesophagus	BRDT	1	92445247	92445247	1	Missense_Mutation	c.1232C>G	p.S411C
TE10	Oesophagus	CREBBP	16	3786149	3786149	-1	Missense_Mutation	c.4616A>G	p.Y1539C
TE10	Oesophagus	TRIM28	19	59061853	59061853	1	Missense_Mutation	c.2441C>T	p.P814L
TE10	Oesophagus	NCOA1	2	24929781	24929781	1	Missense_Mutation	c.1442T>C	p.I481T
TE10	Oesophagus	EP300	22	41568577	41568577	1	Missense_Mutation	c.4527G>T	p.W1509C
TE10	Oesophagus	ATRX	X	76944390	76944390	-1	Missense_Mutation	c.515C>T	p.T172I
TE11	Oesophagus	KAT6B	10	76602955	76602955	1	Missense_Mutation	c.340G>A	p.A114T
TE125T	Soft tissue	BRDT	1	92428315	92428316	1	Frame_Shift_Del	c.4_5delTC	p.S2fs
TE14	Oesophagus	MLLT10	10	21962510	21962510	1	Nonsense_Mutation	c.1283C>A	p.S428*
TE14	Oesophagus	CHD8	14	21861835	21861835	-1	Missense_Mutation	c.5282A>G	p.D1761G
TE14	Oesophagus	CHD8	14	21870258	21870258	-1	Nonsense_Mutation	c.3083T>A	p.L1028*
TE14	Oesophagus	EP300	22	41523570	41523570	1	Missense_Mutation	c.986C>G	p.T329R
TE14	Oesophagus	EP300	22	41564853	41564853	1	Missense_Mutation	c.4154G>A	p.C1385Y
TE14	Oesophagus	NIPBL	5	36984902	36984902	1	Missense_Mutation	c.1620G>C	p.M540I
TE159T	Soft tissue	BRD4	19	15378269	15378269	-1	Missense_Mutation	c.517A>G	p.I173V
TE159T	Soft tissue	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
TE159T	Soft tissue	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
TE1	Oesophagus	LMNA	1	156108487	156108487	1	Frame_Shift_Del	c.1907_1907delG	p.S636fs
TE1	Oesophagus	CHD5	1	6214889	6214889	-1	Nonsense_Mutation	c.576G>A	p.W192*
TE1	Oesophagus	CREBBP	16	3779680	3779681	-1	Frame_Shift_Ins	c.5367_5368insGCAAC	p.N1789fs
TE1	Oesophagus	PCNA	20	5100406	5100406	-1	Missense_Mutation	c.39G>T	p.K13N
TE1	Oesophagus	KMT2C	7	151871304	151871304	-1	Missense_Mutation	c.9286A>G	p.I3096V
TE441T	Soft tissue	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
TE441T	Soft tissue	PHF3	6	64395560	64395560	1	Missense_Mutation	c.1937A>T	p.E646V
TE441T	Soft tissue	ATRX	X	76954091	76954091	-1	Missense_Mutation	c.160T>G	p.S54A
TE4	Oesophagus	ERCC6	10	50667028	50667028	-1	Missense_Mutation	c.4315G>C	p.A1439P
TE4	Oesophagus	KAT6B	10	76732267	76732267	1	Missense_Mutation	c.931A>T	p.M311L
TE4	Oesophagus	CHD8	14	21860779	21860779	-1	Missense_Mutation	c.5821A>G	p.S1941G
TE4	Oesophagus	MGA	15	42042347	42042347	1	Missense_Mutation	c.6542C>T	p.P2181L
TE4	Oesophagus	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
TE4	Oesophagus	BRD3	9	136905168	136905168	-1	Missense_Mutation	c.1631C>A	p.T544N
TE5	Oesophagus	EP300	22	41574631	41574631	1	Missense_Mutation	c.6916C>G	p.Q2306E
TE5	Oesophagus	PHIP	6	79679885	79679885	-1	Missense_Mutation	c.3003A>T	p.Q1001H
TE617T	Soft tissue	SMARCA4	19	11106958	11106958	1	Nonsense_Mutation	c.1663C>T	p.Q555*
