microRNA information: hsa-let-7a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-let-7a-5p | miRbase |
| Accession: | MIMAT0000062 | miRbase |
| Precursor name: | hsa-let-7a-1 | miRbase |
| Precursor accession: | MI0000060 | miRbase |
| Symbol: | MIRLET7A1 | HGNC |
| RefSeq ID: | NR_029476 | GenBank |
| Sequence: | UGAGGUAGUAGGUUGUAUAGUU |
Reported expression in cancers: hsa-let-7a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-let-7a-5p | breast cancer | downregulation | "Previously we found that let-7 miRNAs were downreg ......" | 21826373 | |
| hsa-let-7a-5p | breast cancer | downregulation | "The heterochronic microRNA let 7 inhibits cell mot ......" | 23339187 | |
| hsa-let-7a-5p | breast cancer | downregulation | "Expression status of let 7a and miR 335 among brea ......" | 24942235 | |
| hsa-let-7a-5p | breast cancer | downregulation | "Breast cancer specific TRAIL expression mediated b ......" | 25150312 | qPCR |
| hsa-let-7a-5p | colon cancer | downregulation | "Recently let-7 miRNAs were found to regulate human ......" | 16651716 | |
| hsa-let-7a-5p | colon cancer | downregulation | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | Microarray; qPCR |
| hsa-let-7a-5p | colorectal cancer | upregulation | "NIRF is frequently upregulated in colorectal cance ......" | 22018986 | |
| hsa-let-7a-5p | colorectal cancer | upregulation | "Of the 99 mCRC patients we studied differential mi ......" | 23098991 | Microarray |
| hsa-let-7a-5p | colorectal cancer | upregulation | "High expression of let-7 g was associated with a g ......" | 23932154 | |
| hsa-let-7a-5p | gastric cancer | deregulation | "miRNA expression signature was first analyzed by r ......" | 21628394 | qPCR |
| hsa-let-7a-5p | head and neck cancer | deregulation | "Significance was determined using significance ana ......" | 18798260 | Microarray |
| hsa-let-7a-5p | head and neck cancer | deregulation | "We found that expressions of miR‑424 let-7a miRâ ......" | 26323893 | |
| hsa-let-7a-5p | liver cancer | downregulation | "In present study we found that the tumor suppresso ......" | 21814544 | |
| hsa-let-7a-5p | liver cancer | downregulation | "Downregulation of let-7 miRNA in many human cancer ......" | 22289550 | |
| hsa-let-7a-5p | liver cancer | downregulation | "The down-regulated let-7a was validated in another ......" | 24273923 | qPCR |
| hsa-let-7a-5p | liver cancer | downregulation | "Let-7 family microRNAs have been reported to be do ......" | 24724096 | |
| hsa-let-7a-5p | lung cancer | downregulation | "Reduced expression of the let 7 microRNAs in human ......" | 15172979 | |
| hsa-let-7a-5p | lung cancer | downregulation | "Suppression of non small cell lung tumor developme ......" | 18308936 | |
| hsa-let-7a-5p | lung cancer | downregulation | "Indeed some transcripts of the let-7 family that a ......" | 19275611 | |
| hsa-let-7a-5p | lung cancer | downregulation | "Down-regulation of let-7 microRNA miRNA plays an i ......" | 20033209 | Reverse transcription PCR; qPCR |
| hsa-let-7a-5p | lung cancer | downregulation | "Most miRs including all members of the let-7 famil ......" | 20068076 | qPCR |
| hsa-let-7a-5p | lung cancer | downregulation | "MicroRNAs miRs are small noncoding RNA sequences t ......" | 24293999 | RNA-Seq |
| hsa-let-7a-5p | lymphoma | upregulation | "The major findings were: the detection of a panel ......" | 19945163 | |
| hsa-let-7a-5p | melanoma | downregulation | "A microRNA expression screen was performed analyzi ......" | 18379589 | qPCR |
| hsa-let-7a-5p | ovarian cancer | downregulation | "Using microRNA microarrays we identify several miR ......" | 18560586 | Microarray |
| hsa-let-7a-5p | pancreatic cancer | deregulation | "We also found that the treatment of cells in vitro ......" | 22261338 | |
| hsa-let-7a-5p | pancreatic cancer | deregulation | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-let-7a-5p | prostate cancer | downregulation | "Previous work has shown reduced expression levels ......" | 20418948 | |
