microRNA information: hsa-let-7a-3p

SectionIDlink
Mature name: hsa-let-7a-3pmiRbase
Accession: MIMAT0004481miRbase
Precursor name: hsa-let-7a-1 miRbase
Precursor accession: MI0000060miRbase
Symbol: MIRLET7A1HGNC
RefSeq ID: NR_029476GenBank
Sequence: CUAUACAAUCUACUGUCUUUC



Reported expression in cancers: hsa-let-7a-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-let-7a-3p

breast cancerdownregulation"Previously we found that let-7 miRNAs were downreg ......"21826373
hsa-let-7a-3p

breast cancerdownregulation"The heterochronic microRNA let 7 inhibits cell mot ......"23339187
hsa-let-7a-3p

breast cancerdownregulation"Expression status of let 7a and miR 335 among brea ......"24942235
hsa-let-7a-3p

breast cancerdownregulation"Breast cancer specific TRAIL expression mediated b ......"25150312qPCR
hsa-let-7a-3p

colon cancerdownregulation"Recently let-7 miRNAs were found to regulate human ......"16651716
hsa-let-7a-3p

colon cancerdownregulation"Microarray analyses of miRNAs in exosome-enriched ......"24705249Microarray; qPCR
hsa-let-7a-3p

colorectal cancerupregulation"NIRF is frequently upregulated in colorectal cance ......"22018986
hsa-let-7a-3p

colorectal cancerupregulation"Of the 99 mCRC patients we studied differential mi ......"23098991Microarray
hsa-let-7a-3p

colorectal cancerupregulation"High expression of let-7 g was associated with a g ......"23932154
hsa-let-7a-3p

gastric cancerderegulation"miRNA expression signature was first analyzed by r ......"21628394qPCR
hsa-let-7a-3p

head and neck cancerderegulation"Significance was determined using significance ana ......"18798260Microarray
hsa-let-7a-3p

head and neck cancerderegulation"We found that expressions of miR‑424 let-7a miR ......"26323893
hsa-let-7a-3p

liver cancerdownregulation"In present study we found that the tumor suppresso ......"21814544
hsa-let-7a-3p

liver cancerdownregulation"Downregulation of let-7 miRNA in many human cancer ......"22289550
hsa-let-7a-3p

liver cancerdownregulation"The down-regulated let-7a was validated in another ......"24273923qPCR
hsa-let-7a-3p

liver cancerdownregulation"Let-7 family microRNAs have been reported to be do ......"24724096
hsa-let-7a-3p

lung cancerdownregulation"Reduced expression of the let 7 microRNAs in human ......"15172979
hsa-let-7a-3p

lung cancerdownregulation"Suppression of non small cell lung tumor developme ......"18308936
hsa-let-7a-3p

lung cancerdownregulation"Indeed some transcripts of the let-7 family that a ......"19275611
hsa-let-7a-3p

lung cancerdownregulation"Down-regulation of let-7 microRNA miRNA plays an i ......"20033209Reverse transcription PCR; qPCR
hsa-let-7a-3p

lung cancerdownregulation"Most miRs including all members of the let-7 famil ......"20068076qPCR
hsa-let-7a-3p

lung cancerdownregulation"MicroRNAs miRs are small noncoding RNA sequences t ......"24293999RNA-Seq
hsa-let-7a-3p

lymphomaupregulation"The major findings were: the detection of a panel ......"19945163
hsa-let-7a-3p

melanomadownregulation"A microRNA expression screen was performed analyzi ......"18379589qPCR
hsa-let-7a-3p

ovarian cancerdownregulation"Using microRNA microarrays we identify several miR ......"18560586Microarray
hsa-let-7a-3p

pancreatic cancerderegulation"We also found that the treatment of cells in vitro ......"22261338
hsa-let-7a-3p

pancreatic cancerderegulation"miR-122 let-7 family and miR-101 are down-regulate ......"22303361
hsa-let-7a-3p

prostate cancerdownregulation"Previous work has shown reduced expression levels ......"20418948
hsa-let-7a-3p

sarcomadownregulation"We detected decreased expression levels of some le ......"21412931



Reported cancer pathway affected by hsa-let-7a-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-let-7a-3p

breast cancerWnt signaling pathway; Apoptosis pathway; Notch signaling pathway"The miRNAs and their clusters such as the miR-200 ......"26712794
hsa-let-7a-3p

breast cancerApoptosis pathway"The tumor-suppressive let-7 family of microRNAs mi ......"27574028Western blot; Luciferase
hsa-let-7a-3p

cervical and endocervical cancerApoptosis pathway"The effects of lanthanum chloride on proliferation ......"26209160
hsa-let-7a-3p

colorectal cancercell cycle pathway"NIRF is frequently upregulated in colorectal cance ......"22018986Luciferase
hsa-let-7a-3p

esophageal cancerEpithelial mesenchymal transition pathway"HMGA2 is down regulated by microRNA let 7 and asso ......"24612219
hsa-let-7a-3p

head and neck cancerEpithelial mesenchymal transition pathway"The tumour suppressor roles of the let-7 family th ......"23340306
hsa-let-7a-3p

liver cancerApoptosis pathway"The let 7 family of microRNAs inhibits Bcl xL expr ......"20347499Western blot
hsa-let-7a-3p

lung cancercell cycle pathway"Reduced miR 31 and let 7 maintain the balance betw ......"22301433
hsa-let-7a-3p

lung cancerEpithelial mesenchymal transition pathway"Specifically let-7 and miR-9 are deregulated in bo ......"23365639
hsa-let-7a-3p

lung cancerApoptosis pathway"Specifically following HDAC inhibition MYC which n ......"26915294
hsa-let-7a-3p

lung squamous cell cancercell cycle pathway"Flow cytometry analysis revealed these miRNAs indu ......"19688090Flow cytometry
hsa-let-7a-3p

ovarian cancerApoptosis pathway"Estrogen combined with progesterone decreases cell ......"24643702MTT assay; Western blot
hsa-let-7a-3p

prostate cancercell cycle pathway"MicroRNA let 7a inhibits proliferation of human pr ......"20418948Western blot; Luciferase
hsa-let-7a-3p

prostate cancercell cycle pathway"Distinct microRNA expression profiles in prostate ......"22719071
hsa-let-7a-3p

prostate cancercell cycle pathway; Apoptosis pathway"Reduced microRNA miRNA let-7a expression and the a ......"23974362Western blot; Luciferase; Flow cytometry; MTT assay
hsa-let-7a-3p

sarcomaEpithelial mesenchymal transition pathway"Using miRNA microarrays capable of detecting a kno ......"24457375Cell proliferation assay; Cell Proliferation Assay
hsa-let-7a-3p

sarcomacell cycle pathway"Tumor suppressive microRNA let 7a inhibits cell pr ......"25647078
hsa-let-7a-3p

sarcomacell cycle pathway"c Myc Represses Tumor Suppressive microRNAs let 7a ......"26393798



Reported cancer prognosis affected by hsa-let-7a-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-let-7a-3p

acute myeloid leukemiadifferentiation"We studied miRNA expression of leukemic blasts of ......"20425795
hsa-let-7a-3p

acute myeloid leukemiapoor survival"MicroRNA let 7a 3 gene methylation is associated w ......"24703161
hsa-let-7a-3p

bladder cancerpoor survival"A let 7 microRNA binding site polymorphism in the ......"27620744
hsa-let-7a-3p

breast cancermalignant trasformation"To obtain insight into miRNA deregulation in breas ......"18089790
hsa-let-7a-3p

breast cancermalignant trasformation"Real-time quantitative PCR RQ-PCR is a sensitive a ......"18718003
hsa-let-7a-3p

breast cancertumorigenesis; staging; malignant trasformation"Let 7 family miRNAs regulate estrogen receptor alp ......"20535543Luciferase
hsa-let-7a-3p

breast cancermetastasis"To identify microRNAs miRNA involved in metastasis ......"21057539
hsa-let-7a-3p

breast cancerdrug resistance"let 7 microRNAs induce tamoxifen sensitivity by do ......"21826373Luciferase
hsa-let-7a-3p

breast cancertumorigenesis"LIN28: a regulator of tumor suppressing activity o ......"22081076
hsa-let-7a-3p

breast cancercell migration"MicroRNA let 7a suppresses breast cancer cell migr ......"22251626Luciferase
hsa-let-7a-3p

breast cancerdrug resistance"Lin28 mediates paclitaxel resistance by modulating ......"22808086
hsa-let-7a-3p

breast cancermotility; metastasis"The heterochronic microRNA let 7 inhibits cell mot ......"23339187
hsa-let-7a-3p

breast cancermalignant trasformation"The Wnt β catenin pathway represses let 7 microRN ......"23613467
hsa-let-7a-3p

breast cancermalignant trasformation"Here we identified 33 miRNAs with similar deregula ......"24104550
hsa-let-7a-3p

breast cancerdrug resistance"Breast cancer specific TRAIL expression mediated b ......"25150312Luciferase
hsa-let-7a-3p

breast cancermetastasis; motility"Among these we identified miRNAs previously associ ......"25277099
hsa-let-7a-3p

breast cancerstaging"MiR 208a stimulates the cocktail of SOX2 and β ca ......"26460550
hsa-let-7a-3p

breast cancerrecurrence"Multiple Let-7 family members were negatively corr ......"26717565
hsa-let-7a-3p

breast cancerdrug resistance"Specifically we will discuss key miRNAs involved i ......"27721895
hsa-let-7a-3p

colon cancerstaging"Microarray analyses of miRNAs in exosome-enriched ......"24705249
hsa-let-7a-3p

colon cancerstaging"Association study of the let 7 miRNA complementary ......"24727325
hsa-let-7a-3p

colon cancermetastasis"Nine dysregulated miRNA pairs fell into three miRN ......"25287248
hsa-let-7a-3p

colorectal cancerpoor survival"Genetic modulation of the Let 7 microRNA binding t ......"20177422
hsa-let-7a-3p

colorectal cancerdrug resistance; poor survival"A let 7 microRNA binding site polymorphism in 3' u ......"20603437
hsa-let-7a-3p

colorectal cancerstaging; poor survival"A let 7 microRNA SNP in the KRAS 3'UTR is prognost ......"21994416
hsa-let-7a-3p

colorectal cancercell migration"NIRF is frequently upregulated in colorectal cance ......"22018986Luciferase
hsa-let-7a-3p

colorectal cancermetastasis"Expression of target miRs in micro-dissected paraf ......"22120473
hsa-let-7a-3p

colorectal cancerprogression; poor survival"High let 7a microRNA levels in KRAS mutated colore ......"22584434
hsa-let-7a-3p

colorectal cancerdrug resistance"The LCS6 polymorphism in the binding site of let 7 ......"23324806
hsa-let-7a-3p

colorectal cancerworse prognosis"High expression of let-7 g was associated with a g ......"23932154
hsa-let-7a-3p

colorectal cancermetastasis"Expressions of target miRNAs in serum were evaluat ......"24653631
hsa-let-7a-3p

colorectal cancerdrug resistance"We identified a miRNA profile that was analysed by ......"25197016
hsa-let-7a-3p

colorectal cancerprogression"rs712 polymorphism within let 7 microRNA binding s ......"26543374
hsa-let-7a-3p

colorectal cancerstaging"Simultaneous Underexpression of let 7a 5p and let ......"26793011
hsa-let-7a-3p

colorectal cancerpoor survival; immune evasion; immune resistance"MicroRNA let 7 T cells and patient survival in col ......"27737877
hsa-let-7a-3p

esophageal cancermetastasis; tumorigenesis"Role of microRNA let 7 and effect to HMGA2 in esop ......"21598109Western blot
hsa-let-7a-3p

esophageal cancerstaging"Expression of circulating microRNA 20a and let 7a ......"25914476
hsa-let-7a-3p

gastric cancerpoor survival"Several microarray studies have reported microRNA ......"19951901
hsa-let-7a-3p

gastric cancermetastasis; tumorigenesis"Let 7 microRNA family is selectively secreted into ......"20949044Western blot
hsa-let-7a-3p

gastric cancerdifferentiation"CSC characteristics were checked using spheroid fo ......"22374783Colony formation
hsa-let-7a-3p

gastric cancerpoor survival; worse prognosis"A new polymorphism biomarker rs629367 associated w ......"24760009
hsa-let-7a-3p

head and neck cancerdrug resistance; metastasis; poor survival"MicroRNA let 7a represses chemoresistance and tumo ......"21292542
hsa-let-7a-3p

liver cancermotility; drug resistance"We evaluated the expression of microRNA in human H ......"21352471
hsa-let-7a-3p

lung cancerpoor survival"Reduced expression of the let 7 microRNAs in human ......"15172979
hsa-let-7a-3p

lung cancerdifferentiation"Reduced miR 31 and let 7 maintain the balance betw ......"22301433
hsa-let-7a-3p

lung cancermalignant trasformation"Targeted delivery of let 7a microRNA encapsulated ......"24293999
hsa-let-7a-3p

lung cancerpoor survival"Specifically following HDAC inhibition MYC which n ......"26915294
hsa-let-7a-3p

lung squamous cell cancerprogression"Flow cytometry analysis revealed these miRNAs indu ......"19688090Flow cytometry
hsa-let-7a-3p

lung squamous cell cancerstaging; recurrence"In an exploratory study we determined whether expr ......"20975375
hsa-let-7a-3p

lung squamous cell cancermetastasis"MicroRNA let 7a inhibits the proliferation and inv ......"23134218Cell proliferation assay; Cell Proliferation Assay
hsa-let-7a-3p

lung squamous cell cancerpoor survival"The clinical and functional significance of RNA-in ......"23349018RNAi
hsa-let-7a-3p

lung squamous cell cancermetastasis; staging; poor survival"Different members of let-7 family have been report ......"23981581
hsa-let-7a-3p

lung squamous cell cancerpoor survival"Systemic nanodelivery of miR-34 and let-7 suppress ......"25174400
hsa-let-7a-3p

lung squamous cell cancerstaging"Expression of microRNA let 7a miR 155 and miR 205 ......"27296000
hsa-let-7a-3p

melanomamalignant trasformation"A microRNA expression screen was performed analyzi ......"18379589
hsa-let-7a-3p

melanomamalignant trasformation; progression"Integrin beta 3 expression is regulated by let 7a ......"18679415
hsa-let-7a-3p

melanomaprogression"In situ analysis of melanoma samples using progres ......"23728176
hsa-let-7a-3p

melanomadifferentiation"Metabolic reprogramming of metastatic breast cance ......"25669981
hsa-let-7a-3p

ovarian cancerworse prognosis"We highlight the role of the let-7 and miR-200 fam ......"20083225
hsa-let-7a-3p

ovarian cancerdrug resistance"Luciferase assays and real-time PCRs showed that t ......"21109987Luciferase
hsa-let-7a-3p

ovarian cancermetastasis"miRNA microarray was applied to compare the miRNA ......"21122376
hsa-let-7a-3p

ovarian cancerdrug resistance; poor survival; staging; progression"Let-7 is a family of small non-coding RNAs regulat ......"21571355
hsa-let-7a-3p

ovarian cancerworse prognosis; staging"Two families of miRNAs miR-200 and let-7 are frequ ......"23237306
hsa-let-7a-3p

ovarian cancerpoor survival"Estrogen combined with progesterone decreases cell ......"24643702MTT assay; Western blot
hsa-let-7a-3p

ovarian cancerpoor survival; worse prognosis"MicroRNA let 7a modifies the effect of self renewa ......"25630839
hsa-let-7a-3p

pancreatic cancerprogression"let 7 MicroRNA transfer in pancreatic cancer deriv ......"19323605
hsa-let-7a-3p

pancreatic cancerpoor survival"The expression of miR-21 was significantly higher ......"21139804
hsa-let-7a-3p

pancreatic cancertumorigenesis"miR-122 let-7 family and miR-101 are down-regulate ......"22303361
hsa-let-7a-3p

pancreatic cancermetastasis"We therefore established a screening strategy to f ......"23733161Western blot
hsa-let-7a-3p

pancreatic cancerpoor survival"Quantitative real-time PCR qRT-PCR was subsequentl ......"26819679
hsa-let-7a-3p

pancreatic cancerdrug resistance"In particular modulations of let-7 miR-29a miR-17- ......"27539232
hsa-let-7a-3p

prostate cancerprogression; poor survival"Distinct microRNA expression profile in prostate c ......"23798998
hsa-let-7a-3p

prostate cancerprogression"Reduced microRNA miRNA let-7a expression and the a ......"23974362Western blot; Luciferase; Flow cytometry; MTT assay
hsa-let-7a-3p

prostate cancerdrug resistance; metastasis"Loss of let 7 microRNA upregulates IL 6 in bone ma ......"23977098Luciferase
hsa-let-7a-3p

prostate cancermalignant trasformation"Role of miRNA let 7 and its major targets in prost ......"25276782
hsa-let-7a-3p

sarcomamalignant trasformation"Let 7 microRNA and HMGA2 levels of expression are ......"21412931
hsa-let-7a-3p

sarcomaprogression"Tumor suppressive microRNA let 7a inhibits cell pr ......"25647078
hsa-let-7a-3p

sarcomaprogression"c Myc Represses Tumor Suppressive microRNAs let 7a ......"26393798
hsa-let-7a-3p

thyroid cancerdifferentiation"Effects of let 7 microRNA on Cell Growth and Diffe ......"19956384



Reported gene related to hsa-let-7a-3p

miRNAcancergenereportingPUBMED
hsa-let-7a-3p

bladder cancerKRAS"A let 7 microRNA binding site polymorphism in the ......"27620744
hsa-let-7a-3p

colon cancerKRAS"Association study of the let 7 miRNA complementary ......"24727325
hsa-let-7a-3p

colorectal cancerKRAS"A let 7 microRNA binding site polymorphism in 3' u ......"20603437
hsa-let-7a-3p

colorectal cancerKRAS"Let 7 microRNA binding site polymorphism in the 3' ......"24890702
hsa-let-7a-3p

colorectal cancerKRAS"The LCS6 polymorphism in the binding site of let 7 ......"23324806
hsa-let-7a-3p

colorectal cancerKRAS"A let 7 microRNA SNP in the KRAS 3'UTR is prognost ......"21994416
hsa-let-7a-3p

colorectal cancerKRAS"Let 7 miRNA binding site polymorphism in the KRAS ......"23167843
hsa-let-7a-3p

colorectal cancerKRAS"Genetic modulation of the Let 7 microRNA binding t ......"20177422
hsa-let-7a-3p

colorectal cancerKRAS"A let 7 microRNA binding site polymorphism in KRAS ......"25183481
hsa-let-7a-3p

colorectal cancerKRAS"High let 7a microRNA levels in KRAS mutated colore ......"22584434
hsa-let-7a-3p

lung squamous cell cancerKRAS"A SNP in a let 7 microRNA complementary site in th ......"18922928
hsa-let-7a-3p

esophageal cancerHMGA2"Role of microRNA let 7 and effect to HMGA2 in esop ......"21598109
hsa-let-7a-3p

esophageal cancerHMGA2"HMGA2 is down regulated by microRNA let 7 and asso ......"24612219
hsa-let-7a-3p

gastric cancerHMGA2"Since let-7 miRNAs generally play a tumor-suppress ......"20949044
hsa-let-7a-3p

gastric cancerHMGA2"Recent studies report that HMGA2 is negatively reg ......"18413822
hsa-let-7a-3p

lung cancerHMGA2"MiR-98 a member in the let-7 family acts as a nega ......"23700794
hsa-let-7a-3p

lung squamous cell cancerHMGA2"MicroRNA let 7a inhibits the proliferation and inv ......"23134218
hsa-let-7a-3p

ovarian cancerHMGA2"HMGA2 mRNA and let-7 family microRNA were detected ......"23073586
hsa-let-7a-3p

sarcomaHMGA2"Let 7 microRNA and HMGA2 levels of expression are ......"21412931
hsa-let-7a-3p

glioblastomaHRAS"Transfection of let-7 miRNA reduced expression of ......"20607356
hsa-let-7a-3p

lung cancerHRAS"Using an established orthotopic mouse lung cancer ......"18344688
hsa-let-7a-3p

lung cancerHRAS"k-Ras and c-Myc two key oncogenes in lung cancer h ......"20033209
hsa-let-7a-3p

lung squamous cell cancerHRAS"MicroRNA let 7a inhibits the proliferation and inv ......"23134218
hsa-let-7a-3p

pancreatic cancerHRAS"Because let-7 microRNA targets the K-ras oncogene ......"19323605
hsa-let-7a-3p

breast cancerLIN28A"We identified an inverse relationship between miR- ......"26460550
hsa-let-7a-3p

breast cancerLIN28A"Lin28 mediates paclitaxel resistance by modulating ......"22808086
hsa-let-7a-3p

breast cancerLIN28A"LIN28 is a RNA-binding protein that has been well ......"22081076
hsa-let-7a-3p

breast cancerLIN28A"The Wnt β catenin pathway represses let 7 microRN ......"23613467
hsa-let-7a-3p

prostate cancerLIN28A"Furthermore let-7c expression is downregulated in ......"22479342
hsa-let-7a-3p

colorectal cancerEGFR"The LCS6 polymorphism in the binding site of let 7 ......"23324806
hsa-let-7a-3p

colorectal cancerEGFR"High let 7a microRNA levels in KRAS mutated colore ......"22584434
hsa-let-7a-3p

lung cancerEGFR"We elected to validate our model in vitro by testi ......"23365639
hsa-let-7a-3p

lung cancerMYC"We elected to validate our model in vitro by testi ......"23365639
hsa-let-7a-3p

lung cancerMYC"k-Ras and c-Myc two key oncogenes in lung cancer h ......"20033209
hsa-let-7a-3p

lymphomaMYC"MicroRNA let 7a down regulates MYC and reverts MYC ......"17942906
hsa-let-7a-3p

lung cancerBCL2"As a result transcript levels of the tumor-suppres ......"26915294
hsa-let-7a-3p

ovarian cancerBCL2"Estrogen combined with progesterone decreases cell ......"24643702
hsa-let-7a-3p

liver cancerBCL2L1"The let 7 family of microRNAs inhibits Bcl xL expr ......"20347499
hsa-let-7a-3p

lung cancerBCL2L1"As a result transcript levels of the tumor-suppres ......"26915294
hsa-let-7a-3p

breast cancerDICER1"In let-7a overexpressed ZR75-1 and MM-231 cells DI ......"26460550
hsa-let-7a-3p

melanomaDICER1"Importantly we discovered that ADAR1 fundamentally ......"23728176
hsa-let-7a-3p

prostate cancerE2F2"MicroRNA let 7a inhibits proliferation of human pr ......"20418948
hsa-let-7a-3p

sarcomaE2F2"Tumor suppressive microRNA let 7a inhibits cell pr ......"25647078
hsa-let-7a-3p

breast cancerESR1"Let 7 family miRNAs regulate estrogen receptor alp ......"20535543
hsa-let-7a-3p

breast cancerESR1"let 7 microRNAs induce tamoxifen sensitivity by do ......"21826373
hsa-let-7a-3p

lymphomaHGS"Our studies here demonstrate that PRDM1/blimp-1 is ......"18583325
hsa-let-7a-3p

ovarian cancerHGS"The hazards ratios HRs for death and disease progr ......"21571355
hsa-let-7a-3p

liver cancerIL6"Knocking down IL-6 and Twist in HSCs significantly ......"21352471
hsa-let-7a-3p

prostate cancerIL6"Loss of let 7 microRNA upregulates IL 6 in bone ma ......"23977098
hsa-let-7a-3p

colorectal cancerNRGN"This method was able to detect let-7a miRNA in as ......"17944059
hsa-let-7a-3p

gastric cancerNRGN"The dynamic range and sensitivity of the let-7a mi ......"17569129
hsa-let-7a-3p

melanomaADAR"Importantly we discovered that ADAR1 fundamentally ......"23728176
hsa-let-7a-3p

melanomaBHLHE22"Transfection of melanoma cells with let-7a pre-miR ......"18679415
hsa-let-7a-3p

esophageal cancerBRD2"Let-7 expressions were detected in esophageal canc ......"21598109
hsa-let-7a-3p

breast cancerCCL21"The expression of CCR7 its ligand CCL21 and let-7a ......"22251626
hsa-let-7a-3p

prostate cancerCCND2"MicroRNA let 7a inhibits proliferation of human pr ......"20418948
hsa-let-7a-3p

breast cancerCCR7"In the present study the authors demonstrated that ......"22251626
hsa-let-7a-3p

acute myeloid leukemiaCEBPA"MicroRNA let 7a 3 gene methylation is associated w ......"24703161
hsa-let-7a-3p

gastric cancerDDR1"Let-7 g improved the effects of X-rays on GC cells ......"25972194
hsa-let-7a-3p

lung cancerEFNA1"Targeted delivery of let 7a microRNA encapsulated ......"24293999
hsa-let-7a-3p

breast cancerERBB2"For instance an abundant expression of multiple le ......"25907662
hsa-let-7a-3p