TE617T	Soft tissue	KMT2C	7	151878026	151878026	-1	Missense_Mutation	c.6919A>G	p.R2307G
TE6	Oesophagus	MLLT10	10	21959628	21959628	1	Missense_Mutation	c.1046C>T	p.P349L
TE6	Oesophagus	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
TE6	Oesophagus	HNF1A	12	121416692	121416692	1	Missense_Mutation	c.121G>A	p.E41K
TE6	Oesophagus	KDM5A	12	432857	432857	-1	Missense_Mutation	c.2059G>A	p.A687T
TE6	Oesophagus	KDM5A	12	438134	438134	-1	Missense_Mutation	c.1835C>T	p.S612L
TE6	Oesophagus	STK31	7	23821074	23821074	1	Missense_Mutation	c.2002A>C	p.K668Q
TE6	Oesophagus	ATRX	X	76952184	76952184	-1	Missense_Mutation	c.251C>T	p.S84L
TE8	Oesophagus	TP53BP1	15	43701242	43701242	-1	Missense_Mutation	c.5453G>A	p.R1818Q
TE8	Oesophagus	CREBBP	16	3779755	3779755	-1	Frame_Shift_Del	c.5293_5293delC	p.Q1765fs
TE8	Oesophagus	KMT2C	7	151874011	151874011	-1	Missense_Mutation	c.8527G>T	p.D2843Y
TE9	Oesophagus	NCOA1	2	24985637	24985638	1	Missense_Mutation	c.4147_4148GG>TT	p.G1383L
TE9	Oesophagus	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
TE9	Oesophagus	SMARCB1	22	24145583	24145583	1	Missense_Mutation	c.629G>A	p.R210Q
TE9	Oesophagus	SMARCA2	9	2039777	2039785	1	In_Frame_Del	c.667_675delCAGCAGCAG	p.QQQ235del
TE9	Oesophagus	TAF1L	9	32633291	32633291	-1	Missense_Mutation	c.2287G>C	p.E763Q
TEN	Endometrium	ARID1A	1	27101215	27101215	1	Silent	c.4497G>A	p.Q1499Q
TEN	Endometrium	CREBBP	16	3789646	3789646	-1	Missense_Mutation	c.4213G>A	p.V1405M
TEN	Endometrium	CHD1	5	98229238	98229238	-1	Missense_Mutation	c.1873C>T	p.L625F
TEN	Endometrium	PHIP	6	79664655	79664655	-1	Missense_Mutation	c.3929G>A	p.R1310H
TEN	Endometrium	KMT2C	7	151855953	151855953	-1	Missense_Mutation	c.11665A>C	p.K3889Q
TEN	Endometrium	KAT6A	8	41789919	41789919	-1	Missense_Mutation	c.5819C>T	p.P1940L
TEN	Endometrium	TAF1	X	70627994	70627994	1	Silent	c.4437C>T	p.T1479T
TEN	Endometrium	ATRX	X	76777820	76777820	-1	Missense_Mutation	c.6896C>T	p.P2299L
TF1	Haematopoietic and lymphoid tissue	SIRT1	10	69672312	69672312	1	Missense_Mutation	c.1439G>A	p.G480E
TF1	Haematopoietic and lymphoid tissue	MEN1	11	64577312	64577313	-1	Nonsense_Mutation	c.269_270insA	p.Y90fs
TF1	Haematopoietic and lymphoid tissue	TP53BP1	15	43749158	43749158	-1	Missense_Mutation	c.1648A>T	p.I550F
TF1	Haematopoietic and lymphoid tissue	CHD9	16	53342634	53342634	1	Missense_Mutation	c.7090C>T	p.L2364F
TF1	Haematopoietic and lymphoid tissue	TFPT	19	54611674	54611674	-1	Missense_Mutation	c.382G>A	p.G128R
TF1	Haematopoietic and lymphoid tissue	TRIM28	19	59061130	59061130	1	Missense_Mutation	c.2009A>G	p.H670R
TGBC11TKB	Stomach	SETDB1	1	150915418	150915418	1	Missense_Mutation	c.764C>T	p.A255V
TGBC11TKB	Stomach	ERCC6	10	50732772	50732772	-1	Missense_Mutation	c.704C>A	p.A235D