| hsa-let-7a-5p | sarcoma | downregulation | "We detected decreased expression levels of some le ......" | 21412931 |
Reported cancer pathway affected by hsa-let-7a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-let-7a-5p | breast cancer | Wnt signaling pathway; Apoptosis pathway; Notch signaling pathway | "The miRNAs and their clusters such as the miR-200 ......" | 26712794 | |
| hsa-let-7a-5p | breast cancer | Apoptosis pathway | "The tumor-suppressive let-7 family of microRNAs mi ......" | 27574028 | Western blot; Luciferase |
| hsa-let-7a-5p | cervical and endocervical cancer | Apoptosis pathway | "The effects of lanthanum chloride on proliferation ......" | 26209160 | |
| hsa-let-7a-5p | colorectal cancer | cell cycle pathway | "NIRF is frequently upregulated in colorectal cance ......" | 22018986 | Luciferase |
| hsa-let-7a-5p | esophageal cancer | Epithelial mesenchymal transition pathway | "HMGA2 is down regulated by microRNA let 7 and asso ......" | 24612219 | |
| hsa-let-7a-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "The tumour suppressor roles of the let-7 family th ......" | 23340306 | |
| hsa-let-7a-5p | liver cancer | Apoptosis pathway | "The let 7 family of microRNAs inhibits Bcl xL expr ......" | 20347499 | Western blot |
| hsa-let-7a-5p | lung cancer | cell cycle pathway | "Reduced miR 31 and let 7 maintain the balance betw ......" | 22301433 | |
| hsa-let-7a-5p | lung cancer | Epithelial mesenchymal transition pathway | "Specifically let-7 and miR-9 are deregulated in bo ......" | 23365639 | |
| hsa-let-7a-5p | lung cancer | Apoptosis pathway | "Specifically following HDAC inhibition MYC which n ......" | 26915294 | |
| hsa-let-7a-5p | lung squamous cell cancer | cell cycle pathway | "Flow cytometry analysis revealed these miRNAs indu ......" | 19688090 | Flow cytometry |
| hsa-let-7a-5p | ovarian cancer | Apoptosis pathway | "Estrogen combined with progesterone decreases cell ......" | 24643702 | MTT assay; Western blot |
| hsa-let-7a-5p | prostate cancer | cell cycle pathway | "MicroRNA let 7a inhibits proliferation of human pr ......" | 20418948 | Western blot; Luciferase |
| hsa-let-7a-5p | prostate cancer | cell cycle pathway | "Distinct microRNA expression profiles in prostate ......" | 22719071 | |
| hsa-let-7a-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "Reduced microRNA miRNA let-7a expression and the a ......" | 23974362 | Western blot; Luciferase; Flow cytometry; MTT assay |
| hsa-let-7a-5p | sarcoma | Epithelial mesenchymal transition pathway | "Using miRNA microarrays capable of detecting a kno ......" | 24457375 | Cell proliferation assay; Cell Proliferation Assay |
| hsa-let-7a-5p | sarcoma | cell cycle pathway | "Tumor suppressive microRNA let 7a inhibits cell pr ......" | 25647078 | |
| hsa-let-7a-5p | sarcoma | cell cycle pathway | "c Myc Represses Tumor Suppressive microRNAs let 7a ......" | 26393798 |
Reported cancer prognosis affected by hsa-let-7a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-let-7a-5p | acute myeloid leukemia | differentiation | "We studied miRNA expression of leukemic blasts of ......" | 20425795 | |
| hsa-let-7a-5p | acute myeloid leukemia | poor survival | "MicroRNA let 7a 3 gene methylation is associated w ......" | 24703161 | |
| hsa-let-7a-5p | bladder cancer | poor survival | "A let 7 microRNA binding site polymorphism in the ......" | 27620744 | |
| hsa-let-7a-5p | breast cancer | malignant trasformation | "To obtain insight into miRNA deregulation in breas ......" | 18089790 | |
| hsa-let-7a-5p | breast cancer | malignant trasformation | "Real-time quantitative PCR RQ-PCR is a sensitive a ......" | 18718003 | |
| hsa-let-7a-5p | breast cancer | tumorigenesis; staging; malignant trasformation | "Let 7 family miRNAs regulate estrogen receptor alp ......" | 20535543 | Luciferase |
| hsa-let-7a-5p | breast cancer | metastasis | "To identify microRNAs miRNA involved in metastasis ......" | 21057539 | |
| hsa-let-7a-5p | breast cancer | drug resistance | "let 7 microRNAs induce tamoxifen sensitivity by do ......" | 21826373 | Luciferase |