B cell lymphomaGBA"Let-7 in particular let-7b is overexpressed in DLB ......"20651244
hsa-let-7a-3p

head and neck cancerHMI"Subsequently microarray analysis followed by Ingen ......"27588466
hsa-let-7a-3p

prostate cancerIGF1R"Reduced microRNA miRNA let-7a expression and the a ......"23974362
hsa-let-7a-3p

melanomaITGA9"Transfection of melanoma cells with let-7a pre-miR ......"18679415
hsa-let-7a-3p

breast cancerKDM5B"In MCF-7 cells with stable RNAi-mediated suppressi ......"21969366
hsa-let-7a-3p

ovarian cancerKLK6"The transient transfection of hsa-let-7a to OVCAR- ......"23136250
hsa-let-7a-3p

lung cancerLAT2"A549-let-7a cell line and A549-control cell line t ......"20033209
hsa-let-7a-3p

lung squamous cell cancerLCS1"The purpose of this study was to identify single n ......"18922928
hsa-let-7a-3p

melanomaLIN28B"Mechanistically we discovered that Lin28B a well-c ......"26071398
hsa-let-7a-3p

breast cancerLMNA"Twenty-five differentially expressed miRNAs P < 0. ......"20535543
hsa-let-7a-3p

pancreatic cancerMAP2K6"Restoring let-7 levels in cancer-derived cell line ......"19323605
hsa-let-7a-3p

head and neck cancerMMP8"However the role of let-7 in head and neck cancer ......"21292542
hsa-let-7a-3p

head and neck cancerNANOG"Most importantly overexpression of let-7 or knockd ......"21292542
hsa-let-7a-3p

thyroid cancerNKX2-1"In addition let-7 enhanced transcriptional express ......"19956384
hsa-let-7a-3p

glioblastomaNRAS"Transfection of let-7 miRNA reduced expression of ......"20607356
hsa-let-7a-3p

gastric cancerPGC"This study examined the expression patterns of ser ......"25549793
hsa-let-7a-3p

ovarian cancerPGRMC1"In conclusion we propose that PGRMC1 expression is ......"21109987
hsa-let-7a-3p

ovarian cancerPIWIL1"MicroRNA let 7a modifies the effect of self renewa ......"25630839
hsa-let-7a-3p

B cell lymphomaPRDM1"Data obtained from expression analysis luciferase ......"20651244
hsa-let-7a-3p

breast cancerRASSF1"RASSF1A resulted more frequently methylated in men ......"23160909
hsa-let-7a-3p

melanomaROS1"Moreover let-7a causes mitochondrial ROS productio ......"25669981
hsa-let-7a-3p

lung squamous cell cancerSCLC1"Among them five downregulated miRNAs let-7 miR-20 ......"23117485
hsa-let-7a-3p

sarcomaSERPINH1"Using a quantitative shotgun proteomics approach w ......"24457375
hsa-let-7a-3p

ovarian cancerSLC10A4"E2 + P4 promoted the expression of let-7a and miR- ......"24643702
hsa-let-7a-3p

pancreatic cancerSOCS3"MicroRNA let 7 downregulates STAT3 phosphorylation ......"24491408
hsa-let-7a-3p

breast cancerSOX2"We identified an inverse relationship between miR- ......"26460550
hsa-let-7a-3p

colon cancerSTAB2"Nine dysregulated miRNA pairs fell into three miRN ......"25287248
hsa-let-7a-3p

pancreatic cancerSTAT3"MicroRNA let 7 downregulates STAT3 phosphorylation ......"24491408
hsa-let-7a-3p

breast cancerTAM"Transfection of let-7 mimics to Tam-resistant MCF7 ......"21826373
hsa-let-7a-3p

colorectal cancerTGFBR1"rs868 is contained in a let-7 miRNA binding site i ......"27234654
hsa-let-7a-3p

liver cancerTRIM71"Lin-41 is a stem cell-specific E3 ligase and a kno ......"23097274
hsa-let-7a-3p

liver cancerTWIST1"Knocking down IL-6 and Twist in HSCs significantly ......"21352471
hsa-let-7a-3p