TGBC11TKB	Stomach	KMT2A	11	118376881	118376881	1	Missense_Mutation	c.10274C>T	p.A3425V
TGBC11TKB	Stomach	HNF1A	12	121432115	121432115	1	Frame_Shift_Del	c.862_862delG	p.G288fs
TGBC11TKB	Stomach	HNF1A	12	121434356	121434356	1	Frame_Shift_Del	c.1120_1120delG	p.G374fs
TGBC11TKB	Stomach	CHD4	12	6701121	6701123	-1	In_Frame_Del	c.3040_3042delAAG	p.K1014del
TGBC11TKB	Stomach	CHD4	12	6709456	6709457	-1	Frame_Shift_Ins	c.1159_1160insA	p.R387fs
TGBC11TKB	Stomach	CREBBP	16	3794897	3794898	-1	Frame_Shift_Del	c.3979_3980delAA	p.K1327fs
TGBC11TKB	Stomach	SP110	2	231065633	231065633	-1	Missense_Mutation	c.1097A>G	p.K366R
TGBC11TKB	Stomach	NCOA1	2	24888685	24888685	1	Missense_Mutation	c.157A>G	p.N53D
TGBC11TKB	Stomach	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
TGBC11TKB	Stomach	TET2	4	106156321	106156321	1	Frame_Shift_Del	c.1285_1285delC	p.P429fs
TGBC11TKB	Stomach	LMNB1	5	126156691	126156691	1	Missense_Mutation	c.1250A>C	p.K417T
TGBC11TKB	Stomach	LMNB1	5	126156747	126156747	1	Missense_Mutation	c.1306G>A	p.A436T
TGBC11TKB	Stomach	NIPBL	5	37022374	37022374	1	Missense_Mutation	c.5456G>T	p.R1819L
TGBC11TKB	Stomach	HDAC2	6	114292040	114292040	-1	Frame_Shift_Del	c.315_315delA	p.K105fs
TGBC11TKB	Stomach	BRD2	6	32945612	32945612	1	Frame_Shift_Del	c.1408_1408delC	p.P470fs
TGBC11TKB	Stomach	DAXX	6	33287524	33287524	-1	Nonsense_Mutation	c.1609G>T	p.G537*
TGBC11TKB	Stomach	PHF3	6	64395640	64395640	1	Missense_Mutation	c.2017C>T	p.R673C
TGBC11TKB	Stomach	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
TGBC11TKB	Stomach	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
TGBC11TKB	Stomach	TAF1	X	70642986	70642986	1	Missense_Mutation	c.4532G>A	p.R1511H
THP1	Haematopoietic and lymphoid tissue	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
TM31	Central nervous system	KAT6B	10	76781645	76781645	1	Missense_Mutation	c.3028C>T	p.R1010W
TM31	Central nervous system	KMT2A	11	118375998	118375998	1	Missense_Mutation	c.9391G>A	p.G3131S
TM31	Central nervous system	ATRX	X	76778738	76778738	-1	Nonsense_Mutation	c.6841G>T	p.E2281*
TOLEDO	Haematopoietic and lymphoid tissue	KMT2A	11	118368691	118368691	1	Missense_Mutation	c.5705C>T	p.T1902I
TOLEDO	Haematopoietic and lymphoid tissue	CREBBP	16	3781324	3781326	-1	In_Frame_Del	c.5039_5041delCCT	p.S1680del
TOLEDO	Haematopoietic and lymphoid tissue	EP300	22	41568608	41568608	1	Missense_Mutation	c.4558C>G	p.L1520V
TOLEDO	Haematopoietic and lymphoid tissue	TET2	4	106155055	106155055	1	Splice_Region	c.19A>T	p.I7F
TOLEDO	Haematopoietic and lymphoid tissue	NSD1	5	176721402	176721402	1	Missense_Mutation	c.7033G>T	p.V2345F
TOLEDO	Haematopoietic and lymphoid tissue	PHF3	6	64395517	64395517	1	Nonsense_Mutation	c.1894C>T	p.Q632*