| hsa-let-7a-5p | breast cancer | tumorigenesis | "LIN28: a regulator of tumor suppressing activity o ......" | 22081076 | |
| hsa-let-7a-5p | breast cancer | cell migration | "MicroRNA let 7a suppresses breast cancer cell migr ......" | 22251626 | Luciferase |
| hsa-let-7a-5p | breast cancer | drug resistance | "Lin28 mediates paclitaxel resistance by modulating ......" | 22808086 | |
| hsa-let-7a-5p | breast cancer | motility; metastasis | "The heterochronic microRNA let 7 inhibits cell mot ......" | 23339187 | |
| hsa-let-7a-5p | breast cancer | malignant trasformation | "The Wnt β catenin pathway represses let 7 microRN ......" | 23613467 | |
| hsa-let-7a-5p | breast cancer | malignant trasformation | "Here we identified 33 miRNAs with similar deregula ......" | 24104550 | |
| hsa-let-7a-5p | breast cancer | drug resistance | "Breast cancer specific TRAIL expression mediated b ......" | 25150312 | Luciferase |
| hsa-let-7a-5p | breast cancer | metastasis; motility | "Among these we identified miRNAs previously associ ......" | 25277099 | |
| hsa-let-7a-5p | breast cancer | staging | "MiR 208a stimulates the cocktail of SOX2 and β ca ......" | 26460550 | |
| hsa-let-7a-5p | breast cancer | recurrence | "Multiple Let-7 family members were negatively corr ......" | 26717565 | |
| hsa-let-7a-5p | breast cancer | drug resistance | "Specifically we will discuss key miRNAs involved i ......" | 27721895 | |
| hsa-let-7a-5p | colon cancer | staging | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | |
| hsa-let-7a-5p | colon cancer | staging | "Association study of the let 7 miRNA complementary ......" | 24727325 | |
| hsa-let-7a-5p | colon cancer | metastasis | "Nine dysregulated miRNA pairs fell into three miRN ......" | 25287248 | |
| hsa-let-7a-5p | colorectal cancer | poor survival | "Genetic modulation of the Let 7 microRNA binding t ......" | 20177422 | |
| hsa-let-7a-5p | colorectal cancer | drug resistance; poor survival | "A let 7 microRNA binding site polymorphism in 3' u ......" | 20603437 | |
| hsa-let-7a-5p | colorectal cancer | staging; poor survival | "A let 7 microRNA SNP in the KRAS 3'UTR is prognost ......" | 21994416 | |
| hsa-let-7a-5p | colorectal cancer | cell migration | "NIRF is frequently upregulated in colorectal cance ......" | 22018986 | Luciferase |
| hsa-let-7a-5p | colorectal cancer | metastasis | "Expression of target miRs in micro-dissected paraf ......" | 22120473 | |
| hsa-let-7a-5p | colorectal cancer | progression; poor survival | "High let 7a microRNA levels in KRAS mutated colore ......" | 22584434 | |
| hsa-let-7a-5p | colorectal cancer | drug resistance | "The LCS6 polymorphism in the binding site of let 7 ......" | 23324806 | |
| hsa-let-7a-5p | colorectal cancer | worse prognosis | "High expression of let-7 g was associated with a g ......" | 23932154 | |
| hsa-let-7a-5p | colorectal cancer | metastasis | "Expressions of target miRNAs in serum were evaluat ......" | 24653631 | |
| hsa-let-7a-5p | colorectal cancer | drug resistance | "We identified a miRNA profile that was analysed by ......" | 25197016 | |
| hsa-let-7a-5p | colorectal cancer | progression | "rs712 polymorphism within let 7 microRNA binding s ......" | 26543374 | |
| hsa-let-7a-5p | colorectal cancer | tumorigenesis | "In contrast expression levels of let-7a-5p 7e-5p 7 ......" | 26643896 | |
| hsa-let-7a-5p | colorectal cancer | staging | "Simultaneous Underexpression of let 7a 5p and let ......" | 26793011 | |
| hsa-let-7a-5p | colorectal cancer | poor survival; immune evasion; immune resistance | "MicroRNA let 7 T cells and patient survival in col ......" | 27737877 | |
| hsa-let-7a-5p | esophageal cancer | metastasis; tumorigenesis | "Role of microRNA let 7 and effect to HMGA2 in esop ......" | 21598109 | Western blot |
| hsa-let-7a-5p | esophageal cancer | staging | "Expression of circulating microRNA 20a and let 7a ......" | 25914476 | |