sarcomaVIM"Using a quantitative shotgun proteomics approach w ......"24457375



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-let-7a-3p
ARMC8
10 cancers: BLCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.051; TCGA KIRC -0.123; TCGA KIRP -0.12; TCGA LGG -0.109; TCGA LUAD -0.079; TCGA PAAD -0.095; TCGA PRAD -0.14; TCGA SARC -0.152; TCGA STAD -0.126; TCGA UCEC -0.105
hsa-let-7a-3p
SENP7
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.096; TCGA CESC -0.122; TCGA COAD -0.122; TCGA HNSC -0.144; TCGA KIRC -0.124; TCGA KIRP -0.102; TCGA LUSC -0.117; TCGA PRAD -0.122; TCGA SARC -0.087; TCGA STAD -0.41; TCGA UCEC -0.199
hsa-let-7a-3p
AFF4
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.074; TCGA CESC -0.143; TCGA COAD -0.07; TCGA ESCA -0.124; TCGA HNSC -0.198; TCGA KIRC -0.221; TCGA KIRP -0.222; TCGA LGG -0.083; TCGA PAAD -0.248; TCGA PRAD -0.19; TCGA SARC -0.189; TCGA STAD -0.239; TCGA UCEC -0.085
hsa-let-7a-3p
AFF3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -1.067; TCGA CESC -0.513; TCGA COAD -0.459; TCGA ESCA -0.569; TCGA HNSC -0.75; TCGA KIRP -0.217; TCGA LGG -0.135; TCGA PAAD -0.452; TCGA PRAD -0.275; TCGA SARC -0.424; TCGA STAD -0.64
hsa-let-7a-3p
BST1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget
TCGA BLCA -0.261; TCGA BRCA -0.167; TCGA COAD -0.381; TCGA ESCA -0.412; TCGA HNSC -0.306; TCGA LUAD -0.149; TCGA LUSC -0.425; TCGA PAAD -0.246; TCGA PRAD -0.426; TCGA UCEC -0.333
hsa-let-7a-3p
SETX
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.075; TCGA BRCA -0.056; TCGA CESC -0.072; TCGA ESCA -0.189; TCGA HNSC -0.104; TCGA LGG -0.089; TCGA LUSC -0.076; TCGA PAAD -0.202; TCGA PRAD -0.14; TCGA STAD -0.152; TCGA UCEC -0.079
hsa-let-7a-3p
CRIM1
11 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.158; TCGA BRCA -0.108; TCGA ESCA -0.162; TCGA KIRC -0.189; TCGA LGG -0.098; TCGA LUSC -0.132; TCGA PAAD -0.235; TCGA PRAD -0.437; TCGA SARC -0.241; TCGA STAD -0.325; TCGA UCEC -0.262
hsa-let-7a-3p
NBEA
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.534; TCGA CESC -0.796; TCGA COAD -0.613; TCGA ESCA -0.794; TCGA HNSC -0.526; TCGA KIRC -0.254; TCGA KIRP -0.289; TCGA LGG -0.194; TCGA PAAD -0.465; TCGA PRAD -0.28; TCGA SARC -0.526; TCGA STAD -0.954; TCGA UCEC -0.339
hsa-let-7a-3p
CLIC4
9 cancers: BLCA; COAD; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.3; TCGA COAD -0.382; TCGA KIRP -0.191; TCGA LUSC -0.145; TCGA PAAD -0.379; TCGA PRAD -0.561; TCGA SARC -0.281; TCGA STAD -0.57; TCGA UCEC -0.374
hsa-let-7a-3p
LRRC32
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.47; TCGA BRCA -0.341; TCGA CESC -0.253; TCGA COAD -0.427; TCGA ESCA -0.52; TCGA HNSC -0.307; TCGA LUSC -0.199; TCGA PAAD -0.19; TCGA PRAD -0.238; TCGA STAD -0.247; TCGA UCEC -0.207
hsa-let-7a-3p
THRB
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.348; TCGA BRCA -0.139; TCGA COAD -0.4; TCGA ESCA -0.493; TCGA HNSC -0.298; TCGA LGG -0.195; TCGA SARC -0.487; TCGA STAD -0.439; TCGA UCEC -0.65
hsa-let-7a-3p
RAB11FIP2
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.226; TCGA COAD -0.103; TCGA ESCA -0.214; TCGA HNSC -0.108; TCGA KIRC -0.216; TCGA KIRP -0.188; TCGA LGG -0.09; TCGA OV -0.087; TCGA PAAD -0.269; TCGA PRAD -0.303; TCGA STAD -0.286; TCGA UCEC -0.31
hsa-let-7a-3p
EDIL3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.34; TCGA CESC -0.415; TCGA COAD -0.785; TCGA ESCA -0.402; TCGA HNSC -0.622; TCGA KIRP -0.541; TCGA PAAD -0.725; TCGA PRAD -1.221; TCGA SARC -0.435; TCGA STAD -0.259; TCGA UCEC -0.211
hsa-let-7a-3p
ARID4A
9 cancers: BLCA; CESC; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.117; TCGA CESC -0.172; TCGA ESCA -0.242; TCGA HNSC -0.079; TCGA PAAD -0.175; TCGA PRAD -0.206; TCGA SARC -0.216; TCGA STAD -0.268; TCGA UCEC -0.101
hsa-let-7a-3p
UBL3
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.175; TCGA CESC -0.312; TCGA ESCA -0.329; TCGA HNSC -0.261; TCGA KIRC -0.212; TCGA LGG -0.09; TCGA PAAD -0.315; TCGA PRAD -0.147; TCGA STAD -0.097; TCGA UCEC -0.162
hsa-let-7a-3p
UBR1
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.13; TCGA CESC -0.159; TCGA ESCA -0.177; TCGA HNSC -0.126; TCGA KIRC -0.188; TCGA LGG -0.122; TCGA LUSC -0.086; TCGA PAAD -0.179; TCGA PRAD -0.219; TCGA SARC -0.351; TCGA STAD -0.209
hsa-let-7a-3p
HBP1
13 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.062; TCGA COAD -0.076; TCGA HNSC -0.151; TCGA KIRC -0.156; TCGA KIRP -0.136; TCGA LUAD -0.062; TCGA LUSC -0.067; TCGA OV -0.062; TCGA PAAD -0.148; TCGA PRAD -0.075; TCGA SARC -0.134; TCGA STAD -0.106; TCGA UCEC -0.086
hsa-let-7a-3p
ST6GALNAC3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.469; TCGA BRCA -0.206; TCGA CESC -0.328; TCGA COAD -0.19; TCGA ESCA -0.507; TCGA HNSC -0.368; TCGA LUAD -0.155; TCGA LUSC -0.285; TCGA OV -0.191; TCGA PAAD -0.328; TCGA PRAD -0.513; TCGA STAD -0.255; TCGA UCEC -0.28
hsa-let-7a-3p
CDC42EP3
9 cancers: BLCA; COAD; HNSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.361; TCGA COAD -0.254; TCGA HNSC -0.123; TCGA PAAD -0.254; TCGA PRAD -0.604; TCGA SARC -0.565; TCGA THCA -0.212; TCGA STAD -0.475; TCGA UCEC -0.303
hsa-let-7a-3p
SV2B
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.508; TCGA BRCA -0.401; TCGA COAD -0.851; TCGA HNSC -0.524; TCGA LGG -0.473; TCGA LUSC -0.662; TCGA PRAD -0.661; TCGA STAD -0.599; TCGA UCEC -0.435
hsa-let-7a-3p
HEATR5A
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.098; TCGA CESC -0.181; TCGA ESCA -0.256; TCGA HNSC -0.182; TCGA KIRC -0.183; TCGA LUSC -0.121; TCGA PAAD -0.232; TCGA PRAD -0.186; TCGA THCA -0.126; TCGA STAD -0.118
hsa-let-7a-3p
UBXN2B
12 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; OV; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.076; TCGA CESC -0.135; TCGA ESCA -0.128; TCGA KIRC -0.101; TCGA KIRP -0.126; TCGA LGG -0.06; TCGA LUAD -0.078; TCGA OV -0.07; TCGA PAAD -0.12; TCGA SARC -0.132; TCGA STAD -0.153; TCGA UCEC -0.093
hsa-let-7a-3p
MAP3K8
9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUSC; PRAD; SARC; UCEC
MirTarget
TCGA BLCA -0.241; TCGA BRCA -0.224; TCGA ESCA -0.24; TCGA HNSC -0.157; TCGA LGG -0.185; TCGA LUSC -0.196; TCGA PRAD -0.293; TCGA SARC -0.233; TCGA UCEC -0.184
hsa-let-7a-3p
UBE2Q2
10 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.123; TCGA COAD -0.132; TCGA KIRC -0.106; TCGA KIRP -0.17; TCGA LGG -0.08; TCGA LUAD -0.113; TCGA PAAD -0.18; TCGA PRAD -0.081; TCGA STAD -0.304; TCGA UCEC -0.066
hsa-let-7a-3p
CNKSR2
10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.55; TCGA BRCA -0.274; TCGA ESCA -0.544; TCGA HNSC -0.722; TCGA LGG -0.224; TCGA PAAD -0.81; TCGA PRAD -0.423; TCGA SARC -0.713; TCGA STAD -1.144; TCGA UCEC -0.238
hsa-let-7a-3p
SPATA13
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC
MirTarget
TCGA BLCA -0.198; TCGA CESC -0.855; TCGA COAD -0.2; TCGA ESCA -0.605; TCGA HNSC -0.657; TCGA KIRC -0.256; TCGA KIRP -0.387; TCGA LGG -0.33; TCGA LUSC -0.209; TCGA PRAD -0.341; TCGA SARC -0.286
hsa-let-7a-3p
ROR1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.501; TCGA BRCA -0.183; TCGA CESC -0.441; TCGA COAD -0.602; TCGA ESCA -0.446; TCGA HNSC -0.619; TCGA KIRP -0.312; TCGA LGG -0.229; TCGA PAAD -0.599; TCGA PRAD -0.844; TCGA SARC -0.467; TCGA STAD -0.361
hsa-let-7a-3p
CPEB3
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUSC; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.203; TCGA CESC -0.246; TCGA ESCA -0.249; TCGA HNSC -0.262; TCGA KIRC -0.203; TCGA LUSC -0.173; TCGA PRAD -0.158; TCGA SARC -0.107; TCGA STAD -0.193
hsa-let-7a-3p
DOCK11
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.44; TCGA BRCA -0.349; TCGA CESC -0.413; TCGA ESCA -0.226; TCGA HNSC -0.153; TCGA KIRC -0.167; TCGA KIRP -0.348; TCGA LGG -0.131; TCGA LUSC -0.275; TCGA PAAD -0.378; TCGA PRAD -0.524; TCGA STAD -0.485; TCGA UCEC -0.213
hsa-let-7a-3p
PRKACB
12 cancers: BLCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.22; TCGA CESC -0.212; TCGA HNSC -0.244; TCGA KIRC -0.104; TCGA LGG -0.087; TCGA LUAD -0.11; TCGA LUSC -0.157; TCGA PAAD -0.248; TCGA PRAD -0.193; TCGA SARC -0.176; TCGA STAD -0.387; TCGA UCEC -0.207
hsa-let-7a-3p
PHC3
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.108; TCGA ESCA -0.125; TCGA HNSC -0.194; TCGA KIRC -0.135; TCGA KIRP -0.179; TCGA LGG -0.107; TCGA PAAD -0.134; TCGA PRAD -0.154; TCGA SARC -0.254; TCGA STAD -0.249; TCGA UCEC -0.064
hsa-let-7a-3p
FNIP1
11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.097; TCGA CESC -0.112; TCGA ESCA -0.187; TCGA HNSC -0.147; TCGA KIRP -0.212; TCGA LGG -0.052; TCGA LUSC -0.08; TCGA PAAD -0.188; TCGA PRAD -0.088; TCGA SARC -0.268; TCGA THCA -0.074
hsa-let-7a-3p
TSC22D1
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.235; TCGA BRCA -0.116; TCGA CESC -0.172; TCGA ESCA -0.177; TCGA KIRC -0.102; TCGA KIRP -0.118; TCGA OV -0.095; TCGA PAAD -0.132; TCGA PRAD -0.127; TCGA SARC -0.144; TCGA STAD -0.162; TCGA UCEC -0.134
hsa-let-7a-3p
PHYHIPL
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.648; TCGA BRCA -0.259; TCGA ESCA -0.618; TCGA HNSC -0.24; TCGA KIRP -0.351; TCGA LIHC -0.473; TCGA LUSC -0.405; TCGA PAAD -0.371; TCGA PRAD -0.468; TCGA SARC -0.691; TCGA STAD -0.601
hsa-let-7a-3p
KCTD12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.311; TCGA BRCA -0.265; TCGA CESC -0.209; TCGA COAD -0.447; TCGA ESCA -0.488; TCGA HNSC -0.282; TCGA KIRC -0.21; TCGA LGG -0.307; TCGA PAAD -0.405; TCGA PRAD -0.276; TCGA STAD -0.427; TCGA UCEC -0.559
hsa-let-7a-3p
SEC23A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.118; TCGA BRCA -0.083; TCGA CESC -0.103; TCGA COAD -0.13; TCGA ESCA -0.118; TCGA LUAD -0.098; TCGA PAAD -0.266; TCGA PRAD -0.503; TCGA SARC -0.108; TCGA THCA -0.081; TCGA STAD -0.307; TCGA UCEC -0.16
hsa-let-7a-3p
NECAB1
9 cancers: BLCA; BRCA; COAD; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.447; TCGA BRCA -0.229; TCGA COAD -0.706; TCGA OV -0.235; TCGA PAAD -0.431; TCGA PRAD -0.824; TCGA SARC -0.582; TCGA STAD -0.988; TCGA UCEC -0.792
hsa-let-7a-3p
NLGN1
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.619; TCGA BRCA -0.335; TCGA COAD -0.999; TCGA HNSC -0.711; TCGA KIRP -0.821; TCGA LGG -0.122; TCGA LUSC -0.425; TCGA PAAD -0.623; TCGA PRAD -0.66; TCGA SARC -0.825; TCGA STAD -0.859; TCGA UCEC -0.524
hsa-let-7a-3p
CASD1
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.175; TCGA ESCA -0.142; TCGA HNSC -0.19; TCGA KIRC -0.148; TCGA KIRP -0.165; TCGA LUAD -0.076; TCGA PAAD -0.2; TCGA PRAD -0.069; TCGA STAD -0.261; TCGA UCEC -0.117
hsa-let-7a-3p
SDC2
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.28; TCGA CESC -0.258; TCGA COAD -0.537; TCGA ESCA -0.31; TCGA HNSC -0.262; TCGA LGG -0.305; TCGA LIHC -0.131; TCGA OV -0.147; TCGA PAAD -0.331; TCGA PRAD -0.292; TCGA STAD -0.336; TCGA UCEC -0.258
hsa-let-7a-3p
REV3L
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.148; TCGA CESC -0.142; TCGA ESCA -0.191; TCGA HNSC -0.119; TCGA KIRC -0.135; TCGA KIRP -0.164; TCGA LGG -0.194; TCGA PAAD -0.373; TCGA PRAD -0.373; TCGA SARC -0.177; TCGA STAD -0.318
hsa-let-7a-3p
CRTC3
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.22; TCGA CESC -0.101; TCGA COAD -0.059; TCGA ESCA -0.135; TCGA HNSC -0.173; TCGA PAAD -0.131; TCGA PRAD -0.161; TCGA SARC -0.318; TCGA STAD -0.23
hsa-let-7a-3p
GULP1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; STAD
MirTarget; mirMAP
TCGA BLCA -0.233; TCGA BRCA -0.338; TCGA COAD -0.613; TCGA ESCA -0.688; TCGA HNSC -0.595; TCGA KIRC -0.351; TCGA KIRP -0.663; TCGA PAAD -0.274; TCGA STAD -0.158
hsa-let-7a-3p
LMO3
10 cancers: BLCA; CESC; COAD; ESCA; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.241; TCGA CESC -0.447; TCGA COAD -1.317; TCGA ESCA -0.686; TCGA LGG -0.488; TCGA PAAD -0.471; TCGA PRAD -0.905; TCGA SARC -0.898; TCGA STAD -1.058; TCGA UCEC -1.044
hsa-let-7a-3p
ZNF501
9 cancers: BLCA; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.247; TCGA ESCA -0.252; TCGA HNSC -0.205; TCGA KIRC -0.217; TCGA PAAD -0.128; TCGA PRAD -0.099; TCGA SARC -0.119; TCGA STAD -0.315; TCGA UCEC -0.266
hsa-let-7a-3p
EBF3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.433; TCGA BRCA -0.374; TCGA COAD -0.559; TCGA ESCA -0.324; TCGA HNSC -0.211; TCGA LUSC -0.444; TCGA PAAD -0.41; TCGA PRAD -0.271; TCGA STAD -0.573; TCGA UCEC -0.293
hsa-let-7a-3p
PJA2
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.227; TCGA CESC -0.138; TCGA COAD -0.178; TCGA HNSC -0.177; TCGA KIRC -0.171; TCGA KIRP -0.155; TCGA LGG -0.148; TCGA PAAD -0.364; TCGA PRAD -0.327; TCGA SARC -0.303; TCGA STAD -0.38; TCGA UCEC -0.154
hsa-let-7a-3p
ROCK1
11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.16; TCGA COAD -0.11; TCGA ESCA -0.236; TCGA HNSC -0.181; TCGA LUAD -0.071; TCGA LUSC -0.092; TCGA PAAD -0.227; TCGA PRAD -0.279; TCGA SARC -0.476; TCGA STAD -0.294; TCGA UCEC -0.091
hsa-let-7a-3p
CACNA1C
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.851; TCGA BRCA -0.238; TCGA CESC -0.619; TCGA COAD -0.227; TCGA ESCA -0.585; TCGA HNSC -0.364; TCGA PAAD -0.369; TCGA PRAD -0.58; TCGA SARC -0.665; TCGA STAD -0.791; TCGA UCEC -0.242
hsa-let-7a-3p
SELE
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.672; TCGA BRCA -0.333; TCGA COAD -0.802; TCGA ESCA -0.512; TCGA HNSC -0.523; TCGA LUSC -0.884; TCGA PAAD -0.494; TCGA PRAD -0.796; TCGA STAD -0.355; TCGA UCEC -0.352
hsa-let-7a-3p
SHOC2
10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.117; TCGA COAD -0.054; TCGA HNSC -0.094; TCGA KIRC -0.102; TCGA KIRP -0.07; TCGA LUAD -0.061; TCGA PAAD -0.165; TCGA PRAD -0.122; TCGA STAD -0.065; TCGA UCEC -0.07
hsa-let-7a-3p
ZFHX4
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.334; TCGA BRCA -0.236; TCGA COAD -0.966; TCGA HNSC -0.277; TCGA KIRC -0.338; TCGA PAAD -0.604; TCGA PRAD -0.325; TCGA STAD -0.598; TCGA UCEC -0.424
hsa-let-7a-3p
MITF
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.419; TCGA BRCA -0.226; TCGA CESC -0.314; TCGA COAD -0.628; TCGA ESCA -0.487; TCGA HNSC -0.379; TCGA KIRC -0.178; TCGA KIRP -0.358; TCGA LUSC -0.18; TCGA PAAD -0.341; TCGA PRAD -0.538; TCGA SARC -0.529; TCGA THCA -0.082; TCGA STAD -0.44; TCGA UCEC -0.251
hsa-let-7a-3p
SLC18A2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; SARC
MirTarget; miRNATAP
TCGA BLCA -0.529; TCGA BRCA -0.553; TCGA CESC -0.485; TCGA COAD -0.398; TCGA ESCA -0.544; TCGA HNSC -0.439; TCGA KIRP -0.692; TCGA LUSC -0.299; TCGA PAAD -0.731; TCGA PRAD -1.083; TCGA SARC -0.417
hsa-let-7a-3p
TMEM56
12 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.361; TCGA ESCA -0.595; TCGA HNSC -0.34; TCGA KIRC -0.25; TCGA KIRP -0.354; TCGA LGG -0.363; TCGA LUSC -0.218; TCGA OV -0.142; TCGA PRAD -0.108; TCGA SARC -0.661; TCGA THCA -0.17; TCGA STAD -0.249
hsa-let-7a-3p
CHL1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.556; TCGA BRCA -0.555; TCGA CESC -0.571; TCGA COAD -0.94; TCGA HNSC -0.753; TCGA KIRP -0.506; TCGA LGG -0.675; TCGA PAAD -0.591; TCGA PRAD -0.593; TCGA STAD -0.468; TCGA UCEC -0.596
hsa-let-7a-3p
MDFIC
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.106; TCGA BRCA -0.163; TCGA COAD -0.327; TCGA HNSC -0.266; TCGA KIRC -0.173; TCGA KIRP -0.136; TCGA LGG -0.384; TCGA PAAD -0.274; TCGA PRAD -0.503; TCGA THCA -0.142; TCGA STAD -0.375; TCGA UCEC -0.299
hsa-let-7a-3p
PCGF5
10 cancers: BLCA; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; mirMAP
TCGA BLCA -0.079; TCGA ESCA -0.191; TCGA HNSC -0.171; TCGA KIRC -0.181; TCGA LGG -0.116; TCGA LUSC -0.178; TCGA PAAD -0.209; TCGA PRAD -0.245; TCGA SARC -0.177; TCGA STAD -0.075
hsa-let-7a-3p
RSPO3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.813; TCGA BRCA -0.396; TCGA COAD -0.801; TCGA ESCA -0.689; TCGA HNSC -0.538; TCGA LUAD -0.252; TCGA LUSC -0.365; TCGA OV -0.566; TCGA PAAD -0.708; TCGA PRAD -0.79; TCGA SARC -0.884; TCGA STAD -0.651; TCGA UCEC -0.786
hsa-let-7a-3p
AKTIP
9 cancers: BLCA; KIRC; KIRP; LGG; LUSC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.136; TCGA KIRC -0.126; TCGA KIRP -0.078; TCGA LGG -0.058; TCGA LUSC -0.105; TCGA PAAD -0.157; TCGA SARC -0.088; TCGA STAD -0.22; TCGA UCEC -0.106
hsa-let-7a-3p
ARHGAP20
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.724; TCGA BRCA -0.484; TCGA CESC -0.285; TCGA COAD -0.606; TCGA ESCA -0.332; TCGA HNSC -0.588; TCGA LGG -0.438; TCGA LUSC -0.27; TCGA PAAD -0.51; TCGA PRAD -0.943; TCGA SARC -0.8; TCGA STAD -0.694; TCGA UCEC -0.417
hsa-let-7a-3p
SBF2
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.086; TCGA CESC -0.209; TCGA ESCA -0.112; TCGA HNSC -0.133; TCGA KIRC -0.164; TCGA KIRP -0.154; TCGA PAAD -0.172; TCGA PRAD -0.188; TCGA SARC -0.159; TCGA STAD -0.256
hsa-let-7a-3p
PPM1K
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.241; TCGA CESC -0.297; TCGA COAD -0.211; TCGA ESCA -0.322; TCGA HNSC -0.229; TCGA LGG -0.111; TCGA LUSC -0.273; TCGA PAAD -0.333; TCGA SARC -0.282; TCGA STAD -0.382; TCGA UCEC -0.154
hsa-let-7a-3p
FGF13
9 cancers: BLCA; BRCA; COAD; HNSC; LUSC; OV; PAAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.477; TCGA BRCA -0.129; TCGA COAD -0.413; TCGA HNSC -0.304; TCGA LUSC -0.339; TCGA OV -0.3; TCGA PAAD -0.292; TCGA SARC -0.642; TCGA STAD -0.475
hsa-let-7a-3p
BMPR2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.153; TCGA CESC -0.115; TCGA COAD -0.175; TCGA ESCA -0.14; TCGA HNSC -0.206; TCGA PAAD -0.304; TCGA PRAD -0.254; TCGA SARC -0.111; TCGA STAD -0.278; TCGA UCEC -0.171
hsa-let-7a-3p
PHACTR2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.16; TCGA BRCA -0.08; TCGA CESC -0.173; TCGA ESCA -0.267; TCGA HNSC -0.264; TCGA LGG -0.315; TCGA LUSC -0.156; TCGA PAAD -0.322; TCGA PRAD -0.353; TCGA STAD -0.218; TCGA UCEC -0.127
hsa-let-7a-3p
RNF216
11 cancers: BLCA; COAD; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.083; TCGA COAD -0.061; TCGA HNSC -0.067; TCGA KIRP -0.135; TCGA LGG -0.059; TCGA LIHC -0.094; TCGA PAAD -0.095; TCGA PRAD -0.058; TCGA SARC -0.178; TCGA STAD -0.206; TCGA UCEC -0.125
hsa-let-7a-3p
SLMAP
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.4; TCGA COAD -0.08; TCGA ESCA -0.277; TCGA HNSC -0.076; TCGA KIRC -0.158; TCGA KIRP -0.11; TCGA LGG -0.074; TCGA PAAD -0.158; TCGA PRAD -0.453; TCGA SARC -0.91; TCGA STAD -0.515; TCGA UCEC -0.245
hsa-let-7a-3p
ATRX
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.093; TCGA CESC -0.128; TCGA COAD -0.13; TCGA ESCA -0.137; TCGA HNSC -0.189; TCGA KIRC -0.139; TCGA KIRP -0.109; TCGA LGG -0.327; TCGA LUSC -0.12; TCGA PAAD -0.255; TCGA PRAD -0.21; TCGA SARC -0.153; TCGA STAD -0.316
hsa-let-7a-3p
KIAA2022
9 cancers: BLCA; COAD; HNSC; LGG; OV; PAAD; PRAD; SARC; STAD
MirTarget; mirMAP
TCGA BLCA -0.816; TCGA COAD -1.013; TCGA HNSC -0.521; TCGA LGG -0.304; TCGA OV -0.356; TCGA PAAD -0.611; TCGA PRAD -0.208; TCGA SARC -0.942; TCGA STAD -0.976
hsa-let-7a-3p
TGFB3
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.382; TCGA BRCA -0.23; TCGA COAD -0.684; TCGA HNSC -0.217; TCGA LGG -0.128; TCGA PAAD -0.365; TCGA PRAD -0.502; TCGA STAD -0.356; TCGA UCEC -0.121
hsa-let-7a-3p
KLHL24
13 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.15; TCGA CESC -0.258; TCGA HNSC -0.39; TCGA KIRC -0.187; TCGA KIRP -0.225; TCGA LGG -0.083; TCGA LUSC -0.203; TCGA OV -0.089; TCGA PAAD -0.209; TCGA PRAD -0.131; TCGA SARC -0.19; TCGA STAD -0.231; TCGA UCEC -0.171
hsa-let-7a-3p
SLC7A2
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.365; TCGA BRCA -0.245; TCGA COAD -0.465; TCGA HNSC -0.429; TCGA LGG -0.217; TCGA PAAD -0.357; TCGA SARC -0.315; TCGA STAD -0.574; TCGA UCEC -0.376
hsa-let-7a-3p