TOLEDO	Haematopoietic and lymphoid tissue	PHF3	6	64395520	64395520	1	Nonsense_Mutation	c.1897C>T	p.Q633*
TOLEDO	Haematopoietic and lymphoid tissue	KMT2C	7	151873293	151873293	-1	Missense_Mutation	c.9245C>T	p.P3082L
TOLEDO	Haematopoietic and lymphoid tissue	TAF1	X	70626491	70626491	1	Silent	c.4062G>A	p.A1354A
TOV21G	Ovary	ARID1A	1	27057936	27057937	1	Frame_Shift_Ins	c.1644_1645insC	p.Q548fs
TOV21G	Ovary	ARID1A	1	27088659	27088659	1	Frame_Shift_Del	c.2268_2268delC	p.N756fs
TOV21G	Ovary	KAT6B	10	76789890	76789890	1	Missense_Mutation	c.5308A>G	p.S1770G
TOV21G	Ovary	MEN1	11	64574680	64574680	-1	Nonsense_Mutation	c.810G>A	p.W270*
TOV21G	Ovary	KDM5A	12	432249	432249	-1	Frame_Shift_Del	c.2274_2274delA	p.K758fs
TOV21G	Ovary	ING1	13	111372118	111372118	1	Missense_Mutation	c.1108G>A	p.D370N
TOV21G	Ovary	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
TOV21G	Ovary	LMNB2	19	2434856	2434856	-1	Missense_Mutation	c.911G>A	p.R304H
TOV21G	Ovary	DNMT3B	20	31388687	31388687	1	Missense_Mutation	c.1952G>A	p.C651Y
TOV21G	Ovary	NSD1	5	176638491	176638491	1	Nonsense_Mutation	c.3091C>T	p.R1031*
TOV21G	Ovary	PHF3	6	64408424	64408424	1	Missense_Mutation	c.2911C>T	p.R971W
TOV21G	Ovary	PHF3	6	64415952	64415953	1	Frame_Shift_Ins	c.3401_3402insA	p.P1134fs
TOV21G	Ovary	KMT2C	7	151849939	151849939	-1	Nonsense_Mutation	c.12377T>A	p.L4126*
TOV21G	Ovary	BRD3	9	136918529	136918529	-1	Frame_Shift_Del	c.71_71delC	p.P24fs
TOV21G	Ovary	SMARCA2	9	2039858	2039860	1	In_Frame_Del	c.748_750delCAA	p.Q253del
TOV21G	Ovary	TAF1	X	70613991	70613991	1	Missense_Mutation	c.3362T>C	p.M1121T
TT	Oesophagus	CREBBP	16	3778891	3778891	-1	Missense_Mutation	c.6157A>G	p.M2053V
TT	Oesophagus	SMARCA4	19	11152172	11152172	1	Missense_Mutation	c.4456A>C	p.N1486H
TT	Oesophagus	WHSC1	4	1920021	1920021	1	Missense_Mutation	c.1081A>C	p.K361Q
TT	Oesophagus	TAF1L	9	32630533	32630533	-1	Missense_Mutation	c.5045C>T	p.S1682F
TT	Thyroid	PRDM16	1	3301748	3301748	1	Silent	c.471C>T	p.C157C
TT	Thyroid	TP53BP1	15	43714096	43714096	-1	Missense_Mutation	c.4057G>A	p.D1353N
TUHR10TKB	Kidney	TET1	10	70451542	70451542	1	Missense_Mutation	c.6382G>A	p.V2128I
TUHR10TKB	Kidney	HDAC3	5	141016351	141016351	-1	Missense_Mutation	c.7A>G	p.K3E
TUHR10TKB	Kidney	TRRAP	7	98547146	98547146	1	Missense_Mutation	c.4874G>T	p.R1625L
TUHR10TKB	Kidney	ATRX	X	76938271	76938271	-1	Missense_Mutation	c.2477A>G	p.K826R
TUHR14TKB	Kidney	BAP1	3	52439852	52439852	-1	Nonsense_Mutation	c.860C>A	p.S287*
TUHR14TKB	Kidney	KDM6A	X	44922791	44922791	1	Missense_Mutation	c.1808C>A	p.P603H
TUHR4TKB	Kidney	KMT2A	11	118371797	118371797	1	Missense_Mutation	c.6254A>G	p.D2085G
TUHR4TKB	Kidney	NSD1	5	176562115	176562115	1	Missense_Mutation	c.11C>A	p.T4N