| hsa-let-7a-5p | gastric cancer | poor survival | "Several microarray studies have reported microRNA ......" | 19951901 | |
| hsa-let-7a-5p | gastric cancer | metastasis; tumorigenesis | "Let 7 microRNA family is selectively secreted into ......" | 20949044 | Western blot |
| hsa-let-7a-5p | gastric cancer | differentiation | "CSC characteristics were checked using spheroid fo ......" | 22374783 | Colony formation |
| hsa-let-7a-5p | gastric cancer | poor survival; worse prognosis | "A new polymorphism biomarker rs629367 associated w ......" | 24760009 | |
| hsa-let-7a-5p | head and neck cancer | drug resistance; metastasis; poor survival | "MicroRNA let 7a represses chemoresistance and tumo ......" | 21292542 | |
| hsa-let-7a-5p | liver cancer | motility; drug resistance | "We evaluated the expression of microRNA in human H ......" | 21352471 | |
| hsa-let-7a-5p | lung cancer | poor survival | "Reduced expression of the let 7 microRNAs in human ......" | 15172979 | |
| hsa-let-7a-5p | lung cancer | differentiation | "Reduced miR 31 and let 7 maintain the balance betw ......" | 22301433 | |
| hsa-let-7a-5p | lung cancer | malignant trasformation | "Targeted delivery of let 7a microRNA encapsulated ......" | 24293999 | |
| hsa-let-7a-5p | lung cancer | poor survival | "Specifically following HDAC inhibition MYC which n ......" | 26915294 | |
| hsa-let-7a-5p | lung squamous cell cancer | progression | "Flow cytometry analysis revealed these miRNAs indu ......" | 19688090 | Flow cytometry |
| hsa-let-7a-5p | lung squamous cell cancer | staging; recurrence | "In an exploratory study we determined whether expr ......" | 20975375 | |
| hsa-let-7a-5p | lung squamous cell cancer | metastasis | "MicroRNA let 7a inhibits the proliferation and inv ......" | 23134218 | Cell proliferation assay; Cell Proliferation Assay |
| hsa-let-7a-5p | lung squamous cell cancer | poor survival | "The clinical and functional significance of RNA-in ......" | 23349018 | RNAi |
| hsa-let-7a-5p | lung squamous cell cancer | metastasis; staging; poor survival | "Different members of let-7 family have been report ......" | 23981581 | |
| hsa-let-7a-5p | lung squamous cell cancer | poor survival | "Systemic nanodelivery of miR-34 and let-7 suppress ......" | 25174400 | |
| hsa-let-7a-5p | lung squamous cell cancer | staging | "Expression of microRNA let 7a miR 155 and miR 205 ......" | 27296000 | |
| hsa-let-7a-5p | melanoma | malignant trasformation | "A microRNA expression screen was performed analyzi ......" | 18379589 | |
| hsa-let-7a-5p | melanoma | malignant trasformation; progression | "Integrin beta 3 expression is regulated by let 7a ......" | 18679415 | |
| hsa-let-7a-5p | melanoma | progression | "In situ analysis of melanoma samples using progres ......" | 23728176 | |
| hsa-let-7a-5p | melanoma | differentiation | "Metabolic reprogramming of metastatic breast cance ......" | 25669981 | |
| hsa-let-7a-5p | ovarian cancer | worse prognosis | "We highlight the role of the let-7 and miR-200 fam ......" | 20083225 | |
| hsa-let-7a-5p | ovarian cancer | drug resistance | "Luciferase assays and real-time PCRs showed that t ......" | 21109987 | Luciferase |
| hsa-let-7a-5p | ovarian cancer | metastasis | "miRNA microarray was applied to compare the miRNA ......" | 21122376 | |
| hsa-let-7a-5p | ovarian cancer | drug resistance; poor survival; staging; progression | "Let-7 is a family of small non-coding RNAs regulat ......" | 21571355 | |
| hsa-let-7a-5p | ovarian cancer | worse prognosis; staging | "Two families of miRNAs miR-200 and let-7 are frequ ......" | 23237306 | |
| hsa-let-7a-5p | ovarian cancer | poor survival | "Estrogen combined with progesterone decreases cell ......" | 24643702 | MTT assay; Western blot |
| hsa-let-7a-5p | ovarian cancer | poor survival; worse prognosis | "MicroRNA let 7a modifies the effect of self renewa ......" | 25630839 | |
| hsa-let-7a-5p | pancreatic cancer | progression | "let 7 MicroRNA transfer in pancreatic cancer deriv ......" | 19323605 | |