MYCBP2
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.103; TCGA BRCA -0.104; TCGA COAD -0.109; TCGA HNSC -0.216; TCGA KIRC -0.176; TCGA LGG -0.15; TCGA PAAD -0.301; TCGA PRAD -0.293; TCGA SARC -0.11; TCGA STAD -0.199
hsa-let-7a-3p
COL4A3BP
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.101; TCGA CESC -0.128; TCGA ESCA -0.126; TCGA HNSC -0.108; TCGA KIRC -0.125; TCGA KIRP -0.09; TCGA LGG -0.128; TCGA LUSC -0.112; TCGA PAAD -0.251; TCGA PRAD -0.146; TCGA SARC -0.191; TCGA STAD -0.156; TCGA UCEC -0.092
hsa-let-7a-3p
CLASP2
11 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.082; TCGA ESCA -0.162; TCGA HNSC -0.137; TCGA KIRC -0.154; TCGA LUAD -0.057; TCGA LUSC -0.132; TCGA PAAD -0.161; TCGA PRAD -0.098; TCGA SARC -0.079; TCGA STAD -0.251; TCGA UCEC -0.054
hsa-let-7a-3p
CAPZA2
13 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.078; TCGA COAD -0.079; TCGA ESCA -0.132; TCGA KIRC -0.103; TCGA KIRP -0.228; TCGA LGG -0.072; TCGA LUAD -0.175; TCGA PAAD -0.19; TCGA PRAD -0.177; TCGA SARC -0.164; TCGA THCA -0.081; TCGA STAD -0.147; TCGA UCEC -0.239
hsa-let-7a-3p
MEF2C
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.456; TCGA BRCA -0.165; TCGA CESC -0.285; TCGA COAD -0.444; TCGA ESCA -0.411; TCGA HNSC -0.409; TCGA LUSC -0.248; TCGA PAAD -0.323; TCGA PRAD -0.522; TCGA SARC -0.186; TCGA STAD -0.4; TCGA UCEC -0.29
hsa-let-7a-3p
EVI2A
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget
TCGA BLCA -0.275; TCGA BRCA -0.119; TCGA COAD -0.628; TCGA ESCA -0.312; TCGA HNSC -0.355; TCGA LUAD -0.153; TCGA LUSC -0.445; TCGA PAAD -0.369; TCGA PRAD -0.422; TCGA UCEC -0.234
hsa-let-7a-3p
FOXP2
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; PAAD; PRAD; SARC; STAD
MirTarget; mirMAP
TCGA BLCA -0.599; TCGA BRCA -0.448; TCGA COAD -0.871; TCGA HNSC -0.511; TCGA KIRC -0.76; TCGA PAAD -0.946; TCGA PRAD -1.124; TCGA SARC -0.482; TCGA STAD -1.054
hsa-let-7a-3p
TRAK2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.306; TCGA BRCA -0.076; TCGA CESC -0.209; TCGA COAD -0.065; TCGA ESCA -0.261; TCGA HNSC -0.171; TCGA KIRC -0.086; TCGA KIRP -0.106; TCGA PAAD -0.17; TCGA PRAD -0.178; TCGA SARC -0.164; TCGA STAD -0.295; TCGA UCEC -0.095
hsa-let-7a-3p
ZC3H6
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.162; TCGA CESC -0.189; TCGA ESCA -0.188; TCGA HNSC -0.227; TCGA KIRC -0.168; TCGA KIRP -0.164; TCGA LGG -0.061; TCGA PAAD -0.153; TCGA PRAD -0.121; TCGA SARC -0.216; TCGA STAD -0.413; TCGA UCEC -0.076
hsa-let-7a-3p
NUDT4
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; OV; PAAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.079; TCGA ESCA -0.257; TCGA HNSC -0.13; TCGA KIRC -0.174; TCGA LUAD -0.071; TCGA OV -0.099; TCGA PAAD -0.161; TCGA STAD -0.177
hsa-let-7a-3p
ADAMTSL3
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -1.037; TCGA BRCA -0.128; TCGA COAD -1.138; TCGA ESCA -0.701; TCGA HNSC -0.556; TCGA PAAD -0.679; TCGA PRAD -0.762; TCGA STAD -0.731; TCGA UCEC -0.323
hsa-let-7a-3p
MAN1A1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.328; TCGA BRCA -0.171; TCGA CESC -0.369; TCGA COAD -0.165; TCGA ESCA -0.485; TCGA HNSC -0.318; TCGA KIRC -0.341; TCGA LGG -0.264; TCGA LUAD -0.21; TCGA LUSC -0.262; TCGA PAAD -0.419; TCGA PRAD -0.634; TCGA STAD -0.248; TCGA UCEC -0.198
hsa-let-7a-3p
PIK3C2A
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.121; TCGA CESC -0.182; TCGA ESCA -0.229; TCGA HNSC -0.172; TCGA KIRC -0.215; TCGA KIRP -0.117; TCGA LGG -0.134; TCGA LUSC -0.083; TCGA PAAD -0.19; TCGA PRAD -0.214; TCGA SARC -0.221; TCGA STAD -0.203
hsa-let-7a-3p
TEAD1
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.275; TCGA COAD -0.081; TCGA ESCA -0.135; TCGA HNSC -0.145; TCGA KIRC -0.135; TCGA KIRP -0.141; TCGA PAAD -0.276; TCGA PRAD -0.492; TCGA SARC -0.234; TCGA THCA -0.088; TCGA STAD -0.56; TCGA UCEC -0.151
hsa-let-7a-3p
COL15A1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.394; TCGA BRCA -0.198; TCGA CESC -0.343; TCGA COAD -0.436; TCGA ESCA -0.487; TCGA HNSC -0.401; TCGA PAAD -0.32; TCGA PRAD -0.396; TCGA STAD -0.288; TCGA UCEC -0.165
hsa-let-7a-3p
TSPAN2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.588; TCGA BRCA -0.161; TCGA COAD -0.717; TCGA ESCA -0.434; TCGA HNSC -0.279; TCGA PAAD -0.303; TCGA PRAD -0.792; TCGA SARC -1.231; TCGA STAD -0.69; TCGA UCEC -0.778
hsa-let-7a-3p
NRXN1
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -1.018; TCGA BRCA -0.337; TCGA COAD -1.189; TCGA HNSC -0.492; TCGA LGG -0.445; TCGA PAAD -0.795; TCGA PRAD -0.873; TCGA SARC -0.786; TCGA STAD -1.055
hsa-let-7a-3p
RHOBTB3
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.219; TCGA CESC -0.406; TCGA ESCA -0.316; TCGA HNSC -0.286; TCGA KIRC -0.286; TCGA LUAD -0.13; TCGA OV -0.179; TCGA PAAD -0.276; TCGA PRAD -0.172; TCGA THCA -0.259; TCGA STAD -0.42; TCGA UCEC -0.269
hsa-let-7a-3p
PTCH1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD
MirTarget; miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.116; TCGA COAD -0.168; TCGA ESCA -0.306; TCGA HNSC -0.207; TCGA KIRC -0.192; TCGA LUSC -0.266; TCGA PAAD -0.237; TCGA PRAD -0.089
hsa-let-7a-3p
TBC1D2B
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.11; TCGA BRCA -0.18; TCGA CESC -0.127; TCGA COAD -0.142; TCGA ESCA -0.119; TCGA HNSC -0.108; TCGA PAAD -0.158; TCGA PRAD -0.188; TCGA STAD -0.165; TCGA UCEC -0.097
hsa-let-7a-3p
ZNF569
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.256; TCGA CESC -0.29; TCGA COAD -0.202; TCGA HNSC -0.227; TCGA KIRC -0.126; TCGA OV -0.169; TCGA PAAD -0.341; TCGA PRAD -0.052; TCGA STAD -0.469; TCGA UCEC -0.223
hsa-let-7a-3p
DENND4C
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.158; TCGA CESC -0.213; TCGA ESCA -0.264; TCGA HNSC -0.171; TCGA KIRC -0.127; TCGA KIRP -0.15; TCGA LGG -0.193; TCGA PAAD -0.253; TCGA PRAD -0.161; TCGA SARC -0.245; TCGA STAD -0.146; TCGA UCEC -0.107
hsa-let-7a-3p
USP12
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.157; TCGA CESC -0.333; TCGA COAD -0.191; TCGA ESCA -0.292; TCGA HNSC -0.24; TCGA KIRC -0.277; TCGA KIRP -0.221; TCGA LGG -0.156; TCGA LUAD -0.122; TCGA LUSC -0.105; TCGA PAAD -0.318; TCGA PRAD -0.503; TCGA SARC -0.393; TCGA STAD -0.309; TCGA UCEC -0.18
hsa-let-7a-3p
TACC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.476; TCGA BRCA -0.277; TCGA CESC -0.274; TCGA COAD -0.162; TCGA ESCA -0.335; TCGA HNSC -0.39; TCGA LGG -0.173; TCGA PAAD -0.265; TCGA PRAD -0.517; TCGA SARC -0.58; TCGA STAD -0.504; TCGA UCEC -0.22
hsa-let-7a-3p
FGF7
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.868; TCGA BRCA -0.292; TCGA COAD -0.684; TCGA ESCA -0.731; TCGA HNSC -0.407; TCGA LUSC -0.397; TCGA PAAD -0.77; TCGA PRAD -0.776; TCGA SARC -0.94; TCGA STAD -0.633; TCGA UCEC -0.323
hsa-let-7a-3p
SCARF1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.211; TCGA BRCA -0.287; TCGA CESC -0.258; TCGA COAD -0.28; TCGA ESCA -0.282; TCGA HNSC -0.199; TCGA PRAD -0.126; TCGA STAD -0.087; TCGA UCEC -0.187
hsa-let-7a-3p
DACT1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PRAD; STAD
MirTarget
TCGA BLCA -0.496; TCGA BRCA -0.237; TCGA CESC -0.308; TCGA COAD -0.453; TCGA ESCA -0.54; TCGA HNSC -0.315; TCGA LGG -0.232; TCGA PRAD -0.58; TCGA STAD -0.258
hsa-let-7a-3p
EML1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.592; TCGA BRCA -0.121; TCGA CESC -0.395; TCGA COAD -0.562; TCGA ESCA -0.297; TCGA HNSC -0.295; TCGA LUSC -0.348; TCGA PAAD -0.508; TCGA PRAD -0.221; TCGA SARC -0.199; TCGA STAD -0.715; TCGA UCEC -0.266
hsa-let-7a-3p
PDE5A
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.468; TCGA BRCA -0.15; TCGA CESC -0.269; TCGA COAD -0.249; TCGA ESCA -0.699; TCGA HNSC -0.363; TCGA LUSC -0.24; TCGA PAAD -0.199; TCGA PRAD -0.885; TCGA SARC -0.816; TCGA STAD -0.652
hsa-let-7a-3p
ENPP4
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.487; TCGA CESC -0.634; TCGA ESCA -0.865; TCGA HNSC -0.641; TCGA KIRC -0.309; TCGA KIRP -0.185; TCGA LUAD -0.102; TCGA LUSC -0.367; TCGA OV -0.105; TCGA PAAD -0.284; TCGA SARC -0.302; TCGA STAD -0.219
hsa-let-7a-3p
PRKAR2B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.414; TCGA BRCA -0.137; TCGA CESC -0.49; TCGA COAD -0.321; TCGA ESCA -0.472; TCGA HNSC -0.491; TCGA KIRC -0.285; TCGA LGG -0.228; TCGA LUSC -0.24; TCGA PAAD -0.319; TCGA PRAD -0.324; TCGA STAD -0.514; TCGA UCEC -0.485
hsa-let-7a-3p
FBXL3
9 cancers: BLCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.093; TCGA HNSC -0.111; TCGA KIRC -0.133; TCGA LGG -0.077; TCGA PAAD -0.224; TCGA PRAD -0.134; TCGA SARC -0.13; TCGA STAD -0.133; TCGA UCEC -0.203
hsa-let-7a-3p
SPAG9
9 cancers: BLCA; CESC; COAD; KIRP; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.132; TCGA CESC -0.091; TCGA COAD -0.106; TCGA KIRP -0.26; TCGA PAAD -0.246; TCGA PRAD -0.189; TCGA SARC -0.103; TCGA STAD -0.237; TCGA UCEC -0.116
hsa-let-7a-3p
IDS
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.12; TCGA CESC -0.238; TCGA COAD -0.258; TCGA ESCA -0.186; TCGA HNSC -0.16; TCGA KIRC -0.116; TCGA LGG -0.159; TCGA PAAD -0.274; TCGA PRAD -0.214; TCGA SARC -0.121; TCGA STAD -0.309; TCGA UCEC -0.129
hsa-let-7a-3p
MAP4K3
11 cancers: BLCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.106; TCGA ESCA -0.203; TCGA HNSC -0.121; TCGA KIRC -0.2; TCGA LGG -0.118; TCGA LUAD -0.131; TCGA LUSC -0.12; TCGA OV -0.068; TCGA PRAD -0.123; TCGA STAD -0.15; TCGA UCEC -0.151
hsa-let-7a-3p
IGF1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.924; TCGA BRCA -0.598; TCGA CESC -0.406; TCGA COAD -1.08; TCGA ESCA -0.549; TCGA HNSC -0.628; TCGA LUSC -0.719; TCGA PAAD -0.835; TCGA PRAD -0.425; TCGA STAD -0.633
hsa-let-7a-3p
HGF
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.543; TCGA BRCA -0.37; TCGA CESC -0.337; TCGA COAD -0.884; TCGA ESCA -0.819; TCGA HNSC -0.679; TCGA LUAD -0.22; TCGA LUSC -0.331; TCGA PAAD -0.64; TCGA PRAD -0.749; TCGA STAD -0.269
hsa-let-7a-3p
AKAP11
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.164; TCGA CESC -0.251; TCGA ESCA -0.259; TCGA HNSC -0.183; TCGA KIRC -0.186; TCGA KIRP -0.116; TCGA LGG -0.1; TCGA LUSC -0.11; TCGA PAAD -0.277; TCGA PRAD -0.318; TCGA SARC -0.114; TCGA STAD -0.294; TCGA UCEC -0.112
hsa-let-7a-3p
XK
9 cancers: BLCA; ESCA; HNSC; KIRC; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.29; TCGA ESCA -0.946; TCGA HNSC -0.315; TCGA KIRC -0.637; TCGA LGG -0.403; TCGA PRAD -0.532; TCGA SARC -1.096; TCGA STAD -0.214; TCGA UCEC -0.233
hsa-let-7a-3p
FNIP2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.146; TCGA CESC -0.447; TCGA ESCA -0.314; TCGA HNSC -0.364; TCGA KIRC -0.234; TCGA KIRP -0.407; TCGA PAAD -0.363; TCGA PRAD -0.212; TCGA SARC -0.359; TCGA STAD -0.077
hsa-let-7a-3p
PPP1R12A
12 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.257; TCGA COAD -0.112; TCGA ESCA -0.175; TCGA HNSC -0.123; TCGA KIRP -0.117; TCGA LUAD -0.107; TCGA LUSC -0.112; TCGA PAAD -0.264; TCGA PRAD -0.411; TCGA SARC -0.475; TCGA STAD -0.444; TCGA UCEC -0.188
hsa-let-7a-3p
APPBP2
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.075; TCGA CESC -0.119; TCGA COAD -0.074; TCGA ESCA -0.126; TCGA HNSC -0.144; TCGA KIRC -0.1; TCGA KIRP -0.176; TCGA LUAD -0.081; TCGA LUSC -0.127; TCGA OV -0.07; TCGA PAAD -0.215; TCGA PRAD -0.101; TCGA STAD -0.165; TCGA UCEC -0.161
hsa-let-7a-3p
MYLK
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.917; TCGA BRCA -0.201; TCGA CESC -0.264; TCGA COAD -0.831; TCGA ESCA -0.354; TCGA HNSC -0.185; TCGA PAAD -0.503; TCGA PRAD -1.106; TCGA SARC -1.506; TCGA STAD -1.076; TCGA UCEC -0.456
hsa-let-7a-3p
MYO9A
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.148; TCGA CESC -0.208; TCGA COAD -0.225; TCGA ESCA -0.138; TCGA HNSC -0.288; TCGA KIRC -0.321; TCGA KIRP -0.365; TCGA LGG -0.212; TCGA PAAD -0.473; TCGA PRAD -0.491; TCGA SARC -0.416; TCGA STAD -0.426
hsa-let-7a-3p
MEF2A
9 cancers: BLCA; COAD; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.106; TCGA COAD -0.103; TCGA HNSC -0.133; TCGA KIRC -0.12; TCGA PAAD -0.234; TCGA PRAD -0.338; TCGA SARC -0.326; TCGA STAD -0.325; TCGA UCEC -0.123
hsa-let-7a-3p
ABCC9
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.648; TCGA BRCA -0.351; TCGA CESC -0.466; TCGA COAD -0.797; TCGA ESCA -0.664; TCGA HNSC -0.486; TCGA LGG -0.323; TCGA PAAD -0.732; TCGA PRAD -0.873; TCGA SARC -0.713; TCGA STAD -0.911
hsa-let-7a-3p
NEDD4
9 cancers: BLCA; BRCA; COAD; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.153; TCGA BRCA -0.075; TCGA COAD -0.178; TCGA LIHC -0.287; TCGA PAAD -0.27; TCGA PRAD -0.368; TCGA SARC -0.227; TCGA STAD -0.377; TCGA UCEC -0.135
hsa-let-7a-3p
MGAT4A
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; UCEC
mirMAP
TCGA BLCA -0.31; TCGA CESC -0.434; TCGA ESCA -0.738; TCGA HNSC -0.417; TCGA KIRC -0.133; TCGA LUAD -0.197; TCGA LUSC -0.344; TCGA OV -0.097; TCGA PAAD -0.203; TCGA UCEC -0.368
hsa-let-7a-3p
CYBRD1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.376; TCGA BRCA -0.194; TCGA COAD -0.532; TCGA ESCA -0.39; TCGA HNSC -0.264; TCGA LGG -0.213; TCGA LUSC -0.197; TCGA PAAD -0.432; TCGA PRAD -0.409; TCGA SARC -0.128; TCGA STAD -0.433; TCGA UCEC -0.346
hsa-let-7a-3p
CDC14A
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.105; TCGA CESC -0.313; TCGA COAD -0.152; TCGA ESCA -0.25; TCGA HNSC -0.231; TCGA LUSC -0.272; TCGA PAAD -0.241; TCGA PRAD -0.195; TCGA STAD -0.085
hsa-let-7a-3p
COL4A4
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.726; TCGA BRCA -0.224; TCGA ESCA -0.501; TCGA HNSC -0.497; TCGA KIRC -0.268; TCGA KIRP -0.183; TCGA LGG -0.296; TCGA PRAD -0.703; TCGA STAD -0.382; TCGA UCEC -0.63
hsa-let-7a-3p
WDR7
9 cancers: BLCA; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.086; TCGA ESCA -0.118; TCGA HNSC -0.272; TCGA LGG -0.132; TCGA LUSC -0.128; TCGA PAAD -0.322; TCGA PRAD -0.197; TCGA SARC -0.191; TCGA STAD -0.163
hsa-let-7a-3p
TIMP3
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.441; TCGA BRCA -0.169; TCGA COAD -0.564; TCGA HNSC -0.263; TCGA LGG -0.181; TCGA PAAD -0.346; TCGA PRAD -0.635; TCGA STAD -0.459; TCGA UCEC -0.499
hsa-let-7a-3p
PLCB4
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; SARC
mirMAP; miRNATAP
TCGA BLCA -0.833; TCGA BRCA -0.195; TCGA CESC -0.507; TCGA ESCA -0.828; TCGA HNSC -0.404; TCGA KIRC -0.474; TCGA KIRP -0.325; TCGA LUSC -0.522; TCGA PAAD -0.294; TCGA SARC -0.749
hsa-let-7a-3p
KLHL4
9 cancers: BLCA; BRCA; COAD; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.425; TCGA BRCA -0.26; TCGA COAD -0.799; TCGA HNSC -0.364; TCGA PAAD -0.692; TCGA PRAD -0.878; TCGA SARC -0.388; TCGA STAD -0.78; TCGA UCEC -0.464
hsa-let-7a-3p
KLF8
10 cancers: BLCA; BRCA; COAD; HNSC; LGG; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.283; TCGA BRCA -0.253; TCGA COAD -0.482; TCGA HNSC -0.296; TCGA LGG -0.254; TCGA PRAD -0.561; TCGA SARC -0.715; TCGA THCA -0.189; TCGA STAD -0.612; TCGA UCEC -0.487
hsa-let-7a-3p
GLIS3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC
mirMAP
TCGA BLCA -0.317; TCGA BRCA -0.111; TCGA CESC -0.437; TCGA COAD -0.383; TCGA ESCA -0.523; TCGA HNSC -0.35; TCGA KIRC -0.188; TCGA KIRP -0.234; TCGA LGG -0.199; TCGA PRAD -0.486; TCGA SARC -0.342
hsa-let-7a-3p
ZFAND5
9 cancers: BLCA; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.077; TCGA ESCA -0.129; TCGA HNSC -0.088; TCGA KIRC -0.136; TCGA LGG -0.088; TCGA PAAD -0.119; TCGA PRAD -0.158; TCGA STAD -0.23; TCGA UCEC -0.083
hsa-let-7a-3p
ATE1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.158; TCGA CESC -0.198; TCGA COAD -0.133; TCGA ESCA -0.145; TCGA HNSC -0.258; TCGA KIRC -0.236; TCGA KIRP -0.349; TCGA LUAD -0.15; TCGA LUSC -0.1; TCGA PAAD -0.337; TCGA PRAD -0.401; TCGA SARC -0.249; TCGA STAD -0.115
hsa-let-7a-3p
HLF
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.927; TCGA BRCA -0.436; TCGA COAD -0.284; TCGA HNSC -0.543; TCGA KIRP -0.323; TCGA LIHC -0.302; TCGA PAAD -0.484; TCGA PRAD -0.679; TCGA SARC -0.789; TCGA STAD -1.102; TCGA UCEC -0.488
hsa-let-7a-3p
GAB1
9 cancers: BLCA; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.185; TCGA ESCA -0.203; TCGA HNSC -0.189; TCGA KIRC -0.168; TCGA PAAD -0.222; TCGA PRAD -0.255; TCGA SARC -0.16; TCGA STAD -0.372; TCGA UCEC -0.118
hsa-let-7a-3p
LIN7A
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.457; TCGA BRCA -0.49; TCGA COAD -0.471; TCGA ESCA -0.521; TCGA HNSC -0.453; TCGA KIRP -0.448; TCGA LGG -0.467; TCGA LIHC -0.298; TCGA LUAD -0.178; TCGA LUSC -0.438; TCGA PAAD -0.384; TCGA SARC -0.235; TCGA STAD -0.33
hsa-let-7a-3p
CREBL2
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.117; TCGA CESC -0.137; TCGA COAD -0.068; TCGA ESCA -0.133; TCGA HNSC -0.108; TCGA KIRC -0.159; TCGA LUSC -0.111; TCGA PAAD -0.242; TCGA PRAD -0.074; TCGA SARC -0.088; TCGA STAD -0.181; TCGA UCEC -0.115
hsa-let-7a-3p
HINT3
9 cancers: BLCA; ESCA; HNSC; KIRC; OV; PAAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.136; TCGA ESCA -0.132; TCGA HNSC -0.149; TCGA KIRC -0.091; TCGA OV -0.07; TCGA PAAD -0.131; TCGA SARC -0.103; TCGA THCA -0.054; TCGA STAD -0.168
hsa-let-7a-3p
SASH1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.358; TCGA BRCA -0.168; TCGA CESC -0.279; TCGA COAD -0.116; TCGA HNSC -0.471; TCGA KIRC -0.121; TCGA LGG -0.393; TCGA PAAD -0.339; TCGA STAD -0.37; TCGA UCEC -0.233
hsa-let-7a-3p
RAB23
13 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.428; TCGA COAD -0.268; TCGA ESCA -0.183; TCGA HNSC -0.094; TCGA KIRP -0.18; TCGA LGG -0.13; TCGA LUSC -0.121; TCGA OV -0.092; TCGA PAAD -0.432; TCGA PRAD -0.305; TCGA SARC -0.538; TCGA STAD -0.617; TCGA UCEC -0.289
hsa-let-7a-3p
ARSB
12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.145; TCGA CESC -0.233; TCGA COAD -0.166; TCGA HNSC -0.248; TCGA KIRP -0.17; TCGA LGG -0.087; TCGA LIHC -0.221; TCGA LUSC -0.125; TCGA PAAD -0.305; TCGA PRAD -0.279; TCGA SARC -0.111; TCGA STAD -0.306
hsa-let-7a-3p
RASGRF2
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.354; TCGA BRCA -0.301; TCGA COAD -0.282; TCGA ESCA -0.473; TCGA HNSC -0.411; TCGA LUSC -0.285; TCGA PAAD -0.507; TCGA PRAD -0.666; TCGA STAD -0.262
hsa-let-7a-3p
PDE4D
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.337; TCGA ESCA -0.396; TCGA HNSC -0.325; TCGA KIRC -0.182; TCGA KIRP -0.157; TCGA LGG -0.453; TCGA LUSC -0.189; TCGA PAAD -0.208; TCGA PRAD -0.414; TCGA SARC -0.766; TCGA STAD -0.368
hsa-let-7a-3p
LIFR
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.369; TCGA BRCA -0.284; TCGA COAD -0.672; TCGA HNSC -0.348; TCGA KIRC -0.313; TCGA LGG -0.2; TCGA PAAD -0.504; TCGA PRAD -0.245; TCGA STAD -0.359; TCGA UCEC -0.406
hsa-let-7a-3p
TRIM23
15 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.076; TCGA CESC -0.159; TCGA COAD -0.119; TCGA HNSC -0.168; TCGA KIRC -0.11; TCGA KIRP -0.186; TCGA LGG -0.15; TCGA LUSC -0.153; TCGA OV -0.075; TCGA PAAD -0.32; TCGA PRAD -0.217; TCGA SARC -0.189; TCGA THCA -0.062; TCGA STAD -0.286; TCGA UCEC -0.171
hsa-let-7a-3p
CPEB4
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA BLCA -0.289; TCGA CESC -0.36; TCGA COAD -0.201; TCGA ESCA -0.164; TCGA HNSC -0.324; TCGA KIRC -0.223; TCGA LGG -0.189; TCGA LUSC -0.173; TCGA PAAD -0.284; TCGA PRAD -0.307; TCGA SARC -0.529; TCGA STAD -0.192
hsa-let-7a-3p
PLCL1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.399; TCGA CESC -0.274; TCGA COAD -0.442; TCGA ESCA -0.389; TCGA HNSC -0.359; TCGA LUSC -0.245; TCGA PAAD -0.486; TCGA PRAD -0.95; TCGA SARC -0.386; TCGA STAD -0.663; TCGA UCEC -0.366
hsa-let-7a-3p
PLEKHA3