TUHR4TKB	Kidney	TRRAP	7	98547146	98547146	1	Missense_Mutation	c.4874G>T	p.R1625L
TYKNU	Ovary	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
TYKNU	Ovary	MSH6	2	48033981	48033982	1	Frame_Shift_Ins	c.4065_4066insTTGA	p.T1355fs
TYKNU	Ovary	KMT2C	7	151845289	151845289	-1	Missense_Mutation	c.13723C>T	p.L4575F
TYKNU	Ovary	BRD3	9	136898749	136898749	-1	Missense_Mutation	c.2144C>T	p.S715F
TYKNU	Ovary	ATRX	X	76776298	76776298	-1	Missense_Mutation	c.7168A>G	p.I2390V
U138MG	Central nervous system	PHF3	6	64404570	64404570	1	Missense_Mutation	c.2596C>T	p.R866W
U266B1	Haematopoietic and lymphoid tissue	MSH6	2	48018227	48018227	1	Missense_Mutation	c.422G>A	p.G141D
U266B1	Haematopoietic and lymphoid tissue	PHF3	6	64421859	64421859	1	Frame_Shift_Del	c.4375_4375delT	p.L1459fs
U2OS	Bone	TRIM28	19	59061352	59061352	1	Missense_Mutation	c.2143G>A	p.E715K
U87MG	Central nervous system	NSD1	5	176638780	176638780	1	Missense_Mutation	c.3380T>G	p.L1127R
UACC257	Skin	LMNA	1	156106122	156106122	1	Silent	c.1275G>A	p.E425E
UACC257	Skin	CHD5	1	6214775	6214776	-1	Missense_Mutation	c.689_690CC>TT	p.P230L
UACC257	Skin	KAT6B	10	76790547	76790548	1	Missense_Mutation	c.5965_5966CT>TC	p.L1989S
UACC257	Skin	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
UACC257	Skin	TRRAP	7	98497073	98497073	1	Missense_Mutation	c.662C>T	p.S221F
UACC62	Skin	TRRAP	7	98509802	98509802	1	Missense_Mutation	c.2165C>T	p.S722F
UACC812	Breast	EP400	12	132547068	132547069	1	In_Frame_Ins	c.8156_8157insGCA	p.2748_2749insQ
UACC812	Breast	MGA	15	42058328	42058328	1	Missense_Mutation	c.8048A>G	p.H2683R
UACC812	Breast	RAI1	17	17697094	17697096	1	In_Frame_Del	c.832_834delCAG	p.Q291del
UACC812	Breast	BRD4	19	15366908	15366908	-1	Missense_Mutation	c.1718C>A	p.T573K
UACC812	Breast	SP140	2	231149083	231149083	1	Missense_Mutation	c.1521G>C	p.W507C
UACC893	Breast	CHD5	1	6214885	6214885	-1	Missense_Mutation	c.580G>C	p.E194Q
UACC893	Breast	KMT2A	11	118344150	118344150	1	Missense_Mutation	c.2276G>A	p.S759N
UACC893	Breast	KMT2A	11	118366532	118366532	1	Missense_Mutation	c.5481T>G	p.I1827M
UACC893	Breast	NIPBL	5	36986057	36986057	1	Missense_Mutation	c.2775G>C	p.K925N
UACC893	Breast	BRD2	6	32945740	32945741	1	Frame_Shift_Del	c.1536_1537delAG	p.S512fs
UACC893	Breast	PHF3	6	64394749	64394749	1	Nonsense_Mutation	c.1126G>T	p.E376*
UACC893	Breast	KAT6A	8	41805427	41805427	-1	Missense_Mutation	c.1744G>A	p.D582N
UBLC1	Urinary tract	HDAC4	2	240036913	240036913	-1	Missense_Mutation	c.1612G>A	p.E538K
UBLC1	Urinary tract	TRRAP	7	98567787	98567787	1	Missense_Mutation	c.7544G>A	p.G2515E
UMUC1	Urinary tract	EP400	12	132547138	132547139	1	In_Frame_Ins	c.8226_8227insCAG	p.2748_2749insQ
UMUC1	Urinary tract	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