| hsa-let-7a-5p | pancreatic cancer | poor survival | "The expression of miR-21 was significantly higher ......" | 21139804 | |
| hsa-let-7a-5p | pancreatic cancer | tumorigenesis | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-let-7a-5p | pancreatic cancer | metastasis | "We therefore established a screening strategy to f ......" | 23733161 | Western blot |
| hsa-let-7a-5p | pancreatic cancer | poor survival | "Quantitative real-time PCR qRT-PCR was subsequentl ......" | 26819679 | |
| hsa-let-7a-5p | pancreatic cancer | drug resistance | "In particular modulations of let-7 miR-29a miR-17- ......" | 27539232 | |
| hsa-let-7a-5p | prostate cancer | progression; poor survival | "Distinct microRNA expression profile in prostate c ......" | 23798998 | |
| hsa-let-7a-5p | prostate cancer | progression | "Reduced microRNA miRNA let-7a expression and the a ......" | 23974362 | Western blot; Luciferase; Flow cytometry; MTT assay |
| hsa-let-7a-5p | prostate cancer | drug resistance; metastasis | "Loss of let 7 microRNA upregulates IL 6 in bone ma ......" | 23977098 | Luciferase |
| hsa-let-7a-5p | prostate cancer | malignant trasformation | "Role of miRNA let 7 and its major targets in prost ......" | 25276782 | |
| hsa-let-7a-5p | sarcoma | malignant trasformation | "Let 7 microRNA and HMGA2 levels of expression are ......" | 21412931 | |
| hsa-let-7a-5p | sarcoma | progression | "Tumor suppressive microRNA let 7a inhibits cell pr ......" | 25647078 | |
| hsa-let-7a-5p | sarcoma | progression | "c Myc Represses Tumor Suppressive microRNAs let 7a ......" | 26393798 | |
| hsa-let-7a-5p | thyroid cancer | differentiation | "Effects of let 7 microRNA on Cell Growth and Diffe ......" | 19956384 |
Reported gene related to hsa-let-7a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-let-7a-5p | bladder cancer | KRAS | "A let 7 microRNA binding site polymorphism in the ......" | 27620744 |
| hsa-let-7a-5p | colon cancer | KRAS | "Association study of the let 7 miRNA complementary ......" | 24727325 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "A let 7 microRNA binding site polymorphism in 3' u ......" | 20603437 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "Let 7 microRNA binding site polymorphism in the 3' ......" | 24890702 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "The LCS6 polymorphism in the binding site of let 7 ......" | 23324806 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "A let 7 microRNA SNP in the KRAS 3'UTR is prognost ......" | 21994416 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "Let 7 miRNA binding site polymorphism in the KRAS ......" | 23167843 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "Genetic modulation of the Let 7 microRNA binding t ......" | 20177422 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "A let 7 microRNA binding site polymorphism in KRAS ......" | 25183481 |
| hsa-let-7a-5p | colorectal cancer | KRAS | "High let 7a microRNA levels in KRAS mutated colore ......" | 22584434 |
| hsa-let-7a-5p | lung squamous cell cancer | KRAS | "A SNP in a let 7 microRNA complementary site in th ......" | 18922928 |
| hsa-let-7a-5p | esophageal cancer | HMGA2 | "Role of microRNA let 7 and effect to HMGA2 in esop ......" | 21598109 |
| hsa-let-7a-5p | esophageal cancer | HMGA2 | "HMGA2 is down regulated by microRNA let 7 and asso ......" | 24612219 |
| hsa-let-7a-5p | gastric cancer | HMGA2 | "Since let-7 miRNAs generally play a tumor-suppress ......" | 20949044 |
| hsa-let-7a-5p | gastric cancer | HMGA2 | "Recent studies report that HMGA2 is negatively reg ......" | 18413822 |
| hsa-let-7a-5p | lung cancer | HMGA2 | "MiR-98 a member in the let-7 family acts as a nega ......" | 23700794 |
| hsa-let-7a-5p | lung squamous cell cancer | HMGA2 | "MicroRNA let 7a inhibits the proliferation and inv ......" | 23134218 |
| hsa-let-7a-5p | ovarian cancer | HMGA2 | "HMGA2 mRNA and let-7 family microRNA were detected ......" | 23073586 |
| hsa-let-7a-5p | sarcoma | HMGA2 | "Let 7 microRNA and HMGA2 levels of expression are ......" | 21412931 |