11 cancers: BLCA; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.127; TCGA ESCA -0.113; TCGA KIRC -0.116; TCGA KIRP -0.176; TCGA LUSC -0.081; TCGA PAAD -0.193; TCGA PRAD -0.098; TCGA SARC -0.154; TCGA THCA -0.05; TCGA STAD -0.109; TCGA UCEC -0.137
hsa-let-7a-3p
LEPR
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.271; TCGA BRCA -0.389; TCGA COAD -0.222; TCGA HNSC -0.159; TCGA KIRC -0.218; TCGA LUSC -0.212; TCGA PAAD -0.561; TCGA PRAD -0.697; TCGA STAD -0.458; TCGA UCEC -0.395
hsa-let-7a-3p
MTR
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.113; TCGA CESC -0.124; TCGA ESCA -0.132; TCGA HNSC -0.113; TCGA KIRC -0.165; TCGA PAAD -0.201; TCGA PRAD -0.242; TCGA SARC -0.246; TCGA STAD -0.36; TCGA UCEC -0.083
hsa-let-7a-3p
SLC19A2
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.296; TCGA CESC -0.134; TCGA ESCA -0.263; TCGA HNSC -0.105; TCGA KIRC -0.355; TCGA LGG -0.206; TCGA LUAD -0.098; TCGA PAAD -0.208; TCGA THCA -0.106; TCGA STAD -0.126; TCGA UCEC -0.09
hsa-let-7a-3p
CNR1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.44; TCGA BRCA -0.343; TCGA CESC -0.649; TCGA COAD -0.906; TCGA HNSC -0.628; TCGA KIRP -0.467; TCGA LGG -0.547; TCGA PRAD -0.685; TCGA SARC -1.123; TCGA STAD -0.856; TCGA UCEC -0.39
hsa-let-7a-3p
SGIP1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.292; TCGA CESC -0.239; TCGA COAD -0.534; TCGA ESCA -0.499; TCGA HNSC -0.191; TCGA PAAD -0.377; TCGA PRAD -0.338; TCGA SARC -0.9; TCGA STAD -0.493; TCGA UCEC -0.165
hsa-let-7a-3p
NR4A3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.592; TCGA BRCA -0.376; TCGA COAD -0.394; TCGA ESCA -0.685; TCGA HNSC -0.273; TCGA LUSC -0.466; TCGA PAAD -0.454; TCGA PRAD -0.649; TCGA SARC -0.278; TCGA STAD -0.433; TCGA UCEC -0.29
hsa-let-7a-3p
SMAD9
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.454; TCGA BRCA -0.339; TCGA CESC -0.442; TCGA COAD -0.316; TCGA ESCA -0.467; TCGA HNSC -0.637; TCGA KIRC -0.34; TCGA KIRP -0.461; TCGA PAAD -0.768; TCGA PRAD -0.558; TCGA SARC -0.267; TCGA STAD -0.74
hsa-let-7a-3p
ZNF831
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PRAD
mirMAP
TCGA BLCA -0.387; TCGA BRCA -0.457; TCGA CESC -0.299; TCGA COAD -0.451; TCGA ESCA -0.549; TCGA HNSC -0.553; TCGA LGG -0.401; TCGA LUSC -0.532; TCGA PRAD -0.391
hsa-let-7a-3p
ABCC4
9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.194; TCGA HNSC -0.127; TCGA KIRC -0.147; TCGA KIRP -0.29; TCGA LGG -0.117; TCGA LUSC -0.281; TCGA PAAD -0.452; TCGA STAD -0.184; TCGA UCEC -0.186
hsa-let-7a-3p
PTPRB
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.292; TCGA BRCA -0.355; TCGA CESC -0.375; TCGA COAD -0.103; TCGA ESCA -0.69; TCGA HNSC -0.465; TCGA PAAD -0.296; TCGA PRAD -0.383; TCGA SARC -0.312; TCGA STAD -0.255; TCGA UCEC -0.166
hsa-let-7a-3p
TMOD2
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.198; TCGA CESC -0.213; TCGA COAD -0.266; TCGA ESCA -0.248; TCGA HNSC -0.244; TCGA PAAD -0.35; TCGA PRAD -0.335; TCGA STAD -0.56; TCGA UCEC -0.253
hsa-let-7a-3p
FAM63B
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.144; TCGA CESC -0.247; TCGA COAD -0.314; TCGA ESCA -0.23; TCGA HNSC -0.409; TCGA KIRC -0.411; TCGA KIRP -0.288; TCGA LGG -0.283; TCGA LUSC -0.215; TCGA PAAD -0.365; TCGA PRAD -0.43; TCGA SARC -0.523; TCGA STAD -0.329
hsa-let-7a-3p
MAP1B
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.61; TCGA BRCA -0.14; TCGA COAD -0.552; TCGA ESCA -0.335; TCGA HNSC -0.495; TCGA KIRP -0.217; TCGA LGG -0.159; TCGA LUSC -0.347; TCGA PAAD -0.614; TCGA PRAD -0.687; TCGA SARC -0.55; TCGA STAD -0.838
hsa-let-7a-3p
PRKAB2
10 cancers: BLCA; COAD; ESCA; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.102; TCGA COAD -0.091; TCGA ESCA -0.122; TCGA KIRC -0.174; TCGA LGG -0.11; TCGA PAAD -0.108; TCGA PRAD -0.177; TCGA SARC -0.322; TCGA STAD -0.363; TCGA UCEC -0.141
hsa-let-7a-3p
TMTC1
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.497; TCGA BRCA -0.367; TCGA COAD -0.534; TCGA HNSC -0.308; TCGA LGG -0.258; TCGA PAAD -0.58; TCGA PRAD -0.625; TCGA STAD -0.681; TCGA UCEC -0.231
hsa-let-7a-3p
ROCK2
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.211; TCGA CESC -0.287; TCGA COAD -0.126; TCGA ESCA -0.245; TCGA HNSC -0.296; TCGA KIRP -0.267; TCGA LGG -0.198; TCGA LUAD -0.15; TCGA LUSC -0.182; TCGA PAAD -0.298; TCGA PRAD -0.595; TCGA SARC -0.45; TCGA STAD -0.245; TCGA UCEC -0.198
hsa-let-7a-3p
IL6ST
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.357; TCGA CESC -0.523; TCGA COAD -0.462; TCGA ESCA -0.247; TCGA HNSC -0.606; TCGA KIRC -0.389; TCGA KIRP -0.519; TCGA LGG -0.375; TCGA LUAD -0.176; TCGA LUSC -0.228; TCGA PAAD -0.574; TCGA PRAD -1.011; TCGA SARC -0.627; TCGA STAD -0.363
hsa-let-7a-3p
SOX5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.633; TCGA BRCA -0.234; TCGA CESC -0.593; TCGA COAD -0.604; TCGA ESCA -0.505; TCGA HNSC -0.643; TCGA KIRC -0.247; TCGA LGG -0.477; TCGA LUSC -0.559; TCGA PAAD -0.539; TCGA PRAD -0.892; TCGA SARC -0.583; TCGA STAD -0.497
hsa-let-7a-3p
PDGFRA
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.549; TCGA BRCA -0.329; TCGA CESC -0.432; TCGA COAD -0.468; TCGA ESCA -0.408; TCGA HNSC -0.53; TCGA LUSC -0.243; TCGA PAAD -0.526; TCGA PRAD -0.708; TCGA STAD -0.164
hsa-let-7a-3p
EPHA7
9 cancers: BLCA; CESC; COAD; HNSC; LUSC; OV; PAAD; PRAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.975; TCGA CESC -0.471; TCGA COAD -0.583; TCGA HNSC -0.837; TCGA LUSC -0.533; TCGA OV -0.319; TCGA PAAD -0.559; TCGA PRAD -0.505; TCGA STAD -1.271
hsa-let-7a-3p
SCN7A
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -1.205; TCGA BRCA -0.691; TCGA COAD -1.462; TCGA ESCA -1.03; TCGA HNSC -0.461; TCGA PAAD -0.899; TCGA PRAD -1.225; TCGA STAD -1.33; TCGA UCEC -0.502
hsa-let-7a-3p
RNF38
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.25; TCGA CESC -0.102; TCGA ESCA -0.216; TCGA HNSC -0.157; TCGA KIRC -0.092; TCGA KIRP -0.079; TCGA LGG -0.082; TCGA LUSC -0.128; TCGA PAAD -0.16; TCGA PRAD -0.186; TCGA SARC -0.403; TCGA STAD -0.353; TCGA UCEC -0.141
hsa-let-7a-3p
CPEB2
11 cancers: BLCA; CESC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.135; TCGA CESC -0.194; TCGA KIRC -0.192; TCGA KIRP -0.244; TCGA LGG -0.212; TCGA PAAD -0.15; TCGA PRAD -0.219; TCGA SARC -0.382; TCGA THCA -0.104; TCGA STAD -0.236; TCGA UCEC -0.158
hsa-let-7a-3p
YAP1
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.144; TCGA BRCA -0.121; TCGA COAD -0.107; TCGA KIRC -0.209; TCGA KIRP -0.091; TCGA LGG -0.245; TCGA OV -0.093; TCGA PAAD -0.185; TCGA PRAD -0.412; TCGA SARC -0.399; TCGA STAD -0.271; TCGA UCEC -0.146
hsa-let-7a-3p
THBS1
10 cancers: BLCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.324; TCGA COAD -0.411; TCGA ESCA -0.37; TCGA HNSC -0.258; TCGA LUSC -0.222; TCGA PAAD -0.639; TCGA PRAD -0.52; TCGA SARC -0.21; TCGA STAD -0.489; TCGA UCEC -0.23
hsa-let-7a-3p
ARHGAP29
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.245; TCGA BRCA -0.147; TCGA COAD -0.265; TCGA ESCA -0.58; TCGA HNSC -0.226; TCGA KIRC -0.133; TCGA KIRP -0.249; TCGA PRAD -0.135; TCGA SARC -0.181; TCGA STAD -0.306; TCGA UCEC -0.467
hsa-let-7a-3p
CYP1B1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.474; TCGA BRCA -0.255; TCGA CESC -0.359; TCGA COAD -0.945; TCGA ESCA -0.474; TCGA HNSC -0.626; TCGA LGG -0.35; TCGA LUAD -0.144; TCGA LUSC -0.362; TCGA PAAD -0.535; TCGA PRAD -0.349; TCGA SARC -0.556; TCGA STAD -0.64; TCGA UCEC -0.559
hsa-let-7a-3p
ENTPD1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.339; TCGA BRCA -0.069; TCGA CESC -0.134; TCGA COAD -0.273; TCGA ESCA -0.303; TCGA HNSC -0.149; TCGA LUSC -0.188; TCGA PAAD -0.24; TCGA PRAD -0.266; TCGA SARC -0.428; TCGA STAD -0.305; TCGA UCEC -0.158
hsa-let-7a-3p
SECISBP2L
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.202; TCGA CESC -0.233; TCGA COAD -0.121; TCGA ESCA -0.203; TCGA HNSC -0.292; TCGA KIRC -0.291; TCGA KIRP -0.129; TCGA PAAD -0.269; TCGA PRAD -0.229; TCGA SARC -0.215; TCGA STAD -0.257
hsa-let-7a-3p
FGF2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.57; TCGA BRCA -0.292; TCGA COAD -0.509; TCGA ESCA -0.411; TCGA HNSC -0.347; TCGA KIRC -0.414; TCGA LGG -0.213; TCGA LUSC -0.323; TCGA PAAD -0.615; TCGA PRAD -0.823; TCGA SARC -0.378; TCGA STAD -0.599; TCGA UCEC -0.398
hsa-let-7a-3p
SCARB2
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.098; TCGA COAD -0.076; TCGA ESCA -0.12; TCGA HNSC -0.083; TCGA KIRC -0.136; TCGA KIRP -0.101; TCGA PAAD -0.223; TCGA STAD -0.103; TCGA UCEC -0.072
hsa-let-7a-3p
NTRK3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.843; TCGA BRCA -0.335; TCGA CESC -0.571; TCGA COAD -0.77; TCGA ESCA -0.69; TCGA HNSC -0.469; TCGA LGG -0.149; TCGA PRAD -0.737; TCGA SARC -0.55; TCGA STAD -0.629; TCGA UCEC -0.364
hsa-let-7a-3p
ZFHX3
10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA BLCA -0.227; TCGA BRCA -0.069; TCGA ESCA -0.205; TCGA HNSC -0.25; TCGA LGG -0.131; TCGA LUSC -0.154; TCGA PAAD -0.204; TCGA PRAD -0.135; TCGA SARC -0.177; TCGA STAD -0.355
hsa-let-7a-3p
HUNK
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.514; TCGA BRCA -0.276; TCGA CESC -0.404; TCGA HNSC -0.354; TCGA KIRP -0.341; TCGA PRAD -0.384; TCGA SARC -0.498; TCGA THCA -0.258; TCGA UCEC -0.205
hsa-let-7a-3p
ZNF660
9 cancers: BLCA; BRCA; ESCA; KIRC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.483; TCGA BRCA -0.112; TCGA ESCA -0.393; TCGA KIRC -0.235; TCGA PAAD -0.419; TCGA PRAD -0.708; TCGA SARC -0.354; TCGA STAD -0.747; TCGA UCEC -0.282
hsa-let-7a-3p
PHLDB2
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.2; TCGA BRCA -0.266; TCGA COAD -0.696; TCGA KIRC -0.112; TCGA KIRP -0.189; TCGA PAAD -0.333; TCGA PRAD -0.386; TCGA SARC -0.589; TCGA THCA -0.162; TCGA STAD -0.572; TCGA UCEC -0.385
hsa-let-7a-3p
FAM160B1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.068; TCGA COAD -0.072; TCGA ESCA -0.108; TCGA HNSC -0.146; TCGA LGG -0.067; TCGA LUSC -0.086; TCGA PAAD -0.2; TCGA PRAD -0.125; TCGA STAD -0.223; TCGA UCEC -0.078
hsa-let-7a-3p
GFRA1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -1.041; TCGA CESC -0.695; TCGA COAD -0.896; TCGA ESCA -0.571; TCGA HNSC -0.716; TCGA LUSC -0.34; TCGA PAAD -0.411; TCGA PRAD -0.793; TCGA STAD -0.767; TCGA UCEC -0.707
hsa-let-7a-3p
JMY
12 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.187; TCGA CESC -0.125; TCGA HNSC -0.166; TCGA KIRC -0.164; TCGA KIRP -0.132; TCGA LGG -0.115; TCGA LUSC -0.094; TCGA PAAD -0.301; TCGA PRAD -0.144; TCGA SARC -0.236; TCGA STAD -0.412; TCGA UCEC -0.161
hsa-let-7a-3p
UTRN
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.294; TCGA BRCA -0.15; TCGA CESC -0.255; TCGA COAD -0.133; TCGA ESCA -0.313; TCGA HNSC -0.482; TCGA KIRC -0.22; TCGA LGG -0.177; TCGA LUSC -0.195; TCGA PAAD -0.312; TCGA SARC -0.297; TCGA STAD -0.337; TCGA UCEC -0.112
hsa-let-7a-3p
SCN3A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.292; TCGA BRCA -0.605; TCGA CESC -0.491; TCGA COAD -0.605; TCGA ESCA -0.444; TCGA HNSC -0.428; TCGA KIRC -0.48; TCGA LUSC -0.485; TCGA PAAD -0.526; TCGA PRAD -0.459; TCGA SARC -1.089; TCGA STAD -0.41; TCGA UCEC -0.246
hsa-let-7a-3p
KCNJ16
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUSC; OV; PRAD; UCEC
mirMAP
TCGA BLCA -0.351; TCGA BRCA -0.654; TCGA KIRC -0.27; TCGA KIRP -0.456; TCGA LGG -0.732; TCGA LUSC -0.531; TCGA OV -0.346; TCGA PRAD -0.381; TCGA UCEC -0.635
hsa-let-7a-3p
CACNA2D1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.502; TCGA BRCA -0.286; TCGA CESC -0.539; TCGA COAD -1.236; TCGA HNSC -0.826; TCGA KIRP -0.413; TCGA LGG -0.374; TCGA LUAD -0.246; TCGA LUSC -0.494; TCGA PAAD -1.026; TCGA PRAD -1.147; TCGA SARC -0.44; TCGA STAD -0.677; TCGA UCEC -0.261
hsa-let-7a-3p
TBCEL
12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.181; TCGA COAD -0.262; TCGA HNSC -0.189; TCGA KIRC -0.199; TCGA KIRP -0.166; TCGA LGG -0.109; TCGA LUSC -0.175; TCGA PAAD -0.352; TCGA PRAD -0.201; TCGA SARC -0.125; TCGA STAD -0.293; TCGA UCEC -0.18
hsa-let-7a-3p
PDE1C
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.901; TCGA BRCA -0.299; TCGA COAD -0.39; TCGA ESCA -0.727; TCGA HNSC -0.313; TCGA PAAD -0.309; TCGA PRAD -1.237; TCGA SARC -1.119; TCGA STAD -0.556; TCGA UCEC -0.205
hsa-let-7a-3p
ADAMTS5
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.344; TCGA BRCA -0.346; TCGA CESC -0.406; TCGA COAD -0.357; TCGA ESCA -0.576; TCGA HNSC -0.434; TCGA LGG -0.278; TCGA LUSC -0.257; TCGA PAAD -0.363; TCGA PRAD -0.883; TCGA STAD -0.325; TCGA UCEC -0.39
hsa-let-7a-3p
TMEM55A
13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.205; TCGA COAD -0.265; TCGA ESCA -0.238; TCGA HNSC -0.146; TCGA KIRC -0.147; TCGA LUAD -0.168; TCGA LUSC -0.283; TCGA PAAD -0.214; TCGA PRAD -0.162; TCGA SARC -0.094; TCGA THCA -0.108; TCGA STAD -0.434; TCGA UCEC -0.394
hsa-let-7a-3p
LSM11
11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.26; TCGA CESC -0.088; TCGA ESCA -0.214; TCGA HNSC -0.062; TCGA KIRP -0.113; TCGA LIHC -0.181; TCGA PAAD -0.205; TCGA PRAD -0.331; TCGA SARC -0.387; TCGA STAD -0.296; TCGA UCEC -0.1
hsa-let-7a-3p
FBXO32
10 cancers: BLCA; CESC; COAD; HNSC; LIHC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.381; TCGA CESC -0.201; TCGA COAD -0.247; TCGA HNSC -0.164; TCGA LIHC -0.389; TCGA PRAD -0.222; TCGA SARC -0.92; TCGA THCA -0.35; TCGA STAD -0.73; TCGA UCEC -0.387
hsa-let-7a-3p
KIT
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.306; TCGA BRCA -0.306; TCGA CESC -0.456; TCGA COAD -0.381; TCGA ESCA -0.458; TCGA HNSC -0.531; TCGA LGG -0.262; TCGA OV -0.203; TCGA PAAD -0.485; TCGA PRAD -0.765; TCGA STAD -0.573; TCGA UCEC -0.202
hsa-let-7a-3p
PRKAA2
9 cancers: BLCA; COAD; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.369; TCGA COAD -0.508; TCGA HNSC -0.611; TCGA KIRC -0.161; TCGA KIRP -0.174; TCGA PRAD -0.12; TCGA SARC -1.127; TCGA STAD -1.051; TCGA UCEC -0.131
hsa-let-7a-3p
FAM102B
9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.138; TCGA CESC -0.189; TCGA ESCA -0.309; TCGA HNSC -0.221; TCGA LUSC -0.163; TCGA PAAD -0.198; TCGA PRAD -0.294; TCGA SARC -0.198; TCGA STAD -0.101
hsa-let-7a-3p
KCNT2
11 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.355; TCGA BRCA -0.241; TCGA ESCA -0.578; TCGA HNSC -0.517; TCGA LGG -0.217; TCGA LUSC -0.403; TCGA PAAD -0.565; TCGA PRAD -0.861; TCGA SARC -0.307; TCGA STAD -0.702; TCGA UCEC -0.376
hsa-let-7a-3p
DUSP19
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.23; TCGA ESCA -0.2; TCGA HNSC -0.17; TCGA KIRC -0.144; TCGA KIRP -0.12; TCGA LUSC -0.137; TCGA OV -0.132; TCGA PAAD -0.285; TCGA PRAD -0.443; TCGA SARC -0.513; TCGA STAD -0.373
hsa-let-7a-3p
HIPK1
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.097; TCGA CESC -0.192; TCGA ESCA -0.149; TCGA HNSC -0.226; TCGA KIRC -0.105; TCGA LUSC -0.095; TCGA PAAD -0.198; TCGA PRAD -0.192; TCGA SARC -0.129; TCGA STAD -0.177
hsa-let-7a-3p
EIF4E3
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.246; TCGA BRCA -0.082; TCGA ESCA -0.234; TCGA HNSC -0.254; TCGA KIRP -0.119; TCGA LGG -0.22; TCGA PAAD -0.238; TCGA PRAD -0.281; TCGA SARC -0.206; TCGA STAD -0.332; TCGA UCEC -0.198
hsa-let-7a-3p
FSTL1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.32; TCGA BRCA -0.243; TCGA COAD -0.524; TCGA ESCA -0.288; TCGA HNSC -0.301; TCGA PAAD -0.393; TCGA PRAD -0.157; TCGA STAD -0.437; TCGA UCEC -0.168
hsa-let-7a-3p
RYBP
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.076; TCGA ESCA -0.167; TCGA HNSC -0.112; TCGA KIRC -0.122; TCGA KIRP -0.073; TCGA OV -0.057; TCGA PAAD -0.175; TCGA PRAD -0.063; TCGA STAD -0.141; TCGA UCEC -0.142
hsa-let-7a-3p
PRICKLE2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.539; TCGA BRCA -0.246; TCGA CESC -0.215; TCGA COAD -0.487; TCGA ESCA -0.255; TCGA LGG -0.253; TCGA PAAD -0.408; TCGA PRAD -0.762; TCGA SARC -0.207; TCGA STAD -0.844; TCGA UCEC -0.29
hsa-let-7a-3p
EBF1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.644; TCGA BRCA -0.408; TCGA CESC -0.384; TCGA COAD -0.382; TCGA ESCA -0.376; TCGA HNSC -0.363; TCGA LUSC -0.397; TCGA PAAD -0.293; TCGA PRAD -0.497; TCGA STAD -0.483
hsa-let-7a-3p
TP53INP1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.134; TCGA CESC -0.252; TCGA COAD -0.169; TCGA ESCA -0.243; TCGA HNSC -0.135; TCGA KIRP -0.122; TCGA LUSC -0.13; TCGA SARC -0.215; TCGA STAD -0.193; TCGA UCEC -0.111
hsa-let-7a-3p
ABCA1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.285; TCGA BRCA -0.164; TCGA CESC -0.229; TCGA COAD -0.394; TCGA HNSC -0.151; TCGA KIRP -0.148; TCGA LGG -0.227; TCGA LUSC -0.147; TCGA PAAD -0.372; TCGA PRAD -0.185; TCGA STAD -0.296
hsa-let-7a-3p
HDX
11 cancers: BLCA; COAD; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.241; TCGA COAD -0.415; TCGA HNSC -0.279; TCGA KIRC -0.191; TCGA LGG -0.095; TCGA LUSC -0.389; TCGA PAAD -0.276; TCGA PRAD -0.289; TCGA SARC -0.237; TCGA STAD -0.531; TCGA UCEC -0.578
hsa-let-7a-3p
CFL2
9 cancers: BLCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.453; TCGA COAD -0.423; TCGA ESCA -0.32; TCGA HNSC -0.137; TCGA PAAD -0.334; TCGA PRAD -0.541; TCGA SARC -0.697; TCGA STAD -0.784; TCGA UCEC -0.245
hsa-let-7a-3p
RAB8B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.16; TCGA BRCA -0.133; TCGA CESC -0.112; TCGA COAD -0.173; TCGA ESCA -0.2; TCGA HNSC -0.196; TCGA LGG -0.095; TCGA LUAD -0.131; TCGA LUSC -0.192; TCGA PAAD -0.233; TCGA PRAD -0.196; TCGA THCA -0.087; TCGA STAD -0.185; TCGA UCEC -0.221
hsa-let-7a-3p
FBN1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.531; TCGA BRCA -0.247; TCGA CESC -0.281; TCGA COAD -0.761; TCGA ESCA -0.573; TCGA HNSC -0.477; TCGA LGG -0.189; TCGA LUSC -0.335; TCGA PAAD -0.569; TCGA PRAD -0.629; TCGA STAD -0.393; TCGA UCEC -0.161
hsa-let-7a-3p
GFRA2
9 cancers: BLCA; BRCA; COAD; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.583; TCGA BRCA -0.511; TCGA COAD -0.53; TCGA HNSC -0.399; TCGA LUSC -0.258; TCGA PAAD -0.308; TCGA PRAD -0.462; TCGA STAD -0.525; TCGA UCEC -0.358
hsa-let-7a-3p
PRKCE
9 cancers: BLCA; CESC; ESCA; HNSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.206; TCGA CESC -0.197; TCGA ESCA -0.176; TCGA HNSC -0.198; TCGA OV -0.141; TCGA PAAD -0.224; TCGA PRAD -0.244; TCGA STAD -0.124; TCGA UCEC -0.166
hsa-let-7a-3p
SOCS5
9 cancers: BLCA; COAD; HNSC; LGG; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.133; TCGA COAD -0.075; TCGA HNSC -0.171; TCGA LGG -0.078; TCGA OV -0.079; TCGA PAAD -0.261; TCGA PRAD -0.216; TCGA STAD -0.277; TCGA UCEC -0.168
hsa-let-7a-3p
ANO5
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.881; TCGA CESC -0.707; TCGA COAD -0.586; TCGA ESCA -1.38; TCGA HNSC -0.379; TCGA KIRC -0.538; TCGA LGG -0.423; TCGA OV -0.212; TCGA PRAD -1.043; TCGA SARC -0.819; TCGA STAD -0.755; TCGA UCEC -0.504
hsa-let-7a-3p
RAB33B
10 cancers: BLCA; CESC; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.183; TCGA CESC -0.092; TCGA HNSC -0.107; TCGA KIRC -0.132; TCGA LUAD -0.079; TCGA PAAD -0.193; TCGA PRAD -0.148; TCGA SARC -0.19; TCGA STAD -0.208; TCGA UCEC -0.114
hsa-let-7a-3p
FRMD3
10 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA BLCA -0.483; TCGA CESC -0.542; TCGA ESCA -0.728; TCGA HNSC -0.507; TCGA LUAD -0.224; TCGA LUSC -0.41; TCGA PAAD -0.386; TCGA PRAD -0.744; TCGA SARC -0.214; TCGA STAD -0.166
hsa-let-7a-3p
ZMAT3
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.112; TCGA BRCA -0.085; TCGA CESC -0.257; TCGA COAD -0.34; TCGA HNSC -0.393; TCGA KIRC -0.194; TCGA KIRP -0.296; TCGA LGG -0.269; TCGA LUSC -0.179; TCGA PAAD -0.426; TCGA PRAD -0.439; TCGA THCA -0.186; TCGA STAD -0.29
hsa-let-7a-3p