UMUC1	Urinary tract	PHF3	6	64356578	64356578	1	Missense_Mutation	c.122T>C	p.L41S
UMUC1	Urinary tract	KDM6A	X	44949124	44949124	1	Nonsense_Mutation	c.3841C>T	p.Q1281*
UMUC3	Urinary tract	HDAC4	2	240036981	240036981	-1	Missense_Mutation	c.1544C>T	p.A515V
UMUC3	Urinary tract	JARID2	6	15487649	15487649	1	Missense_Mutation	c.782G>C	p.R261P
UMUC3	Urinary tract	KDM6A	X	44966663	44966663	1	Missense_Mutation	c.4043T>G	p.L1348R
UT7	Haematopoietic and lymphoid tissue	NCOA4	10	51584896	51584896	1	Missense_Mutation	c.1043T>C	p.F348S
UT7	Haematopoietic and lymphoid tissue	KAT6A	8	41794797	41794799	-1	In_Frame_Del	c.3327_3329delAGA	p.E1109del
UT7	Haematopoietic and lymphoid tissue	TAF1L	9	32631377	32631377	-1	Missense_Mutation	c.4201A>G	p.M1401V
VCAP	Prostate	MSH6	2	48030639	48030640	1	Frame_Shift_Ins	c.3253_3254insC	p.T1085fs
VMCUB1	Urinary tract	ARID1A	1	27057947	27057947	1	Nonsense_Mutation	c.1655C>G	p.S552*
VMCUB1	Urinary tract	CREBBP	16	3790511	3790511	-1	Missense_Mutation	c.4022G>A	p.R1341Q
VMCUB1	Urinary tract	ATF2	2	175939558	175939558	-1	Missense_Mutation	c.1297G>C	p.D433H
VMCUB1	Urinary tract	EP300	22	41573335	41573335	1	Missense_Mutation	c.5620C>G	p.Q1874E
VMCUB1	Urinary tract	EP300	22	41573782	41573782	1	Nonsense_Mutation	c.6067C>T	p.Q2023*
VMCUB1	Urinary tract	TET2	4	106157196	106157196	1	Missense_Mutation	c.2160G>T	p.L720F
VMCUB1	Urinary tract	WHSC1	4	1956960	1956960	1	Missense_Mutation	c.2411C>T	p.S804L
VMCUB1	Urinary tract	KDM6A	X	44949149	44949149	1	Missense_Mutation	c.3866T>A	p.I1289N
VMCUB1	Urinary tract	ATRX	X	76938923	76938923	-1	Missense_Mutation	c.1825C>G	p.P609A
VMRCLCD	Lung	ARID1A	1	27057889	27057889	1	Missense_Mutation	c.1597C>G	p.P533A
VMRCLCD	Lung	BRDT	1	92457851	92457851	1	Nonsense_Mutation	c.2107G>T	p.G703*
VMRCLCD	Lung	KDM5A	12	416155	416155	-1	Missense_Mutation	c.4031A>T	p.D1344V
VMRCLCD	Lung	TP53BP1	15	43738650	43738663	-1	Frame_Shift_Del	c.2962_2975delGATAAATTATGTCT	p.D988fs
VMRCLCD	Lung	NCOA1	2	24929598	24929598	1	Missense_Mutation	c.1259G>A	p.R420H
VMRCLCD	Lung	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
VMRCLCD	Lung	STK31	7	23830527	23830527	1	Missense_Mutation	c.2722G>C	p.G908R
VMRCLCD	Lung	WHSC1L1	8	38156991	38156991	-1	Nonsense_Mutation	c.2729C>A	p.S910*
VMRCLCD	Lung	HDAC6	X	48675005	48675005	1	Missense_Mutation	c.1756G>T	p.A586S
VMRCLCP	Lung	KAT6B	10	76788663	76788663	1	Missense_Mutation	c.4081G>A	p.E1361K
VMRCLCP	Lung	DNMT1	19	10283824	10283824	-1	Missense_Mutation	c.710A>T	p.E237V
VMRCLCP	Lung	LMNB1	5	126156820	126156820	1	Missense_Mutation	c.1379C>T	p.S460F
VMRCLCP	Lung	NIPBL	5	37045664	37045664	1	Missense_Mutation	c.6463G>C	p.D2155H
VMRCRCW	Kidney	SP140	2	231134283	231134283	1	Missense_Mutation	c.1277A>C	p.E426A