| hsa-let-7a-5p | glioblastoma | HRAS | "Transfection of let-7 miRNA reduced expression of ......" | 20607356 |
| hsa-let-7a-5p | lung cancer | HRAS | "Using an established orthotopic mouse lung cancer ......" | 18344688 |
| hsa-let-7a-5p | lung cancer | HRAS | "k-Ras and c-Myc two key oncogenes in lung cancer h ......" | 20033209 |
| hsa-let-7a-5p | lung squamous cell cancer | HRAS | "MicroRNA let 7a inhibits the proliferation and inv ......" | 23134218 |
| hsa-let-7a-5p | pancreatic cancer | HRAS | "Because let-7 microRNA targets the K-ras oncogene ......" | 19323605 |
| hsa-let-7a-5p | breast cancer | LIN28A | "We identified an inverse relationship between miR- ......" | 26460550 |
| hsa-let-7a-5p | breast cancer | LIN28A | "Lin28 mediates paclitaxel resistance by modulating ......" | 22808086 |
| hsa-let-7a-5p | breast cancer | LIN28A | "LIN28 is a RNA-binding protein that has been well ......" | 22081076 |
| hsa-let-7a-5p | breast cancer | LIN28A | "The Wnt β catenin pathway represses let 7 microRN ......" | 23613467 |
| hsa-let-7a-5p | prostate cancer | LIN28A | "Furthermore let-7c expression is downregulated in ......" | 22479342 |
| hsa-let-7a-5p | colorectal cancer | EGFR | "The LCS6 polymorphism in the binding site of let 7 ......" | 23324806 |
| hsa-let-7a-5p | colorectal cancer | EGFR | "High let 7a microRNA levels in KRAS mutated colore ......" | 22584434 |
| hsa-let-7a-5p | lung cancer | EGFR | "We elected to validate our model in vitro by testi ......" | 23365639 |
| hsa-let-7a-5p | lung cancer | MYC | "We elected to validate our model in vitro by testi ......" | 23365639 |
| hsa-let-7a-5p | lung cancer | MYC | "k-Ras and c-Myc two key oncogenes in lung cancer h ......" | 20033209 |
| hsa-let-7a-5p | lymphoma | MYC | "MicroRNA let 7a down regulates MYC and reverts MYC ......" | 17942906 |
| hsa-let-7a-5p | lung cancer | BCL2 | "As a result transcript levels of the tumor-suppres ......" | 26915294 |
| hsa-let-7a-5p | ovarian cancer | BCL2 | "Estrogen combined with progesterone decreases cell ......" | 24643702 |
| hsa-let-7a-5p | liver cancer | BCL2L1 | "The let 7 family of microRNAs inhibits Bcl xL expr ......" | 20347499 |
| hsa-let-7a-5p | lung cancer | BCL2L1 | "As a result transcript levels of the tumor-suppres ......" | 26915294 |
| hsa-let-7a-5p | breast cancer | DICER1 | "In let-7a overexpressed ZR75-1 and MM-231 cells DI ......" | 26460550 |
| hsa-let-7a-5p | melanoma | DICER1 | "Importantly we discovered that ADAR1 fundamentally ......" | 23728176 |
| hsa-let-7a-5p | prostate cancer | E2F2 | "MicroRNA let 7a inhibits proliferation of human pr ......" | 20418948 |
| hsa-let-7a-5p | sarcoma | E2F2 | "Tumor suppressive microRNA let 7a inhibits cell pr ......" | 25647078 |
| hsa-let-7a-5p | breast cancer | ESR1 | "Let 7 family miRNAs regulate estrogen receptor alp ......" | 20535543 |
| hsa-let-7a-5p | breast cancer | ESR1 | "let 7 microRNAs induce tamoxifen sensitivity by do ......" | 21826373 |
| hsa-let-7a-5p | lymphoma | HGS | "Our studies here demonstrate that PRDM1/blimp-1 is ......" | 18583325 |
| hsa-let-7a-5p | ovarian cancer | HGS | "The hazards ratios HRs for death and disease progr ......" | 21571355 |
| hsa-let-7a-5p | liver cancer | IL6 | "Knocking down IL-6 and Twist in HSCs significantly ......" | 21352471 |
| hsa-let-7a-5p | prostate cancer | IL6 | "Loss of let 7 microRNA upregulates IL 6 in bone ma ......" | 23977098 |
| hsa-let-7a-5p | colorectal cancer | NRGN | "This method was able to detect let-7a miRNA in as ......" | 17944059 |
| hsa-let-7a-5p | gastric cancer | NRGN | "The dynamic range and sensitivity of the let-7a mi ......" | 17569129 |
| hsa-let-7a-5p | melanoma | ADAR | "Importantly we discovered that ADAR1 fundamentally ......" | 23728176 |
| hsa-let-7a-5p | melanoma | BHLHE22 | "Transfection of melanoma cells with let-7a pre-miR ......" | 18679415 |
| hsa-let-7a-5p | esophageal cancer | BRD2 | "Let-7 expressions were detected in esophageal canc ......" | 21598109 |