DMXL1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.111; TCGA CESC -0.167; TCGA COAD -0.087; TCGA ESCA -0.131; TCGA HNSC -0.255; TCGA KIRC -0.197; TCGA KIRP -0.126; TCGA LGG -0.172; TCGA LUSC -0.136; TCGA PAAD -0.235; TCGA PRAD -0.127; TCGA SARC -0.277; TCGA STAD -0.232
hsa-let-7a-3p
BNC2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.636; TCGA BRCA -0.308; TCGA CESC -0.431; TCGA COAD -0.77; TCGA ESCA -0.375; TCGA HNSC -0.559; TCGA LGG -0.466; TCGA PAAD -0.51; TCGA PRAD -0.776; TCGA STAD -0.767; TCGA UCEC -0.508
hsa-let-7a-3p
ABCD2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.671; TCGA BRCA -0.502; TCGA CESC -0.389; TCGA COAD -0.514; TCGA ESCA -0.627; TCGA HNSC -0.55; TCGA LGG -0.718; TCGA LUSC -0.581; TCGA PAAD -0.676; TCGA PRAD -0.823; TCGA SARC -0.29; TCGA STAD -0.453; TCGA UCEC -0.268
hsa-let-7a-3p
CXorf23
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; SARC; STAD
mirMAP
TCGA BLCA -0.093; TCGA CESC -0.142; TCGA ESCA -0.254; TCGA HNSC -0.113; TCGA KIRC -0.094; TCGA KIRP -0.104; TCGA LGG -0.119; TCGA SARC -0.082; TCGA STAD -0.246
hsa-let-7a-3p
KLHL15
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.11; TCGA COAD -0.085; TCGA ESCA -0.256; TCGA HNSC -0.191; TCGA KIRC -0.195; TCGA LGG -0.156; TCGA LUAD -0.074; TCGA PAAD -0.275; TCGA PRAD -0.218; TCGA STAD -0.368; TCGA UCEC -0.137
hsa-let-7a-3p
FZD4
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.26; TCGA BRCA -0.408; TCGA CESC -0.289; TCGA COAD -0.242; TCGA ESCA -0.474; TCGA HNSC -0.179; TCGA PAAD -0.276; TCGA STAD -0.325; TCGA UCEC -0.262
hsa-let-7a-3p
ZBTB38
14 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.224; TCGA CESC -0.176; TCGA ESCA -0.215; TCGA HNSC -0.324; TCGA KIRC -0.192; TCGA KIRP -0.266; TCGA LGG -0.154; TCGA LUAD -0.07; TCGA LUSC -0.214; TCGA PAAD -0.278; TCGA PRAD -0.431; TCGA SARC -0.268; TCGA STAD -0.241; TCGA UCEC -0.173
hsa-let-7a-3p
FAM26E
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.377; TCGA BRCA -0.228; TCGA CESC -0.402; TCGA COAD -0.636; TCGA ESCA -0.547; TCGA HNSC -0.224; TCGA LUSC -0.325; TCGA PAAD -0.477; TCGA PRAD -0.376; TCGA SARC -0.241; TCGA STAD -0.329; TCGA UCEC -0.331
hsa-let-7a-3p
FIGN
10 cancers: BLCA; COAD; HNSC; KIRP; LGG; OV; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.251; TCGA COAD -0.736; TCGA HNSC -0.322; TCGA KIRP -0.302; TCGA LGG -0.206; TCGA OV -0.267; TCGA PAAD -0.329; TCGA PRAD -0.438; TCGA SARC -0.681; TCGA STAD -0.494
hsa-let-7a-3p
GRIN2A
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.591; TCGA BRCA -0.36; TCGA CESC -0.494; TCGA COAD -0.683; TCGA ESCA -0.673; TCGA HNSC -0.557; TCGA PAAD -0.534; TCGA PRAD -0.833; TCGA SARC -1.392; TCGA STAD -0.784; TCGA UCEC -0.305
hsa-let-7a-3p
PDE4B
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.351; TCGA BRCA -0.138; TCGA COAD -0.306; TCGA HNSC -0.376; TCGA LGG -0.192; TCGA LUSC -0.441; TCGA PAAD -0.364; TCGA PRAD -0.141; TCGA SARC -0.266
hsa-let-7a-3p
SESTD1
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.168; TCGA COAD -0.087; TCGA ESCA -0.215; TCGA HNSC -0.205; TCGA KIRC -0.184; TCGA KIRP -0.338; TCGA PAAD -0.156; TCGA PRAD -0.274; TCGA SARC -0.322; TCGA THCA -0.126; TCGA STAD -0.35
hsa-let-7a-3p
NHS
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA BLCA -0.177; TCGA BRCA -0.132; TCGA CESC -0.312; TCGA ESCA -0.418; TCGA HNSC -0.194; TCGA LGG -0.26; TCGA PRAD -0.668; TCGA SARC -0.504; TCGA STAD -0.235
hsa-let-7a-3p
LRRK2
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.547; TCGA BRCA -0.331; TCGA CESC -0.63; TCGA COAD -0.855; TCGA HNSC -0.641; TCGA KIRP -0.73; TCGA LGG -0.26; TCGA PAAD -0.466; TCGA PRAD -0.859; TCGA SARC -0.479; TCGA THCA -0.345; TCGA STAD -0.62; TCGA UCEC -0.441
hsa-let-7a-3p
TCF4
9 cancers: BLCA; BRCA; COAD; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.315; TCGA BRCA -0.251; TCGA COAD -0.485; TCGA HNSC -0.357; TCGA LUSC -0.192; TCGA PAAD -0.418; TCGA PRAD -0.47; TCGA STAD -0.378; TCGA UCEC -0.132
hsa-let-7a-3p
KPNA5
12 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.113; TCGA COAD -0.154; TCGA ESCA -0.328; TCGA KIRC -0.177; TCGA KIRP -0.146; TCGA LGG -0.205; TCGA LUSC -0.136; TCGA OV -0.162; TCGA PAAD -0.446; TCGA PRAD -0.362; TCGA STAD -0.349; TCGA UCEC -0.126
hsa-let-7a-3p
MFAP3L
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.245; TCGA COAD -0.237; TCGA ESCA -0.329; TCGA HNSC -0.284; TCGA KIRC -0.338; TCGA LGG -0.218; TCGA LUSC -0.319; TCGA PAAD -0.52; TCGA PRAD -0.3; TCGA STAD -0.401
hsa-let-7a-3p
ZBTB10
9 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.262; TCGA HNSC -0.558; TCGA KIRC -0.231; TCGA KIRP -0.227; TCGA LUAD -0.184; TCGA PAAD -0.333; TCGA SARC -0.245; TCGA STAD -0.409; TCGA UCEC -0.229
hsa-let-7a-3p
TMEM170B
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.37; TCGA CESC -0.379; TCGA COAD -0.25; TCGA ESCA -0.405; TCGA HNSC -0.543; TCGA LGG -0.148; TCGA LUSC -0.275; TCGA PAAD -0.339; TCGA PRAD -0.069; TCGA STAD -0.521; TCGA UCEC -0.215
hsa-let-7a-3p
DOK6
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.916; TCGA BRCA -0.164; TCGA CESC -0.497; TCGA COAD -0.54; TCGA ESCA -0.443; TCGA HNSC -0.529; TCGA PAAD -0.462; TCGA PRAD -0.315; TCGA STAD -0.564
hsa-let-7a-3p
VGLL3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.501; TCGA BRCA -0.278; TCGA COAD -0.701; TCGA ESCA -0.326; TCGA HNSC -0.425; TCGA LUSC -0.274; TCGA PAAD -0.358; TCGA PRAD -0.783; TCGA SARC -0.709; TCGA STAD -0.52; TCGA UCEC -0.421
hsa-let-7a-3p
PPP1CB
11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.133; TCGA HNSC -0.128; TCGA KIRC -0.119; TCGA KIRP -0.146; TCGA LGG -0.093; TCGA LUAD -0.07; TCGA PAAD -0.108; TCGA PRAD -0.09; TCGA SARC -0.208; TCGA STAD -0.231; TCGA UCEC -0.155
hsa-let-7a-3p
CD302
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; UCEC
mirMAP
TCGA BLCA -0.227; TCGA BRCA -0.159; TCGA CESC -0.198; TCGA COAD -0.17; TCGA ESCA -0.405; TCGA HNSC -0.278; TCGA LGG -0.177; TCGA PAAD -0.363; TCGA PRAD -0.185; TCGA UCEC -0.176
hsa-let-7a-3p
PEG10
9 cancers: BLCA; COAD; HNSC; KIRP; LUAD; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.342; TCGA COAD -0.52; TCGA HNSC -0.622; TCGA KIRP -0.293; TCGA LUAD -0.311; TCGA OV -0.219; TCGA PRAD -0.623; TCGA STAD -0.683; TCGA UCEC -0.266
hsa-let-7a-3p
CCPG1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.146; TCGA CESC -0.225; TCGA COAD -0.175; TCGA ESCA -0.333; TCGA HNSC -0.315; TCGA KIRC -0.232; TCGA KIRP -0.201; TCGA LGG -0.166; TCGA LUSC -0.167; TCGA PAAD -0.296; TCGA PRAD -0.175; TCGA SARC -0.16; TCGA STAD -0.13; TCGA UCEC -0.153
hsa-let-7a-3p
ZFPM2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.591; TCGA BRCA -0.291; TCGA COAD -0.774; TCGA ESCA -0.464; TCGA HNSC -0.551; TCGA PAAD -0.491; TCGA PRAD -0.747; TCGA SARC -0.373; TCGA STAD -0.68; TCGA UCEC -0.487
hsa-let-7a-3p
HCFC2
13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.086; TCGA COAD -0.234; TCGA ESCA -0.115; TCGA HNSC -0.111; TCGA KIRC -0.14; TCGA LGG -0.088; TCGA LUAD -0.118; TCGA LUSC -0.121; TCGA PAAD -0.38; TCGA PRAD -0.299; TCGA SARC -0.163; TCGA STAD -0.386; TCGA UCEC -0.109
hsa-let-7a-3p
ARID5B
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.331; TCGA BRCA -0.259; TCGA CESC -0.131; TCGA ESCA -0.149; TCGA HNSC -0.256; TCGA PAAD -0.296; TCGA PRAD -0.129; TCGA SARC -0.288; TCGA STAD -0.232; TCGA UCEC -0.212
hsa-let-7a-3p
SORBS1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.18; TCGA BRCA -0.344; TCGA CESC -0.595; TCGA COAD -0.55; TCGA ESCA -0.774; TCGA HNSC -0.419; TCGA PAAD -0.451; TCGA PRAD -1.025; TCGA SARC -1.382; TCGA STAD -1.028; TCGA UCEC -0.377
hsa-let-7a-3p
ANKS1B
10 cancers: BLCA; CESC; ESCA; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.779; TCGA CESC -0.416; TCGA ESCA -0.523; TCGA KIRP -0.423; TCGA LGG -0.185; TCGA LUSC -0.366; TCGA PAAD -0.419; TCGA PRAD -0.195; TCGA SARC -0.925; TCGA STAD -0.282
hsa-let-7a-3p
CELF2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.615; TCGA BRCA -0.279; TCGA CESC -0.337; TCGA ESCA -0.431; TCGA HNSC -0.477; TCGA PAAD -0.351; TCGA PRAD -0.676; TCGA SARC -0.316; TCGA STAD -0.562; TCGA UCEC -0.247
hsa-let-7a-3p
CCDC50
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.113; TCGA BRCA -0.109; TCGA COAD -0.14; TCGA HNSC -0.098; TCGA KIRP -0.158; TCGA PAAD -0.157; TCGA SARC -0.152; TCGA STAD -0.336; TCGA UCEC -0.21
hsa-let-7a-3p
NR2F2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.308; TCGA BRCA -0.142; TCGA CESC -0.306; TCGA ESCA -0.528; TCGA HNSC -0.244; TCGA PAAD -0.217; TCGA PRAD -0.199; TCGA SARC -0.368; TCGA STAD -0.21; TCGA UCEC -0.112
hsa-let-7a-3p
LRP6
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.083; TCGA CESC -0.24; TCGA COAD -0.072; TCGA ESCA -0.165; TCGA HNSC -0.173; TCGA KIRC -0.156; TCGA KIRP -0.139; TCGA OV -0.122; TCGA PAAD -0.255; TCGA PRAD -0.165; TCGA STAD -0.163; TCGA UCEC -0.082
hsa-let-7a-3p
ADCYAP1
9 cancers: BLCA; BRCA; COAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.661; TCGA BRCA -0.259; TCGA COAD -1.117; TCGA LUSC -0.36; TCGA PAAD -0.584; TCGA PRAD -0.507; TCGA SARC -0.471; TCGA STAD -0.731; TCGA UCEC -0.43
hsa-let-7a-3p
HECTD2
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.199; TCGA CESC -0.261; TCGA COAD -0.427; TCGA HNSC -0.098; TCGA KIRC -0.18; TCGA LGG -0.211; TCGA LUSC -0.153; TCGA PAAD -0.341; TCGA PRAD -0.467; TCGA STAD -0.525; TCGA UCEC -0.118
hsa-let-7a-3p
RCAN2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.744; TCGA BRCA -0.241; TCGA CESC -0.505; TCGA COAD -0.376; TCGA ESCA -0.662; TCGA HNSC -0.404; TCGA PAAD -0.402; TCGA PRAD -0.561; TCGA SARC -0.214; TCGA STAD -0.689; TCGA UCEC -0.31
hsa-let-7a-3p
FAT3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.836; TCGA BRCA -0.33; TCGA CESC -0.593; TCGA COAD -0.66; TCGA HNSC -0.465; TCGA KIRC -0.317; TCGA LGG -0.414; TCGA PAAD -0.341; TCGA PRAD -1.215; TCGA SARC -1.077; TCGA STAD -1.204
hsa-let-7a-3p
PLXNA4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.576; TCGA BRCA -0.48; TCGA CESC -0.382; TCGA COAD -0.895; TCGA ESCA -0.525; TCGA HNSC -0.358; TCGA LGG -0.58; TCGA PAAD -0.704; TCGA PRAD -0.443; TCGA SARC -1.087; TCGA STAD -0.655; TCGA UCEC -0.321
hsa-let-7a-3p
SLITRK3
9 cancers: BLCA; COAD; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.594; TCGA COAD -1.36; TCGA LGG -0.288; TCGA LUSC -0.407; TCGA PAAD -0.609; TCGA PRAD -1.144; TCGA SARC -0.936; TCGA STAD -1.147; TCGA UCEC -0.57
hsa-let-7a-3p
KALRN
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.401; TCGA BRCA -0.121; TCGA CESC -0.744; TCGA ESCA -0.694; TCGA HNSC -0.335; TCGA KIRP -0.205; TCGA LGG -0.256; TCGA OV -0.168; TCGA PRAD -0.113; TCGA SARC -0.67; TCGA STAD -0.151; TCGA UCEC -0.219
hsa-let-7a-3p
PCDH17
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.195; TCGA CESC -0.323; TCGA COAD -0.386; TCGA ESCA -0.344; TCGA HNSC -0.433; TCGA LUSC -0.352; TCGA PAAD -0.436; TCGA PRAD -0.391; TCGA STAD -0.233; TCGA UCEC -0.177
hsa-let-7a-3p
SAMD4A
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.348; TCGA BRCA -0.222; TCGA COAD -0.375; TCGA ESCA -0.396; TCGA LGG -0.223; TCGA PAAD -0.253; TCGA PRAD -0.477; TCGA SARC -0.214; TCGA THCA -0.244; TCGA STAD -0.537; TCGA UCEC -0.426
hsa-let-7a-3p
SPRY1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; OV; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.327; TCGA BRCA -0.377; TCGA CESC -0.254; TCGA ESCA -0.528; TCGA HNSC -0.248; TCGA OV -0.238; TCGA PAAD -0.275; TCGA PRAD -0.466; TCGA STAD -0.2
hsa-let-7a-3p
CLIP1
11 cancers: BLCA; COAD; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.1; TCGA COAD -0.127; TCGA KIRC -0.178; TCGA KIRP -0.202; TCGA LGG -0.179; TCGA PAAD -0.253; TCGA PRAD -0.18; TCGA SARC -0.369; TCGA THCA -0.11; TCGA STAD -0.367; TCGA UCEC -0.085
hsa-let-7a-3p
KIF5C
9 cancers: BLCA; COAD; ESCA; HNSC; LUSC; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.32; TCGA COAD -0.245; TCGA ESCA -0.604; TCGA HNSC -0.304; TCGA LUSC -0.324; TCGA PAAD -0.511; TCGA SARC -0.514; TCGA STAD -0.567; TCGA UCEC -0.171
hsa-let-7a-3p
ZNF521
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.534; TCGA BRCA -0.188; TCGA CESC -0.35; TCGA COAD -0.627; TCGA ESCA -0.278; TCGA HNSC -0.464; TCGA LGG -0.283; TCGA PAAD -0.428; TCGA PRAD -0.527; TCGA STAD -0.363; TCGA UCEC -0.241
hsa-let-7a-3p
RTN1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.206; TCGA CESC -0.363; TCGA COAD -0.581; TCGA ESCA -0.38; TCGA HNSC -0.346; TCGA LUSC -0.321; TCGA PAAD -0.453; TCGA SARC -0.371; TCGA STAD -0.308
hsa-let-7a-3p
MSRB3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.731; TCGA BRCA -0.296; TCGA COAD -0.847; TCGA ESCA -0.463; TCGA HNSC -0.323; TCGA LUSC -0.284; TCGA PAAD -0.491; TCGA PRAD -0.867; TCGA SARC -0.66; TCGA STAD -0.858; TCGA UCEC -0.397
hsa-let-7a-3p
COL4A1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.208; TCGA CESC -0.211; TCGA COAD -0.366; TCGA ESCA -0.23; TCGA HNSC -0.172; TCGA LUAD -0.118; TCGA PAAD -0.295; TCGA PRAD -0.495; TCGA SARC -0.257; TCGA STAD -0.263; TCGA UCEC -0.141
hsa-let-7a-3p
CDC14B
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; UCEC
miRNATAP
TCGA BLCA -0.104; TCGA BRCA -0.189; TCGA ESCA -0.371; TCGA HNSC -0.183; TCGA KIRC -0.136; TCGA KIRP -0.151; TCGA LGG -0.109; TCGA LUSC -0.11; TCGA PRAD -0.235; TCGA UCEC -0.08
hsa-let-7a-3p
ARL1
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.087; TCGA CESC -0.091; TCGA ESCA -0.078; TCGA HNSC -0.072; TCGA KIRC -0.173; TCGA KIRP -0.133; TCGA LGG -0.064; TCGA LUAD -0.105; TCGA PAAD -0.175; TCGA PRAD -0.066; TCGA STAD -0.057
hsa-let-7a-3p
IKZF4
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; OV; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.236; TCGA CESC -0.232; TCGA ESCA -0.189; TCGA HNSC -0.191; TCGA KIRC -0.087; TCGA OV -0.074; TCGA PAAD -0.226; TCGA PRAD -0.176; TCGA STAD -0.242
hsa-let-7a-3p
AKAP12
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.588; TCGA BRCA -0.465; TCGA COAD -0.884; TCGA ESCA -0.791; TCGA HNSC -0.518; TCGA PAAD -0.579; TCGA PRAD -0.425; TCGA SARC -0.353; TCGA STAD -0.703; TCGA UCEC -0.454
hsa-let-7a-3p
ELOVL2
9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.372; TCGA COAD -0.488; TCGA HNSC -0.507; TCGA KIRP -0.333; TCGA LGG -0.607; TCGA LUAD -0.212; TCGA SARC -0.374; TCGA STAD -0.421; TCGA UCEC -0.448
hsa-let-7a-3p
AXIN2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.581; TCGA BRCA -0.155; TCGA CESC -0.494; TCGA ESCA -0.391; TCGA HNSC -0.354; TCGA LGG -0.105; TCGA PAAD -0.176; TCGA PRAD -0.25; TCGA SARC -0.284; TCGA STAD -0.211
hsa-let-7a-3p
SMARCA2
9 cancers: BLCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.242; TCGA HNSC -0.214; TCGA KIRC -0.112; TCGA LGG -0.103; TCGA PAAD -0.253; TCGA PRAD -0.159; TCGA SARC -0.172; TCGA STAD -0.213; TCGA UCEC -0.127
hsa-let-7a-3p
ABI3BP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.981; TCGA BRCA -0.599; TCGA CESC -0.549; TCGA COAD -0.621; TCGA ESCA -0.824; TCGA HNSC -0.644; TCGA LGG -0.316; TCGA LUSC -0.424; TCGA PAAD -0.458; TCGA PRAD -0.706; TCGA SARC -0.43; TCGA STAD -0.914; TCGA UCEC -0.327
hsa-let-7a-3p
NOVA1
10 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.782; TCGA CESC -0.459; TCGA COAD -0.58; TCGA HNSC -0.488; TCGA KIRP -0.156; TCGA LUSC -0.604; TCGA PAAD -0.651; TCGA PRAD -0.47; TCGA STAD -0.761; TCGA UCEC -0.557
hsa-let-7a-3p
FYN
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.396; TCGA BRCA -0.181; TCGA CESC -0.342; TCGA ESCA -0.206; TCGA HNSC -0.266; TCGA LUSC -0.179; TCGA OV -0.155; TCGA PAAD -0.162; TCGA PRAD -0.238; TCGA THCA -0.105; TCGA STAD -0.103; TCGA UCEC -0.277
hsa-let-7a-3p
SNX9
11 cancers: BLCA; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.185; TCGA ESCA -0.216; TCGA HNSC -0.179; TCGA KIRP -0.087; TCGA LUAD -0.111; TCGA LUSC -0.15; TCGA PAAD -0.128; TCGA SARC -0.15; TCGA THCA -0.074; TCGA STAD -0.068; TCGA UCEC -0.116
hsa-let-7a-3p
SEC14L1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; OV; PAAD; PRAD
miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.057; TCGA CESC -0.216; TCGA ESCA -0.226; TCGA HNSC -0.203; TCGA LGG -0.089; TCGA LUSC -0.149; TCGA OV -0.132; TCGA PAAD -0.175; TCGA PRAD -0.166
hsa-let-7a-3p
KLHL20
10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.054; TCGA COAD -0.119; TCGA HNSC -0.091; TCGA KIRC -0.091; TCGA KIRP -0.109; TCGA PAAD -0.194; TCGA PRAD -0.253; TCGA SARC -0.211; TCGA STAD -0.146; TCGA UCEC -0.126
hsa-let-7a-3p
ELK3
10 cancers: BRCA; COAD; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.194; TCGA COAD -0.383; TCGA HNSC -0.268; TCGA KIRP -0.206; TCGA LGG -0.166; TCGA LUSC -0.161; TCGA PAAD -0.267; TCGA PRAD -0.573; TCGA STAD -0.169; TCGA UCEC -0.229
hsa-let-7a-3p
EEA1
14 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.079; TCGA COAD -0.126; TCGA HNSC -0.214; TCGA KIRC -0.166; TCGA KIRP -0.182; TCGA LGG -0.126; TCGA LUAD -0.094; TCGA LUSC -0.087; TCGA PAAD -0.365; TCGA PRAD -0.247; TCGA SARC -0.224; TCGA THCA -0.073; TCGA STAD -0.26; TCGA UCEC -0.178
hsa-let-7a-3p
RNF144A
9 cancers: BRCA; COAD; HNSC; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.119; TCGA COAD -0.206; TCGA HNSC -0.227; TCGA LUSC -0.146; TCGA OV -0.161; TCGA PAAD -0.232; TCGA THCA -0.155; TCGA STAD -0.219; TCGA UCEC -0.219
hsa-let-7a-3p
ARRDC3
9 cancers: BRCA; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BRCA -0.115; TCGA ESCA -0.179; TCGA HNSC -0.265; TCGA KIRC -0.175; TCGA LGG -0.109; TCGA PAAD -0.19; TCGA PRAD -0.291; TCGA SARC -0.11; TCGA STAD -0.294
hsa-let-7a-3p
ERAP1
12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; UCEC
MirTarget
TCGA BRCA -0.102; TCGA CESC -0.14; TCGA HNSC -0.125; TCGA KIRC -0.192; TCGA KIRP -0.161; TCGA LGG -0.259; TCGA LIHC -0.198; TCGA LUSC -0.151; TCGA PAAD -0.133; TCGA PRAD -0.349; TCGA SARC -0.122; TCGA UCEC -0.127
hsa-let-7a-3p
CCDC102B
9 cancers: BRCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.071; TCGA COAD -0.293; TCGA ESCA -0.226; TCGA HNSC -0.226; TCGA LUAD -0.098; TCGA PAAD -0.357; TCGA PRAD -0.115; TCGA STAD -0.17; TCGA UCEC -0.292
hsa-let-7a-3p
PRKAA1
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BRCA -0.075; TCGA CESC -0.104; TCGA COAD -0.075; TCGA ESCA -0.155; TCGA HNSC -0.071; TCGA KIRC -0.171; TCGA KIRP -0.092; TCGA LGG -0.062; TCGA LUAD -0.081; TCGA PAAD -0.121; TCGA PRAD -0.076; TCGA SARC -0.326; TCGA STAD -0.108; TCGA UCEC -0.191
hsa-let-7a-3p
NTN4
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.368; TCGA CESC -0.387; TCGA COAD -0.166; TCGA ESCA -0.486; TCGA HNSC -0.317; TCGA KIRC -0.256; TCGA PRAD -0.555; TCGA STAD -0.179; TCGA UCEC -0.2
hsa-let-7a-3p
FAM126A
9 cancers: BRCA; COAD; KIRP; LGG; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.187; TCGA COAD -0.422; TCGA KIRP -0.193; TCGA LGG -0.154; TCGA LUAD -0.182; TCGA PAAD -0.249; TCGA PRAD -0.362; TCGA STAD -0.297; TCGA UCEC -0.148
hsa-let-7a-3p
GALC
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; UCEC
mirMAP
TCGA BRCA -0.072; TCGA CESC -0.191; TCGA ESCA -0.436; TCGA HNSC -0.186; TCGA KIRC -0.126; TCGA LGG -0.228; TCGA PAAD -0.214; TCGA PRAD -0.171; TCGA UCEC -0.117
hsa-let-7a-3p
IPCEF1
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PRAD; SARC; UCEC
mirMAP
TCGA BRCA -0.141; TCGA CESC -0.371; TCGA ESCA -0.233; TCGA HNSC -0.448; TCGA KIRC -0.283; TCGA LUSC -0.188; TCGA PRAD -0.321; TCGA SARC -0.451; TCGA UCEC -0.14
hsa-let-7a-3p
QKI
10 cancers: BRCA; COAD; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.084; TCGA COAD -0.51; TCGA HNSC -0.114; TCGA KIRP -0.104; TCGA LGG -0.073; TCGA LUSC -0.132; TCGA PAAD -0.291; TCGA PRAD -0.236; TCGA STAD -0.376; TCGA UCEC -0.251