VMRCRCW	Kidney	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
VMRCRCW	Kidney	BAP1	3	52437305	52437305	-1	Frame_Shift_Del	c.1739_1739delA	p.K580fs
VMRCRCZ	Kidney	ZMYM2	13	20567907	20567907	1	Missense_Mutation	c.695T>A	p.L232Q
VMRCRCZ	Kidney	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
VMRCRCZ	Kidney	PHIP	6	79727285	79727285	-1	Missense_Mutation	c.1010C>T	p.A337V
WM1799	Skin	TP53BP1	15	43724856	43724856	-1	Missense_Mutation	c.3211C>A	p.P1071T
WM1799	Skin	DNMT1	19	10251832	10251832	-1	Missense_Mutation	c.3343C>T	p.P1115S
WM1799	Skin	WHSC1L1	8	38162867	38162867	-1	Missense_Mutation	c.2339G>A	p.R780H
WM793	Skin	ASH1L	1	155491185	155491186	-1	Frame_Shift_Ins	c.125_126insA	p.N42fs
WM793	Skin	KAT6B	10	76784866	76784866	1	Missense_Mutation	c.3523A>G	p.T1175A
WM793	Skin	NCOA3	20	46279815	46279823	1	In_Frame_Del	c.3741_3749delGCAGCAGCA	p.QQQ1272del
WM793	Skin	KMT2C	7	151945192	151945192	-1	Missense_Mutation	c.2327T>A	p.I776K
WM88	Skin	KAT6B	10	76780406	76780406	1	Missense_Mutation	c.2696G>A	p.R899H
WM88	Skin	CHD8	14	21853968	21853968	-1	Missense_Mutation	c.6713C>T	p.P2238L
WM88	Skin	CHD9	16	53190180	53190180	1	Missense_Mutation	c.179C>T	p.P60L
WM88	Skin	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
WM88	Skin	SMARCA4	19	11134239	11134239	1	Missense_Mutation	c.2905C>T	p.H969Y
WM88	Skin	KMT2C	7	151860257	151860258	-1	Missense_Mutation	c.10404_10405CC>TT	p.L3469F
WM88	Skin	KMT2C	7	151932922	151932922	-1	Missense_Mutation	c.2749G>A	p.G917R
WM983B	Skin	BAG6	6	31612770	31612770	-1	Missense_Mutation	c.1340C>T	p.S447F
WM983B	Skin	BRD2	6	32945699	32945701	1	In_Frame_Del	c.1495_1497delGAG	p.E500del
WM983B	Skin	KMT2C	7	151884349	151884349	-1	Missense_Mutation	c.5006C>G	p.P1669R
WM983B	Skin	NCOA2	8	71040954	71040954	-1	Missense_Mutation	c.3586C>T	p.R1196C
WSUDLCL2	Haematopoietic and lymphoid tissue	MLLT10	10	21962581	21962581	1	Missense_Mutation	c.1354C>T	p.R452W
YAPC	Pancreas	ARID1B	6	157099402	157099403	1	In_Frame_Ins	c.165_166insCAG	p.73_74insQ
YD10B	Upper aerodigestive tract	ARID1A	1	27101425	27101425	1	Silent	c.4707A>C	p.P1569P
YD10B	Upper aerodigestive tract	CHD5	1	6206828	6206828	-1	Missense_Mutation	c.1487G>A	p.S496N
YD10B	Upper aerodigestive tract	CHD4	12	6711144	6711145	-1	In_Frame_Ins	c.410_411insGGA	p.136_137insE
YD10B	Upper aerodigestive tract	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
YD15	Salivary gland	PRDM16	1	3102928	3102928	1	Missense_Mutation	c.277G>A	p.G93R
YD15	Salivary gland	SIRT1	10	69669136	69669136	1	Missense_Mutation	c.1294G>A	p.E432K
YD15	Salivary gland	KMT2A	11	118344696	118344696	1	Missense_Mutation	c.2822C>T	p.S941F
YD15	Salivary gland	CHD8	14	21861835	21861835	-1	Missense_Mutation	c.5282A>G	p.D1761G