| hsa-let-7a-5p | breast cancer | CCL21 | "The expression of CCR7 its ligand CCL21 and let-7a ......" | 22251626 |
| hsa-let-7a-5p | prostate cancer | CCND2 | "MicroRNA let 7a inhibits proliferation of human pr ......" | 20418948 |
| hsa-let-7a-5p | breast cancer | CCR7 | "In the present study the authors demonstrated that ......" | 22251626 |
| hsa-let-7a-5p | acute myeloid leukemia | CEBPA | "MicroRNA let 7a 3 gene methylation is associated w ......" | 24703161 |
| hsa-let-7a-5p | gastric cancer | DDR1 | "Let-7 g improved the effects of X-rays on GC cells ......" | 25972194 |
| hsa-let-7a-5p | lung cancer | EFNA1 | "Targeted delivery of let 7a microRNA encapsulated ......" | 24293999 |
| hsa-let-7a-5p | breast cancer | ERBB2 | "For instance an abundant expression of multiple le ......" | 25907662 |
| hsa-let-7a-5p | B cell lymphoma | GBA | "Let-7 in particular let-7b is overexpressed in DLB ......" | 20651244 |
| hsa-let-7a-5p | head and neck cancer | HMI | "Subsequently microarray analysis followed by Ingen ......" | 27588466 |
| hsa-let-7a-5p | prostate cancer | IGF1R | "Reduced microRNA miRNA let-7a expression and the a ......" | 23974362 |
| hsa-let-7a-5p | melanoma | ITGA9 | "Transfection of melanoma cells with let-7a pre-miR ......" | 18679415 |
| hsa-let-7a-5p | breast cancer | KDM5B | "In MCF-7 cells with stable RNAi-mediated suppressi ......" | 21969366 |
| hsa-let-7a-5p | ovarian cancer | KLK6 | "The transient transfection of hsa-let-7a to OVCAR- ......" | 23136250 |
| hsa-let-7a-5p | lung cancer | LAT2 | "A549-let-7a cell line and A549-control cell line t ......" | 20033209 |
| hsa-let-7a-5p | lung squamous cell cancer | LCS1 | "The purpose of this study was to identify single n ......" | 18922928 |
| hsa-let-7a-5p | melanoma | LIN28B | "Mechanistically we discovered that Lin28B a well-c ......" | 26071398 |
| hsa-let-7a-5p | breast cancer | LMNA | "Twenty-five differentially expressed miRNAs P < 0. ......" | 20535543 |
| hsa-let-7a-5p | pancreatic cancer | MAP2K6 | "Restoring let-7 levels in cancer-derived cell line ......" | 19323605 |
| hsa-let-7a-5p | head and neck cancer | MMP8 | "However the role of let-7 in head and neck cancer ......" | 21292542 |
| hsa-let-7a-5p | colorectal cancer | MTUS1 | "In contrast let-7a-5p 7e-5p 7f-5p miR-125a-5p and ......" | 26643896 |
| hsa-let-7a-5p | head and neck cancer | NANOG | "Most importantly overexpression of let-7 or knockd ......" | 21292542 |
| hsa-let-7a-5p | thyroid cancer | NKX2-1 | "In addition let-7 enhanced transcriptional express ......" | 19956384 |
| hsa-let-7a-5p | glioblastoma | NRAS | "Transfection of let-7 miRNA reduced expression of ......" | 20607356 |
| hsa-let-7a-5p | gastric cancer | PGC | "This study examined the expression patterns of ser ......" | 25549793 |
| hsa-let-7a-5p | ovarian cancer | PGRMC1 | "In conclusion we propose that PGRMC1 expression is ......" | 21109987 |
| hsa-let-7a-5p | ovarian cancer | PIWIL1 | "MicroRNA let 7a modifies the effect of self renewa ......" | 25630839 |
| hsa-let-7a-5p | B cell lymphoma | PRDM1 | "Data obtained from expression analysis luciferase ......" | 20651244 |
| hsa-let-7a-5p | breast cancer | RASSF1 | "RASSF1A resulted more frequently methylated in men ......" | 23160909 |
| hsa-let-7a-5p | melanoma | ROS1 | "Moreover let-7a causes mitochondrial ROS productio ......" | 25669981 |
| hsa-let-7a-5p | lung squamous cell cancer | SCLC1 | "Among them five downregulated miRNAs let-7 miR-20 ......" | 23117485 |
| hsa-let-7a-5p | sarcoma | SERPINH1 | "Using a quantitative shotgun proteomics approach w ......" | 24457375 |
| hsa-let-7a-5p | ovarian cancer | SLC10A4 | "E2 + P4 promoted the expression of let-7a and miR- ......" | 24643702 |
| hsa-let-7a-5p | pancreatic cancer | SOCS3 | "MicroRNA let 7 downregulates STAT3 phosphorylation ......" | 24491408 |
| hsa-let-7a-5p | breast cancer | SOX2 | "We identified an inverse relationship between miR- ......" | 26460550 |
| hsa-let-7a-5p | colon cancer | STAB2 | "Nine dysregulated miRNA pairs fell into three miRN ......" | 25287248 |