hsa-let-7a-3p
ARL10
9 cancers: BRCA; COAD; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.125; TCGA COAD -0.55; TCGA HNSC -0.137; TCGA KIRC -0.173; TCGA PAAD -0.36; TCGA PRAD -0.59; TCGA SARC -0.191; TCGA STAD -0.462; TCGA UCEC -0.169
hsa-let-7a-3p
NR3C1
9 cancers: BRCA; COAD; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.199; TCGA COAD -0.506; TCGA HNSC -0.102; TCGA LUSC -0.093; TCGA PAAD -0.365; TCGA PRAD -0.508; TCGA SARC -0.174; TCGA STAD -0.341; TCGA UCEC -0.408
hsa-let-7a-3p
KLF7
9 cancers: BRCA; COAD; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.175; TCGA COAD -0.26; TCGA KIRC -0.169; TCGA KIRP -0.201; TCGA PAAD -0.235; TCGA PRAD -0.507; TCGA SARC -0.352; TCGA STAD -0.264; TCGA UCEC -0.12
hsa-let-7a-3p
DMXL2
9 cancers: CESC; ESCA; HNSC; LGG; LUAD; LUSC; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA CESC -0.215; TCGA ESCA -0.233; TCGA HNSC -0.173; TCGA LGG -0.12; TCGA LUAD -0.098; TCGA LUSC -0.178; TCGA SARC -0.096; TCGA THCA -0.182; TCGA STAD -0.124
hsa-let-7a-3p
KLF12
9 cancers: CESC; COAD; HNSC; LGG; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA CESC -0.238; TCGA COAD -0.244; TCGA HNSC -0.371; TCGA LGG -0.123; TCGA OV -0.158; TCGA PAAD -0.265; TCGA PRAD -0.496; TCGA STAD -0.458; TCGA UCEC -0.168
hsa-let-7a-3p
TMED7
11 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget
TCGA CESC -0.109; TCGA HNSC -0.122; TCGA KIRC -0.198; TCGA KIRP -0.131; TCGA LGG -0.167; TCGA LUAD -0.087; TCGA LUSC -0.102; TCGA PAAD -0.229; TCGA PRAD -0.188; TCGA THCA -0.061; TCGA UCEC -0.112
hsa-let-7a-3p
DOPEY1
9 cancers: CESC; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.179; TCGA ESCA -0.145; TCGA HNSC -0.077; TCGA KIRC -0.147; TCGA LGG -0.09; TCGA PAAD -0.127; TCGA PRAD -0.118; TCGA SARC -0.099; TCGA STAD -0.127
hsa-let-7a-3p
CASP8AP2
10 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.135; TCGA HNSC -0.107; TCGA KIRC -0.153; TCGA KIRP -0.171; TCGA LGG -0.087; TCGA LUSC -0.091; TCGA PAAD -0.191; TCGA PRAD -0.303; TCGA SARC -0.228; TCGA STAD -0.245
hsa-let-7a-3p
ZNF292
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; OV; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA CESC -0.141; TCGA ESCA -0.208; TCGA HNSC -0.215; TCGA KIRC -0.151; TCGA KIRP -0.183; TCGA OV -0.079; TCGA PAAD -0.136; TCGA PRAD -0.234; TCGA SARC -0.145; TCGA STAD -0.257
hsa-let-7a-3p
LATS1
12 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; mirMAP
TCGA CESC -0.243; TCGA COAD -0.117; TCGA HNSC -0.356; TCGA KIRC -0.332; TCGA KIRP -0.278; TCGA LGG -0.201; TCGA LUAD -0.081; TCGA LUSC -0.127; TCGA PAAD -0.343; TCGA PRAD -0.388; TCGA SARC -0.172; TCGA STAD -0.221
hsa-let-7a-3p
EFR3A
11 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.099; TCGA COAD -0.098; TCGA HNSC -0.083; TCGA KIRC -0.097; TCGA KIRP -0.084; TCGA LGG -0.177; TCGA PAAD -0.219; TCGA PRAD -0.23; TCGA SARC -0.131; TCGA STAD -0.14; TCGA UCEC -0.205
hsa-let-7a-3p
GNA13
13 cancers: CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.088; TCGA COAD -0.063; TCGA ESCA -0.097; TCGA HNSC -0.167; TCGA KIRP -0.222; TCGA LGG -0.103; TCGA LUAD -0.124; TCGA LUSC -0.165; TCGA PAAD -0.18; TCGA PRAD -0.215; TCGA SARC -0.117; TCGA STAD -0.165; TCGA UCEC -0.18
hsa-let-7a-3p
GTF2A1
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC
MirTarget; miRNATAP
TCGA CESC -0.33; TCGA COAD -0.181; TCGA HNSC -0.337; TCGA KIRC -0.393; TCGA KIRP -0.345; TCGA LGG -0.211; TCGA LUAD -0.143; TCGA PAAD -0.402; TCGA PRAD -0.579; TCGA SARC -0.208
hsa-let-7a-3p
KIF3A
10 cancers: CESC; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; SARC; THCA; STAD
MirTarget; mirMAP; miRNATAP
TCGA CESC -0.153; TCGA ESCA -0.114; TCGA KIRC -0.21; TCGA KIRP -0.165; TCGA LGG -0.142; TCGA LUSC -0.111; TCGA PAAD -0.217; TCGA SARC -0.087; TCGA THCA -0.133; TCGA STAD -0.32
hsa-let-7a-3p
FBXO38
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA CESC -0.098; TCGA ESCA -0.096; TCGA HNSC -0.091; TCGA KIRC -0.095; TCGA KIRP -0.098; TCGA LUSC -0.064; TCGA PAAD -0.11; TCGA PRAD -0.06; TCGA SARC -0.129; TCGA STAD -0.103
hsa-let-7a-3p
ATF2
11 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD
MirTarget; mirMAP; miRNATAP
TCGA CESC -0.153; TCGA COAD -0.145; TCGA HNSC -0.203; TCGA KIRC -0.258; TCGA KIRP -0.353; TCGA LGG -0.125; TCGA LUAD -0.129; TCGA PAAD -0.292; TCGA PRAD -0.36; TCGA SARC -0.206; TCGA STAD -0.156
hsa-let-7a-3p
ZDHHC21
9 cancers: CESC; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.325; TCGA HNSC -0.399; TCGA KIRC -0.288; TCGA LGG -0.356; TCGA LUSC -0.193; TCGA PAAD -0.173; TCGA PRAD -0.148; TCGA SARC -0.177; TCGA STAD -0.147
hsa-let-7a-3p
CHD1
11 cancers: CESC; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.088; TCGA ESCA -0.126; TCGA HNSC -0.085; TCGA KIRP -0.111; TCGA LGG -0.09; TCGA LUSC -0.112; TCGA PAAD -0.164; TCGA PRAD -0.19; TCGA SARC -0.102; TCGA STAD -0.169; TCGA UCEC -0.093
hsa-let-7a-3p
NR2C2
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.271; TCGA ESCA -0.141; TCGA HNSC -0.23; TCGA KIRC -0.158; TCGA KIRP -0.155; TCGA LGG -0.175; TCGA PRAD -0.261; TCGA SARC -0.274; TCGA STAD -0.226
hsa-let-7a-3p
PPM1D
13 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; UCEC
MirTarget
TCGA CESC -0.163; TCGA COAD -0.074; TCGA ESCA -0.155; TCGA HNSC -0.193; TCGA KIRC -0.11; TCGA KIRP -0.18; TCGA LUAD -0.092; TCGA LUSC -0.131; TCGA OV -0.099; TCGA PAAD -0.183; TCGA PRAD -0.182; TCGA SARC -0.135; TCGA UCEC -0.186
hsa-let-7a-3p
UHMK1
11 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC
MirTarget; mirMAP
TCGA CESC -0.29; TCGA COAD -0.22; TCGA HNSC -0.426; TCGA KIRC -0.481; TCGA KIRP -0.471; TCGA LGG -0.265; TCGA LUAD -0.195; TCGA LUSC -0.205; TCGA PAAD -0.383; TCGA PRAD -0.593; TCGA SARC -0.329
hsa-let-7a-3p
GDPD1
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD
MirTarget
TCGA CESC -0.584; TCGA ESCA -0.762; TCGA HNSC -0.299; TCGA KIRC -0.208; TCGA KIRP -0.364; TCGA LGG -0.13; TCGA LIHC -0.236; TCGA LUAD -0.166; TCGA LUSC -0.393; TCGA OV -0.204; TCGA PAAD -0.296
hsa-let-7a-3p
RIC8B
10 cancers: CESC; COAD; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.101; TCGA COAD -0.066; TCGA KIRC -0.068; TCGA LUAD -0.056; TCGA LUSC -0.123; TCGA PAAD -0.196; TCGA PRAD -0.082; TCGA SARC -0.115; TCGA STAD -0.2; TCGA UCEC -0.078
hsa-let-7a-3p
RSF1
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA CESC -0.111; TCGA COAD -0.06; TCGA ESCA -0.181; TCGA HNSC -0.149; TCGA KIRC -0.154; TCGA KIRP -0.172; TCGA PAAD -0.227; TCGA PRAD -0.217; TCGA SARC -0.153; TCGA STAD -0.191; TCGA UCEC -0.112
hsa-let-7a-3p
FNDC3A
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; STAD
MirTarget; mirMAP; miRNATAP
TCGA CESC -0.286; TCGA ESCA -0.275; TCGA HNSC -0.144; TCGA KIRC -0.223; TCGA KIRP -0.144; TCGA LGG -0.12; TCGA LUSC -0.166; TCGA OV -0.072; TCGA PAAD -0.281; TCGA PRAD -0.29; TCGA STAD -0.124
hsa-let-7a-3p
ZNF430
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.467; TCGA COAD -0.115; TCGA ESCA -0.141; TCGA HNSC -0.275; TCGA KIRC -0.183; TCGA LUAD -0.083; TCGA LUSC -0.152; TCGA PAAD -0.229; TCGA PRAD -0.404; TCGA SARC -0.213; TCGA STAD -0.122
hsa-let-7a-3p
ZKSCAN1
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.35; TCGA ESCA -0.157; TCGA HNSC -0.295; TCGA KIRC -0.259; TCGA KIRP -0.294; TCGA PAAD -0.259; TCGA PRAD -0.195; TCGA SARC -0.131; TCGA STAD -0.099
hsa-let-7a-3p
ZDHHC20
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC
MirTarget
TCGA CESC -0.525; TCGA COAD -0.234; TCGA HNSC -0.428; TCGA KIRC -0.26; TCGA KIRP -0.286; TCGA LUAD -0.254; TCGA LUSC -0.2; TCGA PAAD -0.367; TCGA PRAD -0.594; TCGA SARC -0.26
hsa-let-7a-3p
SP4
11 cancers: CESC; ESCA; HNSC; KIRC; LGG; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.132; TCGA ESCA -0.227; TCGA HNSC -0.194; TCGA KIRC -0.191; TCGA LGG -0.114; TCGA OV -0.131; TCGA PAAD -0.199; TCGA PRAD -0.251; TCGA SARC -0.178; TCGA STAD -0.231; TCGA UCEC -0.147
hsa-let-7a-3p
TAOK1
13 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA CESC -0.351; TCGA COAD -0.289; TCGA ESCA -0.178; TCGA HNSC -0.474; TCGA KIRC -0.345; TCGA KIRP -0.487; TCGA LGG -0.223; TCGA LUAD -0.173; TCGA LUSC -0.168; TCGA PAAD -0.496; TCGA PRAD -0.566; TCGA SARC -0.364; TCGA STAD -0.219
hsa-let-7a-3p
RHOT1
13 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA CESC -0.09; TCGA ESCA -0.088; TCGA HNSC -0.121; TCGA KIRC -0.132; TCGA KIRP -0.135; TCGA LUAD -0.069; TCGA LUSC -0.153; TCGA PAAD -0.209; TCGA PRAD -0.13; TCGA SARC -0.148; TCGA THCA -0.085; TCGA STAD -0.196; TCGA UCEC -0.074
hsa-let-7a-3p
ZFYVE16
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA CESC -0.171; TCGA COAD -0.075; TCGA ESCA -0.127; TCGA HNSC -0.15; TCGA KIRC -0.195; TCGA KIRP -0.106; TCGA LUSC -0.156; TCGA OV -0.081; TCGA PAAD -0.177; TCGA STAD -0.206; TCGA UCEC -0.083
hsa-let-7a-3p
POLK
14 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.171; TCGA COAD -0.122; TCGA ESCA -0.113; TCGA HNSC -0.171; TCGA KIRC -0.225; TCGA KIRP -0.155; TCGA LGG -0.086; TCGA LUSC -0.14; TCGA PAAD -0.221; TCGA PRAD -0.271; TCGA SARC -0.228; TCGA THCA -0.082; TCGA STAD -0.229; TCGA UCEC -0.094
hsa-let-7a-3p
BDP1
12 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA CESC -0.155; TCGA ESCA -0.145; TCGA HNSC -0.091; TCGA KIRC -0.172; TCGA KIRP -0.169; TCGA LGG -0.12; TCGA LUSC -0.099; TCGA PAAD -0.229; TCGA PRAD -0.153; TCGA SARC -0.19; TCGA STAD -0.27; TCGA UCEC -0.069
hsa-let-7a-3p
CLOCK
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.181; TCGA COAD -0.119; TCGA HNSC -0.231; TCGA KIRC -0.303; TCGA KIRP -0.349; TCGA LGG -0.217; TCGA PAAD -0.375; TCGA PRAD -0.452; TCGA SARC -0.195; TCGA STAD -0.119
hsa-let-7a-3p
DPP8
13 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.202; TCGA COAD -0.088; TCGA ESCA -0.094; TCGA HNSC -0.272; TCGA KIRC -0.246; TCGA KIRP -0.223; TCGA LGG -0.289; TCGA LUAD -0.071; TCGA LUSC -0.118; TCGA PAAD -0.316; TCGA PRAD -0.418; TCGA SARC -0.258; TCGA STAD -0.158
hsa-let-7a-3p
N4BP2
11 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA CESC -0.303; TCGA COAD -0.259; TCGA HNSC -0.329; TCGA KIRC -0.306; TCGA KIRP -0.364; TCGA LGG -0.256; TCGA LUAD -0.157; TCGA LUSC -0.137; TCGA PAAD -0.395; TCGA PRAD -0.378; TCGA STAD -0.116
hsa-let-7a-3p
REST
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.423; TCGA COAD -0.228; TCGA HNSC -0.376; TCGA KIRC -0.394; TCGA KIRP -0.333; TCGA LUSC -0.122; TCGA PAAD -0.318; TCGA PRAD -0.53; TCGA SARC -0.242; TCGA STAD -0.137
hsa-let-7a-3p
CPD
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; THCA
mirMAP; miRNATAP
TCGA CESC -0.247; TCGA ESCA -0.192; TCGA HNSC -0.258; TCGA KIRC -0.237; TCGA KIRP -0.356; TCGA LUAD -0.226; TCGA PAAD -0.225; TCGA PRAD -0.122; TCGA THCA -0.188
hsa-let-7a-3p
HIPK3
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.416; TCGA COAD -0.264; TCGA ESCA -0.167; TCGA HNSC -0.415; TCGA KIRC -0.295; TCGA KIRP -0.37; TCGA LGG -0.237; TCGA PAAD -0.48; TCGA PRAD -0.747; TCGA SARC -0.567; TCGA STAD -0.403
hsa-let-7a-3p
SEC24A
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD
mirMAP
TCGA CESC -0.21; TCGA ESCA -0.16; TCGA HNSC -0.185; TCGA KIRC -0.131; TCGA KIRP -0.192; TCGA LGG -0.122; TCGA LUAD -0.107; TCGA LUSC -0.135; TCGA PAAD -0.204; TCGA PRAD -0.117
hsa-let-7a-3p
PRKAR2A
12 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.301; TCGA COAD -0.146; TCGA ESCA -0.171; TCGA HNSC -0.34; TCGA KIRC -0.243; TCGA KIRP -0.271; TCGA LUAD -0.13; TCGA LUSC -0.167; TCGA PAAD -0.369; TCGA PRAD -0.411; TCGA SARC -0.385; TCGA STAD -0.162
hsa-let-7a-3p
STRN
12 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.278; TCGA COAD -0.126; TCGA HNSC -0.327; TCGA KIRC -0.42; TCGA KIRP -0.35; TCGA LGG -0.164; TCGA LUAD -0.182; TCGA LUSC -0.125; TCGA PAAD -0.271; TCGA PRAD -0.419; TCGA SARC -0.168; TCGA STAD -0.096
hsa-let-7a-3p
VPS13B
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; SARC; STAD; UCEC
mirMAP
TCGA CESC -0.133; TCGA COAD -0.144; TCGA ESCA -0.106; TCGA HNSC -0.079; TCGA KIRC -0.158; TCGA KIRP -0.137; TCGA LGG -0.157; TCGA PAAD -0.243; TCGA SARC -0.16; TCGA STAD -0.207; TCGA UCEC -0.096
hsa-let-7a-3p
XPO4
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA CESC -0.125; TCGA ESCA -0.145; TCGA HNSC -0.089; TCGA KIRC -0.189; TCGA KIRP -0.077; TCGA PAAD -0.168; TCGA PRAD -0.134; TCGA STAD -0.142; TCGA UCEC -0.08
hsa-let-7a-3p
KRAS
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PRAD; THCA; UCEC
mirMAP; miRNATAP
TCGA CESC -0.121; TCGA ESCA -0.275; TCGA HNSC -0.137; TCGA KIRC -0.136; TCGA KIRP -0.14; TCGA LGG -0.163; TCGA LUAD -0.166; TCGA OV -0.109; TCGA PRAD -0.082; TCGA THCA -0.075; TCGA UCEC -0.093
hsa-let-7a-3p
APC
10 cancers: CESC; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA CESC -0.119; TCGA HNSC -0.185; TCGA KIRC -0.094; TCGA KIRP -0.135; TCGA LGG -0.209; TCGA PAAD -0.36; TCGA PRAD -0.229; TCGA SARC -0.092; TCGA STAD -0.246; TCGA UCEC -0.07
hsa-let-7a-3p
BMP2K
10 cancers: CESC; COAD; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD
mirMAP
TCGA CESC -0.133; TCGA COAD -0.166; TCGA HNSC -0.109; TCGA KIRP -0.265; TCGA LGG -0.305; TCGA LUAD -0.101; TCGA PAAD -0.257; TCGA PRAD -0.241; TCGA THCA -0.132; TCGA STAD -0.105
hsa-let-7a-3p
SBNO1
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA CESC -0.32; TCGA COAD -0.148; TCGA HNSC -0.289; TCGA KIRC -0.397; TCGA KIRP -0.423; TCGA LUAD -0.141; TCGA PAAD -0.417; TCGA PRAD -0.461; TCGA SARC -0.328; TCGA STAD -0.153
hsa-let-7a-3p
ASXL2
12 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA CESC -0.34; TCGA COAD -0.177; TCGA HNSC -0.413; TCGA KIRC -0.327; TCGA KIRP -0.473; TCGA LGG -0.299; TCGA LUAD -0.135; TCGA LUSC -0.138; TCGA PAAD -0.401; TCGA PRAD -0.548; TCGA SARC -0.277; TCGA STAD -0.097
hsa-let-7a-3p
IPMK
9 cancers: CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
mirMAP
TCGA CESC -0.27; TCGA COAD -0.142; TCGA HNSC -0.372; TCGA KIRC -0.239; TCGA KIRP -0.528; TCGA LUAD -0.258; TCGA LUSC -0.194; TCGA PAAD -0.332; TCGA PRAD -0.581
hsa-let-7a-3p
GXYLT1
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; UCEC
mirMAP
TCGA CESC -0.164; TCGA ESCA -0.191; TCGA HNSC -0.142; TCGA KIRC -0.122; TCGA KIRP -0.182; TCGA LGG -0.124; TCGA LUAD -0.107; TCGA LUSC -0.105; TCGA OV -0.111; TCGA PAAD -0.171; TCGA UCEC -0.125
hsa-let-7a-3p
CDC42SE2
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; SARC
mirMAP
TCGA CESC -0.131; TCGA ESCA -0.115; TCGA HNSC -0.104; TCGA KIRC -0.127; TCGA KIRP -0.156; TCGA LGG -0.062; TCGA LUSC -0.113; TCGA PAAD -0.105; TCGA SARC -0.108
hsa-let-7a-3p
SYNJ1
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.163; TCGA COAD -0.104; TCGA ESCA -0.155; TCGA HNSC -0.189; TCGA KIRC -0.096; TCGA KIRP -0.12; TCGA LGG -0.178; TCGA PAAD -0.244; TCGA PRAD -0.212; TCGA SARC -0.236; TCGA STAD -0.196
hsa-let-7a-3p
SON
9 cancers: CESC; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.126; TCGA HNSC -0.167; TCGA KIRC -0.099; TCGA KIRP -0.104; TCGA LGG -0.136; TCGA PAAD -0.159; TCGA PRAD -0.107; TCGA SARC -0.111; TCGA STAD -0.157
hsa-let-7a-3p
WDFY3
9 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; STAD
mirMAP; miRNATAP
TCGA CESC -0.129; TCGA COAD -0.143; TCGA HNSC -0.123; TCGA KIRC -0.158; TCGA KIRP -0.115; TCGA LGG -0.161; TCGA PAAD -0.292; TCGA PRAD -0.157; TCGA STAD -0.221
hsa-let-7a-3p
RNF169
9 cancers: CESC; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.155; TCGA COAD -0.071; TCGA HNSC -0.287; TCGA KIRC -0.16; TCGA KIRP -0.182; TCGA PAAD -0.235; TCGA PRAD -0.286; TCGA SARC -0.231; TCGA STAD -0.157
hsa-let-7a-3p
PAFAH1B2
9 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD
mirMAP
TCGA CESC -0.176; TCGA COAD -0.172; TCGA HNSC -0.165; TCGA KIRC -0.272; TCGA KIRP -0.279; TCGA LGG -0.118; TCGA LUAD -0.122; TCGA PAAD -0.264; TCGA PRAD -0.364
hsa-let-7a-3p
LIMS1
11 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA CESC -0.205; TCGA COAD -0.281; TCGA HNSC -0.332; TCGA KIRC -0.241; TCGA KIRP -0.337; TCGA LGG -0.171; TCGA LUAD -0.155; TCGA LUSC -0.12; TCGA PAAD -0.266; TCGA PRAD -0.482; TCGA STAD -0.162
hsa-let-7a-3p
RALGAPB
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA CESC -0.131; TCGA ESCA -0.092; TCGA HNSC -0.058; TCGA KIRC -0.193; TCGA KIRP -0.111; TCGA LGG -0.097; TCGA PAAD -0.119; TCGA SARC -0.068; TCGA THCA -0.102; TCGA STAD -0.099; TCGA UCEC -0.116
hsa-let-7a-3p
TNKS
9 cancers: CESC; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.155; TCGA HNSC -0.162; TCGA KIRC -0.127; TCGA KIRP -0.144; TCGA LGG -0.089; TCGA PAAD -0.182; TCGA PRAD -0.188; TCGA SARC -0.079; TCGA STAD -0.115
hsa-let-7a-3p
ZNF791
13 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.292; TCGA COAD -0.113; TCGA ESCA -0.151; TCGA HNSC -0.183; TCGA KIRC -0.237; TCGA KIRP -0.242; TCGA LGG -0.115; TCGA LUSC -0.109; TCGA OV -0.079; TCGA PAAD -0.241; TCGA PRAD -0.305; TCGA SARC -0.289; TCGA STAD -0.263
hsa-let-7a-3p
CHD9
9 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; STAD
mirMAP; miRNATAP
TCGA CESC -0.118; TCGA COAD -0.092; TCGA HNSC -0.125; TCGA KIRC -0.218; TCGA KIRP -0.172; TCGA LGG -0.134; TCGA PAAD -0.242; TCGA PRAD -0.291; TCGA STAD -0.225
hsa-let-7a-3p
DPY19L3
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA CESC -0.358; TCGA COAD -0.115; TCGA ESCA -0.202; TCGA HNSC -0.243; TCGA KIRC -0.242; TCGA KIRP -0.253; TCGA LGG -0.214; TCGA LUSC -0.133; TCGA PAAD -0.239; TCGA PRAD -0.258; TCGA STAD -0.143
hsa-let-7a-3p
ATP6AP2
10 cancers: CESC; COAD; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA CESC -0.087; TCGA COAD -0.133; TCGA HNSC -0.073; TCGA KIRC -0.103; TCGA LGG -0.144; TCGA LUAD -0.08; TCGA PAAD -0.197; TCGA PRAD -0.083; TCGA STAD -0.072; TCGA UCEC -0.183
hsa-let-7a-3p
LRCH3
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.148; TCGA COAD -0.141; TCGA HNSC -0.144; TCGA KIRC -0.196; TCGA KIRP -0.163; TCGA LGG -0.136; TCGA PAAD -0.185; TCGA PRAD -0.183; TCGA SARC -0.175; TCGA STAD -0.282
hsa-let-7a-3p
MKL2
9 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; STAD
mirMAP
TCGA CESC -0.131; TCGA COAD -0.062; TCGA HNSC -0.177; TCGA KIRC -0.124; TCGA KIRP -0.181; TCGA LGG -0.166; TCGA PAAD -0.31; TCGA PRAD -0.188; TCGA STAD -0.217
hsa-let-7a-3p
LCOR
10 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
mirMAP; miRNATAP
TCGA CESC -0.397; TCGA COAD -0.182; TCGA ESCA -0.22; TCGA HNSC -0.468; TCGA KIRC -0.35; TCGA KIRP -0.418; TCGA LUAD -0.135; TCGA LUSC -0.16; TCGA PAAD -0.299; TCGA PRAD -0.388
hsa-let-7a-3p
NF1
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.155; TCGA ESCA -0.131; TCGA HNSC -0.205; TCGA KIRC -0.166; TCGA KIRP -0.192; TCGA LUSC -0.139; TCGA PAAD -0.224; TCGA PRAD -0.204; TCGA SARC -0.155; TCGA STAD -0.128
hsa-let-7a-3p
ARHGAP12
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PRAD; THCA
miRNATAP
TCGA CESC -0.23; TCGA ESCA -0.344; TCGA HNSC -0.092; TCGA KIRC -0.168; TCGA KIRP -0.086; TCGA LGG -0.089; TCGA LUAD -0.067; TCGA OV -0.066; TCGA PRAD -0.145; TCGA THCA -0.088
hsa-let-7a-3p
TXLNG
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA CESC -0.172; TCGA COAD -0.166; TCGA HNSC -0.117; TCGA KIRC -0.192; TCGA KIRP -0.311; TCGA LGG -0.147; TCGA PAAD -0.262; TCGA PRAD -0.347; TCGA SARC -0.445; TCGA STAD -0.088
hsa-let-7a-3p
KIAA1109
9 cancers: CESC; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA CESC -0.171; TCGA ESCA -0.121; TCGA HNSC -0.116; TCGA KIRC -0.218; TCGA LGG -0.183; TCGA PAAD -0.152; TCGA PRAD -0.223; TCGA SARC -0.224; TCGA STAD -0.265
hsa-let-7a-3p
ITCH