YD15	Salivary gland	MGA	15	41988997	41988997	1	Missense_Mutation	c.1789G>A	p.A597T
YD15	Salivary gland	SMARCA4	19	11170498	11170498	1	Missense_Mutation	c.4801G>A	p.D1601N
YD15	Salivary gland	NCOA3	20	46265468	46265468	1	Missense_Mutation	c.2338G>C	p.E780Q
YD15	Salivary gland	EP300	22	41545822	41545822	1	Nonsense_Mutation	c.2437C>T	p.Q813*
YD15	Salivary gland	WHSC1	4	1932444	1932444	1	Missense_Mutation	c.1502G>A	p.R501H
YD15	Salivary gland	PHF3	6	64394896	64394896	1	Missense_Mutation	c.1273G>C	p.D425H
YD15	Salivary gland	KMT2C	7	151917668	151917668	-1	Nonsense_Mutation	c.3652C>T	p.Q1218*
YD15	Salivary gland	TAF1	X	70627481	70627481	1	Missense_Mutation	c.4225A>G	p.I1409V
YD15	Salivary gland	ATRX	X	76939133	76939133	-1	Missense_Mutation	c.1615C>G	p.Q539E
YD38	Upper aerodigestive tract	CHD8	14	21860016	21860018	-1	In_Frame_Del	c.6022_6024delAAG	p.K2008del
YD38	Upper aerodigestive tract	CHD9	16	53191422	53191422	1	Missense_Mutation	c.1421A>G	p.H474R
YD38	Upper aerodigestive tract	DNMT3B	20	31384616	31384617	1	Frame_Shift_Ins	c.1318_1319insG	p.R440fs
YD38	Upper aerodigestive tract	NSD1	5	176722221	176722221	1	Missense_Mutation	c.7852G>A	p.V2618I
YD38	Upper aerodigestive tract	PHF3	6	64394989	64394989	1	Missense_Mutation	c.1366A>G	p.S456G
YD38	Upper aerodigestive tract	TRRAP	7	98574650	98574650	1	Missense_Mutation	c.8315C>T	p.S2772L
YD38	Upper aerodigestive tract	TAF1L	9	32630960	32630960	-1	Missense_Mutation	c.4618G>A	p.A1540T
YD8	Upper aerodigestive tract	ATRX	X	76920242	76920242	-1	Nonsense_Mutation	c.3835G>T	p.E1279*
YH13	Central nervous system	CREBBP	16	3778461	3778461	-1	Missense_Mutation	c.6587A>T	p.Q2196L
YH13	Central nervous system	TNRC18	7	5352663	5352665	-1	In_Frame_Del	c.7857_7859delATC	p.2619_2620SS>S
YKG1	Central nervous system	MGA	15	42046647	42046647	1	Missense_Mutation	c.7021G>C	p.E2341Q
YKG1	Central nervous system	KMT2C	7	151860353	151860353	-1	Missense_Mutation	c.10309G>T	p.V3437L
YKG1	Central nervous system	ATRX	X	76919028	76919028	-1	Missense_Mutation	c.3963T>A	p.N1321K
ZR751	Breast	CHD9	16	53338410	53338412	1	In_Frame_Del	c.6492_6494delTTC	p.2164_2165SS>S
ZR7530	Breast	SIRT1	10	69676321	69676321	1	Missense_Mutation	c.2215G>T	p.D739Y
ZR7530	Breast	KAT6B	10	76735876	76735876	1	Missense_Mutation	c.1781G>C	p.R594T
ZR7530	Breast	KAT6B	10	76790353	76790353	1	Missense_Mutation	c.5771C>A	p.S1924Y
ZR7530	Breast	MGA	15	41961433	41961433	1	Missense_Mutation	c.341G>T	p.G114V
ZR7530	Breast	MGA	15	42041782	42041782	1	Missense_Mutation	c.5977G>T	p.V1993F
ZR7530	Breast	NCOA3	20	46279864	46279866	1	In_Frame_Del	c.3790_3792delCAA	p.Q1276del
ZR7530	Breast	HDAC6	X	48682576	48682576	1	Missense_Mutation	c.3451G>A	p.V1151I
ZR7530	Breast	ATRX	X	76776325	76776325	-1	Missense_Mutation	c.7141G>A	p.E2381K