13 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA CESC -0.089; TCGA COAD -0.085; TCGA HNSC -0.066; TCGA KIRC -0.156; TCGA KIRP -0.136; TCGA LGG -0.072; TCGA LUAD -0.068; TCGA OV -0.058; TCGA PAAD -0.13; TCGA PRAD -0.129; TCGA THCA -0.074; TCGA STAD -0.15; TCGA UCEC -0.168
hsa-let-7a-3p
RB1CC1
15 cancers: CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA CESC -0.145; TCGA HNSC -0.118; TCGA KIRC -0.102; TCGA KIRP -0.151; TCGA LGG -0.071; TCGA LIHC -0.168; TCGA LUAD -0.067; TCGA LUSC -0.125; TCGA OV -0.082; TCGA PAAD -0.242; TCGA PRAD -0.083; TCGA SARC -0.125; TCGA THCA -0.054; TCGA STAD -0.223; TCGA UCEC -0.217
hsa-let-7a-3p
ARFGEF2
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA CESC -0.202; TCGA ESCA -0.151; TCGA HNSC -0.161; TCGA KIRC -0.307; TCGA KIRP -0.165; TCGA LGG -0.095; TCGA PAAD -0.142; TCGA PRAD -0.209; TCGA SARC -0.126; TCGA THCA -0.108; TCGA UCEC -0.098
hsa-let-7a-3p
MARCH1
9 cancers: CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA CESC -0.225; TCGA COAD -0.368; TCGA HNSC -0.384; TCGA KIRC -0.231; TCGA LUAD -0.198; TCGA LUSC -0.295; TCGA PAAD -0.383; TCGA PRAD -0.272; TCGA UCEC -0.149
hsa-let-7a-3p
VCPIP1
10 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA CESC -0.087; TCGA HNSC -0.09; TCGA KIRC -0.089; TCGA KIRP -0.117; TCGA LGG -0.089; TCGA LUAD -0.069; TCGA PAAD -0.154; TCGA SARC -0.08; TCGA STAD -0.1; TCGA UCEC -0.111
hsa-let-7a-3p
CHM
13 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA COAD -0.133; TCGA ESCA -0.112; TCGA HNSC -0.102; TCGA KIRC -0.205; TCGA KIRP -0.144; TCGA LGG -0.12; TCGA LUAD -0.081; TCGA LUSC -0.119; TCGA PAAD -0.268; TCGA PRAD -0.29; TCGA SARC -0.089; TCGA STAD -0.161; TCGA UCEC -0.151
hsa-let-7a-3p
ARID4B
9 cancers: COAD; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.063; TCGA ESCA -0.106; TCGA HNSC -0.101; TCGA KIRC -0.101; TCGA PAAD -0.154; TCGA PRAD -0.074; TCGA SARC -0.074; TCGA STAD -0.18; TCGA UCEC -0.062
hsa-let-7a-3p
BACH1
10 cancers: COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA COAD -0.09; TCGA HNSC -0.196; TCGA KIRC -0.172; TCGA KIRP -0.203; TCGA LGG -0.083; TCGA LUAD -0.125; TCGA PAAD -0.143; TCGA PRAD -0.138; TCGA STAD -0.113; TCGA UCEC -0.243
hsa-let-7a-3p
OXR1
11 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.133; TCGA ESCA -0.116; TCGA HNSC -0.181; TCGA KIRC -0.348; TCGA KIRP -0.259; TCGA LGG -0.112; TCGA PAAD -0.161; TCGA PRAD -0.257; TCGA SARC -0.157; TCGA STAD -0.189; TCGA UCEC -0.096
hsa-let-7a-3p
CORO1C
10 cancers: COAD; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.116; TCGA KIRP -0.242; TCGA LUAD -0.139; TCGA LUSC -0.098; TCGA PAAD -0.171; TCGA PRAD -0.432; TCGA SARC -0.261; TCGA THCA -0.173; TCGA STAD -0.281; TCGA UCEC -0.176
hsa-let-7a-3p
FRS2
9 cancers: COAD; HNSC; KIRC; KIRP; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA COAD -0.078; TCGA HNSC -0.12; TCGA KIRC -0.137; TCGA KIRP -0.105; TCGA OV -0.068; TCGA PAAD -0.239; TCGA PRAD -0.167; TCGA STAD -0.19; TCGA UCEC -0.064
hsa-let-7a-3p
MAP2
9 cancers: COAD; HNSC; KIRC; KIRP; LIHC; PAAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA COAD -0.618; TCGA HNSC -0.244; TCGA KIRC -0.188; TCGA KIRP -0.395; TCGA LIHC -0.297; TCGA PAAD -0.43; TCGA SARC -0.224; TCGA THCA -0.222; TCGA STAD -0.558
hsa-let-7a-3p
UBE2W
9 cancers: COAD; KIRC; KIRP; LUAD; PAAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA COAD -0.088; TCGA KIRC -0.188; TCGA KIRP -0.141; TCGA LUAD -0.136; TCGA PAAD -0.207; TCGA SARC -0.081; TCGA THCA -0.052; TCGA STAD -0.073; TCGA UCEC -0.201
hsa-let-7a-3p
FYTTD1
11 cancers: COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA COAD -0.074; TCGA HNSC -0.09; TCGA KIRC -0.113; TCGA KIRP -0.075; TCGA LGG -0.075; TCGA LUAD -0.075; TCGA PAAD -0.203; TCGA PRAD -0.145; TCGA THCA -0.054; TCGA STAD -0.217; TCGA UCEC -0.166
hsa-let-7a-3p
SGTB
11 cancers: COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA COAD -0.18; TCGA HNSC -0.095; TCGA KIRP -0.187; TCGA LGG -0.16; TCGA LUAD -0.113; TCGA LUSC -0.22; TCGA PAAD -0.297; TCGA PRAD -0.295; TCGA SARC -0.144; TCGA STAD -0.389; TCGA UCEC -0.201
hsa-let-7a-3p
UBQLN2
9 cancers: COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA COAD -0.077; TCGA HNSC -0.116; TCGA KIRC -0.079; TCGA KIRP -0.096; TCGA PAAD -0.136; TCGA PRAD -0.088; TCGA SARC -0.111; TCGA STAD -0.178; TCGA UCEC -0.132
hsa-let-7a-3p
OSBPL8
12 cancers: COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA COAD -0.129; TCGA HNSC -0.21; TCGA KIRC -0.165; TCGA KIRP -0.217; TCGA LUAD -0.13; TCGA LUSC -0.113; TCGA OV -0.082; TCGA PAAD -0.315; TCGA PRAD -0.253; TCGA THCA -0.103; TCGA STAD -0.193; TCGA UCEC -0.167
hsa-let-7a-3p
CDS2
11 cancers: COAD; ESCA; KIRC; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA COAD -0.118; TCGA ESCA -0.095; TCGA KIRC -0.068; TCGA LGG -0.127; TCGA LIHC -0.105; TCGA LUSC -0.136; TCGA PAAD -0.195; TCGA PRAD -0.141; TCGA SARC -0.245; TCGA STAD -0.258; TCGA UCEC -0.072
hsa-let-7a-3p
NBN
11 cancers: COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA COAD -0.092; TCGA ESCA -0.104; TCGA KIRC -0.141; TCGA KIRP -0.14; TCGA LGG -0.079; TCGA LIHC -0.082; TCGA LUAD -0.081; TCGA PAAD -0.169; TCGA PRAD -0.091; TCGA STAD -0.078; TCGA UCEC -0.186
hsa-let-7a-3p
MAPK8
10 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD; STAD
mirMAP
TCGA COAD -0.084; TCGA ESCA -0.11; TCGA HNSC -0.115; TCGA KIRC -0.225; TCGA KIRP -0.209; TCGA LUAD -0.158; TCGA OV -0.064; TCGA PAAD -0.231; TCGA PRAD -0.235; TCGA STAD -0.075
hsa-let-7a-3p
WDR44
11 cancers: COAD; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA COAD -0.103; TCGA KIRP -0.171; TCGA LGG -0.129; TCGA LUAD -0.062; TCGA LUSC -0.079; TCGA PAAD -0.187; TCGA PRAD -0.269; TCGA SARC -0.292; TCGA THCA -0.077; TCGA STAD -0.111; TCGA UCEC -0.16
hsa-let-7a-3p
ASAP1
9 cancers: COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA COAD -0.188; TCGA HNSC -0.104; TCGA KIRP -0.124; TCGA LUAD -0.085; TCGA LUSC -0.098; TCGA PAAD -0.191; TCGA PRAD -0.357; TCGA STAD -0.227; TCGA UCEC -0.188
hsa-let-7a-3p
CUL4B
9 cancers: COAD; HNSC; KIRP; LGG; LUAD; PAAD; SARC; STAD; UCEC
mirMAP
TCGA COAD -0.103; TCGA HNSC -0.086; TCGA KIRP -0.08; TCGA LGG -0.084; TCGA LUAD -0.052; TCGA PAAD -0.141; TCGA SARC -0.095; TCGA STAD -0.198; TCGA UCEC -0.138
hsa-let-7a-3p
MAP9
10 cancers: COAD; HNSC; KIRP; LGG; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA COAD -0.72; TCGA HNSC -0.593; TCGA KIRP -0.241; TCGA LGG -0.223; TCGA LUSC -0.159; TCGA OV -0.13; TCGA PAAD -0.535; TCGA PRAD -0.168; TCGA STAD -0.49; TCGA UCEC -0.159
hsa-let-7a-3p
BTC
10 cancers: COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA COAD -0.198; TCGA ESCA -0.602; TCGA HNSC -0.429; TCGA KIRC -0.55; TCGA LGG -0.546; TCGA PAAD -0.384; TCGA PRAD -0.407; TCGA SARC -1.598; TCGA THCA -0.229; TCGA STAD -0.427
hsa-let-7a-3p
HDAC9
9 cancers: COAD; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA COAD -0.417; TCGA ESCA -0.337; TCGA HNSC -0.231; TCGA KIRP -0.191; TCGA PAAD -0.313; TCGA PRAD -0.593; TCGA SARC -0.468; TCGA STAD -0.291; TCGA UCEC -0.185
hsa-let-7a-3p
CBL
9 cancers: ESCA; HNSC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA ESCA -0.137; TCGA HNSC -0.103; TCGA KIRP -0.157; TCGA LGG -0.096; TCGA PAAD -0.141; TCGA PRAD -0.249; TCGA SARC -0.17; TCGA STAD -0.193; TCGA UCEC -0.075
hsa-let-7a-3p
CCDC126
11 cancers: ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA ESCA -0.171; TCGA HNSC -0.15; TCGA KIRP -0.09; TCGA LGG -0.139; TCGA LUAD -0.068; TCGA LUSC -0.166; TCGA OV -0.085; TCGA PAAD -0.158; TCGA PRAD -0.057; TCGA STAD -0.085; TCGA UCEC -0.157
hsa-let-7a-3p
APPL1
11 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA ESCA -0.145; TCGA HNSC -0.22; TCGA KIRC -0.139; TCGA KIRP -0.117; TCGA LGG -0.066; TCGA LUAD -0.062; TCGA LUSC -0.122; TCGA PAAD -0.18; TCGA PRAD -0.093; TCGA STAD -0.134; TCGA UCEC -0.132
hsa-let-7a-3p
CRY1
10 cancers: ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA ESCA -0.221; TCGA HNSC -0.072; TCGA KIRP -0.086; TCGA LUAD -0.095; TCGA LUSC -0.108; TCGA OV -0.076; TCGA PAAD -0.209; TCGA PRAD -0.074; TCGA STAD -0.078; TCGA UCEC -0.166
hsa-let-7a-3p
FAM199X
11 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA ESCA -0.095; TCGA HNSC -0.099; TCGA KIRC -0.23; TCGA KIRP -0.275; TCGA LGG -0.274; TCGA LUAD -0.104; TCGA LUSC -0.151; TCGA SARC -0.107; TCGA THCA -0.123; TCGA STAD -0.072; TCGA UCEC -0.076
hsa-let-7a-3p
SNX13
10 cancers: ESCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA ESCA -0.102; TCGA KIRC -0.213; TCGA KIRP -0.155; TCGA LGG -0.197; TCGA PAAD -0.178; TCGA PRAD -0.143; TCGA SARC -0.069; TCGA THCA -0.106; TCGA STAD -0.146; TCGA UCEC -0.131
hsa-let-7a-3p
TRIP11
9 cancers: ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA ESCA -0.161; TCGA HNSC -0.081; TCGA KIRC -0.194; TCGA LGG -0.138; TCGA PAAD -0.205; TCGA PRAD -0.143; TCGA SARC -0.091; TCGA STAD -0.122; TCGA UCEC -0.073
hsa-let-7a-3p
ARHGAP5
10 cancers: ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA ESCA -0.184; TCGA HNSC -0.121; TCGA KIRC -0.183; TCGA KIRP -0.093; TCGA LGG -0.11; TCGA PAAD -0.176; TCGA PRAD -0.233; TCGA SARC -0.167; TCGA STAD -0.19; TCGA UCEC -0.134
hsa-let-7a-3p
RALGPS2
9 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; UCEC
mirMAP
TCGA ESCA -0.159; TCGA HNSC -0.309; TCGA KIRC -0.274; TCGA KIRP -0.196; TCGA LGG -0.2; TCGA LUAD -0.127; TCGA LUSC -0.171; TCGA PRAD -0.094; TCGA UCEC -0.344
hsa-let-7a-3p
CGGBP1
9 cancers: ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA ESCA -0.136; TCGA HNSC -0.167; TCGA KIRC -0.107; TCGA LGG -0.076; TCGA PAAD -0.108; TCGA PRAD -0.1; TCGA SARC -0.072; TCGA STAD -0.15; TCGA UCEC -0.117
hsa-let-7a-3p
ZNF12
9 cancers: ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA ESCA -0.123; TCGA HNSC -0.07; TCGA KIRC -0.137; TCGA KIRP -0.187; TCGA PAAD -0.081; TCGA PRAD -0.085; TCGA SARC -0.104; TCGA STAD -0.18; TCGA UCEC -0.108
hsa-let-7a-3p
SLC36A4
12 cancers: ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA ESCA -0.163; TCGA KIRC -0.152; TCGA KIRP -0.168; TCGA LGG -0.104; TCGA LUAD -0.123; TCGA LUSC -0.138; TCGA PAAD -0.227; TCGA PRAD -0.203; TCGA SARC -0.158; TCGA THCA -0.091; TCGA STAD -0.294; TCGA UCEC -0.331
hsa-let-7a-3p
ZNF148
9 cancers: HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA HNSC -0.159; TCGA KIRC -0.084; TCGA KIRP -0.152; TCGA LGG -0.087; TCGA LUAD -0.051; TCGA PAAD -0.188; TCGA PRAD -0.136; TCGA STAD -0.173; TCGA UCEC -0.129
hsa-let-7a-3p
RPRD1A
9 cancers: HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA HNSC -0.11; TCGA KIRC -0.076; TCGA KIRP -0.078; TCGA LUAD -0.09; TCGA PAAD -0.234; TCGA PRAD -0.142; TCGA SARC -0.247; TCGA THCA -0.104; TCGA STAD -0.161
hsa-let-7a-3p
PUM2
10 cancers: HNSC; KIRC; KIRP; LGG; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.135; TCGA KIRC -0.078; TCGA KIRP -0.057; TCGA LGG -0.066; TCGA OV -0.055; TCGA PAAD -0.102; TCGA PRAD -0.068; TCGA SARC -0.11; TCGA STAD -0.142; TCGA UCEC -0.066
hsa-let-7a-3p
PIK3R4
9 cancers: HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.107; TCGA KIRC -0.136; TCGA KIRP -0.116; TCGA LGG -0.18; TCGA PAAD -0.166; TCGA PRAD -0.088; TCGA SARC -0.142; TCGA STAD -0.104; TCGA UCEC -0.139
hsa-let-7a-3p
PAPOLG
10 cancers: HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA HNSC -0.144; TCGA KIRC -0.096; TCGA KIRP -0.113; TCGA LGG -0.136; TCGA LUAD -0.089; TCGA LUSC -0.107; TCGA PAAD -0.175; TCGA PRAD -0.214; TCGA STAD -0.178; TCGA UCEC -0.138
hsa-let-7a-3p
PPP1R2
10 cancers: HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.12; TCGA KIRC -0.062; TCGA KIRP -0.063; TCGA LGG -0.077; TCGA LIHC -0.073; TCGA PAAD -0.083; TCGA PRAD -0.092; TCGA SARC -0.144; TCGA STAD -0.161; TCGA UCEC -0.134
hsa-let-7a-3p
OPA1
9 cancers: HNSC; KIRC; KIRP; LGG; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.086; TCGA KIRC -0.123; TCGA KIRP -0.113; TCGA LGG -0.072; TCGA PAAD -0.137; TCGA PRAD -0.155; TCGA THCA -0.071; TCGA STAD -0.122; TCGA UCEC -0.156
hsa-let-7a-3p
SCAMP1
11 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA HNSC -0.077; TCGA KIRC -0.219; TCGA KIRP -0.136; TCGA LGG -0.17; TCGA LIHC -0.097; TCGA LUSC -0.086; TCGA PAAD -0.292; TCGA PRAD -0.087; TCGA SARC -0.14; TCGA STAD -0.201; TCGA UCEC -0.063
hsa-let-7a-3p
TMTC3
10 cancers: HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA HNSC -0.117; TCGA KIRC -0.189; TCGA KIRP -0.182; TCGA LGG -0.152; TCGA LUAD -0.1; TCGA OV -0.092; TCGA PAAD -0.297; TCGA PRAD -0.218; TCGA STAD -0.169; TCGA UCEC -0.076
hsa-let-7a-3p
ARL5A
11 cancers: HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA HNSC -0.121; TCGA KIRC -0.123; TCGA KIRP -0.108; TCGA LGG -0.054; TCGA LUAD -0.11; TCGA LUSC -0.149; TCGA OV -0.05; TCGA PAAD -0.193; TCGA PRAD -0.101; TCGA STAD -0.099; TCGA UCEC -0.179
hsa-let-7a-3p
ACAP2
10 cancers: HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA HNSC -0.236; TCGA KIRP -0.107; TCGA LGG -0.135; TCGA LUAD -0.069; TCGA LUSC -0.147; TCGA PAAD -0.175; TCGA PRAD -0.171; TCGA THCA -0.061; TCGA STAD -0.17; TCGA UCEC -0.185
hsa-let-7a-3p
PANK3
9 cancers: HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA
MirTarget
TCGA HNSC -0.099; TCGA KIRC -0.247; TCGA KIRP -0.136; TCGA LGG -0.197; TCGA LUAD -0.095; TCGA LUSC -0.096; TCGA PAAD -0.207; TCGA PRAD -0.089; TCGA THCA -0.093
hsa-let-7a-3p
ZNF800
11 cancers: HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.147; TCGA KIRC -0.132; TCGA KIRP -0.151; TCGA LGG -0.134; TCGA LUAD -0.089; TCGA LUSC -0.111; TCGA PAAD -0.157; TCGA PRAD -0.177; TCGA SARC -0.081; TCGA STAD -0.075; TCGA UCEC -0.163
hsa-let-7a-3p
DCUN1D1
10 cancers: HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA HNSC -0.206; TCGA KIRC -0.241; TCGA KIRP -0.112; TCGA LGG -0.153; TCGA LUAD -0.121; TCGA LUSC -0.187; TCGA PAAD -0.236; TCGA PRAD -0.2; TCGA STAD -0.136; TCGA UCEC -0.149
hsa-let-7a-3p
TNPO1
10 cancers: HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA HNSC -0.082; TCGA KIRC -0.139; TCGA KIRP -0.116; TCGA LGG -0.144; TCGA LUAD -0.061; TCGA LUSC -0.119; TCGA PAAD -0.211; TCGA PRAD -0.123; TCGA STAD -0.09; TCGA UCEC -0.075
hsa-let-7a-3p
HACE1
9 cancers: HNSC; KIRC; LGG; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA HNSC -0.093; TCGA KIRC -0.141; TCGA LGG -0.067; TCGA OV -0.113; TCGA PAAD -0.188; TCGA PRAD -0.143; TCGA SARC -0.129; TCGA STAD -0.23; TCGA UCEC -0.11
hsa-let-7a-3p
CPNE3
9 cancers: HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA HNSC -0.131; TCGA KIRC -0.18; TCGA LGG -0.074; TCGA LUAD -0.075; TCGA PAAD -0.196; TCGA PRAD -0.062; TCGA SARC -0.09; TCGA STAD -0.088; TCGA UCEC -0.12
hsa-let-7a-3p
FBXO3
9 cancers: HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA HNSC -0.108; TCGA KIRC -0.147; TCGA KIRP -0.126; TCGA LGG -0.166; TCGA PAAD -0.146; TCGA PRAD -0.134; TCGA SARC -0.154; TCGA STAD -0.109; TCGA UCEC -0.076
hsa-let-7a-3p
XRN1
10 cancers: HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA HNSC -0.179; TCGA KIRC -0.165; TCGA KIRP -0.117; TCGA LGG -0.086; TCGA LUAD -0.06; TCGA LUSC -0.085; TCGA PAAD -0.212; TCGA PRAD -0.191; TCGA STAD -0.152; TCGA UCEC -0.135
hsa-let-7a-3p
LANCL1
9 cancers: HNSC; KIRC; KIRP; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA HNSC -0.141; TCGA KIRC -0.159; TCGA KIRP -0.131; TCGA OV -0.065; TCGA PAAD -0.158; TCGA PRAD -0.125; TCGA SARC -0.251; TCGA STAD -0.198; TCGA UCEC -0.152
hsa-let-7a-3p
RAB3GAP2
10 cancers: HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA HNSC -0.111; TCGA KIRC -0.156; TCGA KIRP -0.109; TCGA LGG -0.179; TCGA PAAD -0.194; TCGA PRAD -0.122; TCGA SARC -0.094; TCGA THCA -0.063; TCGA STAD -0.127; TCGA UCEC -0.07
hsa-let-7a-3p
CDC73
10 cancers: HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA HNSC -0.079; TCGA KIRC -0.089; TCGA KIRP -0.118; TCGA LGG -0.116; TCGA LUAD -0.053; TCGA PAAD -0.184; TCGA PRAD -0.142; TCGA SARC -0.155; TCGA STAD -0.104; TCGA UCEC -0.114
hsa-let-7a-3p
CTDSPL2
9 cancers: HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA HNSC -0.149; TCGA KIRC -0.133; TCGA KIRP -0.15; TCGA LUAD -0.089; TCGA PAAD -0.175; TCGA PRAD -0.213; TCGA SARC -0.09; TCGA STAD -0.184; TCGA UCEC -0.111
hsa-let-7a-3p
RBM27
11 cancers: HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA HNSC -0.144; TCGA KIRC -0.141; TCGA KIRP -0.17; TCGA LGG -0.061; TCGA LUSC -0.099; TCGA OV -0.052; TCGA PAAD -0.235; TCGA PRAD -0.15; TCGA SARC -0.104; TCGA STAD -0.053; TCGA UCEC -0.124
hsa-let-7a-3p
RIF1
10 cancers: HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA HNSC -0.211; TCGA KIRC -0.323; TCGA KIRP -0.369; TCGA LGG -0.166; TCGA LUAD -0.093; TCGA PAAD -0.327; TCGA PRAD -0.353; TCGA SARC -0.286; TCGA STAD -0.134; TCGA UCEC -0.225
hsa-let-7a-3p
UBE2H
10 cancers: HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA HNSC -0.087; TCGA KIRC -0.218; TCGA KIRP -0.313; TCGA LGG -0.12; TCGA PAAD -0.125; TCGA PRAD -0.088; TCGA SARC -0.11; TCGA THCA -0.116; TCGA STAD -0.143; TCGA UCEC -0.13
hsa-let-7a-3p
VPS37A
10 cancers: KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA KIRC -0.107; TCGA KIRP -0.092; TCGA LUAD -0.128; TCGA LUSC -0.073; TCGA PAAD -0.174; TCGA PRAD -0.228; TCGA SARC -0.179; TCGA THCA -0.07; TCGA STAD -0.098; TCGA UCEC -0.067
hsa-let-7a-3p
PCNP
10 cancers: KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA KIRC -0.082; TCGA KIRP -0.128; TCGA LUAD -0.101; TCGA LUSC -0.079; TCGA OV -0.07; TCGA PAAD -0.178; TCGA PRAD -0.127; TCGA SARC -0.15; TCGA STAD -0.204; TCGA UCEC -0.298
hsa-let-7a-3p
EIF2AK2
9 cancers: KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA KIRC -0.148; TCGA KIRP -0.176; TCGA LGG -0.186; TCGA LUAD -0.11; TCGA LUSC -0.159; TCGA PRAD -0.128; TCGA THCA -0.086; TCGA STAD -0.136; TCGA UCEC -0.173
hsa-let-7a-3p
NCKAP1
10 cancers: KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA KIRC -0.148; TCGA KIRP -0.202; TCGA LGG -0.106; TCGA LUAD -0.062; TCGA PAAD -0.254; TCGA PRAD -0.235; TCGA SARC -0.261; TCGA THCA -0.095; TCGA STAD -0.174; TCGA UCEC -0.102
hsa-let-7a-3p
KRR1
9 cancers: KIRC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA KIRC -0.197; TCGA KIRP -0.083; TCGA LUAD -0.083; TCGA OV -0.071; TCGA PAAD -0.167; TCGA PRAD -0.071; TCGA THCA -0.054; TCGA STAD -0.134; TCGA UCEC -0.157
hsa-let-7a-3p
C2orf49
9 cancers: KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA KIRC -0.085; TCGA KIRP -0.12; TCGA LGG -0.079; TCGA LIHC -0.15; TCGA LUAD -0.131; TCGA PAAD -0.115; TCGA PRAD -0.084; TCGA STAD -0.054; TCGA UCEC -0.154
hsa-let-7a-3p
PAQR3
11 cancers: KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA KIRC -0.33; TCGA KIRP -0.233; TCGA LGG -0.23; TCGA LUAD -0.116; TCGA LUSC -0.149; TCGA PAAD -0.24; TCGA PRAD -0.322; TCGA SARC -0.109; TCGA THCA -0.118; TCGA STAD -0.184; TCGA UCEC -0.125
hsa-let-7a-3p
GFM1
9 cancers: KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA KIRC -0.143; TCGA KIRP -0.124; TCGA LGG -0.151; TCGA LUAD -0.086; TCGA PAAD -0.175; TCGA PRAD -0.118; TCGA SARC -0.09; TCGA THCA -0.103; TCGA UCEC -0.168
hsa-let-7a-3p
PTPN11
9 cancers: KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA KIRC -0.166; TCGA KIRP -0.184; TCGA LUAD -0.082; TCGA PAAD -0.269; TCGA PRAD -0.254; TCGA SARC -0.176; TCGA THCA -0.074; TCGA STAD -0.258; TCGA UCEC -0.132
hsa-let-7a-3p
GLS
9 cancers: KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA KIRC -0.208; TCGA KIRP -0.391; TCGA LUAD -0.173; TCGA PAAD -0.154; TCGA PRAD -0.16; TCGA SARC -0.23; TCGA THCA -0.156; TCGA STAD -0.125; TCGA UCEC -0.402





Enriched cancer pathways of putative targets