| hsa-let-7a-5p | pancreatic cancer | STAT3 | "MicroRNA let 7 downregulates STAT3 phosphorylation ......" | 24491408 |
| hsa-let-7a-5p | breast cancer | TAM | "Transfection of let-7 mimics to Tam-resistant MCF7 ......" | 21826373 |
| hsa-let-7a-5p | colorectal cancer | TGFBR1 | "rs868 is contained in a let-7 miRNA binding site i ......" | 27234654 |
| hsa-let-7a-5p | liver cancer | TRIM71 | "Lin-41 is a stem cell-specific E3 ligase and a kno ......" | 23097274 |
| hsa-let-7a-5p | liver cancer | TWIST1 | "Knocking down IL-6 and Twist in HSCs significantly ......" | 21352471 |
| hsa-let-7a-5p | sarcoma | VIM | "Using a quantitative shotgun proteomics approach w ......" | 24457375 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-let-7a-5p | C2CD4A | 10 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.434; TCGA BRCA -0.406; TCGA CESC -0.726; TCGA KIRC -0.413; TCGA LUAD -0.765; TCGA LUSC -0.869; TCGA PRAD -0.336; TCGA SARC -0.328; TCGA THCA -0.776; TCGA UCEC -0.45 |
hsa-let-7a-5p | CDC25B | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.203; TCGA BRCA -0.432; TCGA CESC -0.201; TCGA HNSC -0.2; TCGA KIRC -0.157; TCGA LGG -0.101; TCGA LIHC -0.209; TCGA LUAD -0.283; TCGA LUSC -0.2; TCGA THCA -0.185; TCGA UCEC -0.404 |
hsa-let-7a-5p | KLHDC8B | 9 cancers: BLCA; COAD; ESCA; LGG; LIHC; PRAD; SARC; STAD; UCEC | MirTarget; TargetScan; miRNATAP | TCGA BLCA -0.26; TCGA COAD -0.258; TCGA ESCA -0.228; TCGA LGG -0.143; TCGA LIHC -0.139; TCGA PRAD -0.13; TCGA SARC -0.269; TCGA STAD -0.292; TCGA UCEC -0.353 |
hsa-let-7a-5p | IGF2BP3 | 10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; UCEC | MirTarget; TargetScan | TCGA BLCA -0.737; TCGA BRCA -0.46; TCGA CESC -0.812; TCGA KIRC -0.408; TCGA KIRP -0.436; TCGA LIHC -0.773; TCGA LUAD -0.726; TCGA LUSC -1.447; TCGA OV -0.733; TCGA UCEC -0.861 |
hsa-let-7a-5p | GLRX | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; PRAD; THCA; STAD; UCEC | MirTarget; TargetScan | TCGA BLCA -0.298; TCGA BRCA -0.152; TCGA ESCA -0.27; TCGA HNSC -0.18; TCGA KIRP -0.195; TCGA LIHC -0.209; TCGA PRAD -0.242; TCGA THCA -0.272; TCGA STAD -0.266; TCGA UCEC -0.242 |
hsa-let-7a-5p | DLGAP4 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD | MirTarget; TargetScan | TCGA BLCA -0.113; TCGA BRCA -0.12; TCGA CESC -0.131; TCGA COAD -0.277; TCGA HNSC -0.118; TCGA LIHC -0.122; TCGA LUAD -0.172; TCGA LUSC -0.147; TCGA OV -0.069; TCGA PRAD -0.064; TCGA THCA -0.09; TCGA STAD -0.119 |
hsa-let-7a-5p | ADAMTS14 | 9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PRAD; THCA; UCEC | TargetScan | TCGA BLCA -0.58; TCGA BRCA -0.419; TCGA CESC -0.597; TCGA HNSC -0.263; TCGA LUAD -0.562; TCGA LUSC -0.359; TCGA PRAD -0.205; TCGA THCA -0.82; TCGA UCEC -0.315 |
hsa-let-7a-5p | DPH3 | 9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; OV; PRAD; STAD; UCEC | TargetScan | TCGA BLCA -0.226; TCGA BRCA -0.105; TCGA CESC -0.14; TCGA HNSC -0.093; TCGA LIHC -0.207; TCGA OV -0.082; TCGA PRAD -0.2; TCGA STAD -0.099; TCGA UCEC -0.196 |
hsa-let-7a-5p | EIF2S2 | 10 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC | TargetScan | TCGA BLCA -0.084; TCGA BRCA -0.257; TCGA HNSC -0.26; TCGA KIRP -0.167; TCGA LIHC -0.249; TCGA LUAD -0.065; TCGA LUSC -0.337; TCGA OV -0.136; TCGA THCA -0.123; TCGA UCEC -0.174 |
hsa-let-7a-5p | FADS3 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; THCA; UCEC | TargetScan | TCGA BLCA -0.25; TCGA BRCA -0.247; TCGA CESC -0.495; TCGA HNSC -0.341; TCGA KIRP -0.298; TCGA LIHC -0.292; TCGA LUAD -0.126; TCGA THCA -0.322; TCGA UCEC -0.157 |
hsa-let-7a-5p | FBXO32 | 10 cancers: BLCA; COAD; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | TargetScan; miRNATAP | TCGA BLCA -0.773; TCGA COAD -0.434; TCGA LIHC -0.409; TCGA LUAD -0.285; TCGA LUSC -0.666; TCGA PRAD -0.44; TCGA SARC -0.983; TCGA THCA -0.456; TCGA STAD -0.385; TCGA UCEC -0.238 |
hsa-let-7a-5p | FKRP | 10 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC | TargetScan | TCGA BLCA -0.098; TCGA COAD -0.151; TCGA HNSC -0.085; TCGA KIRP -0.094; TCGA LUAD -0.122; TCGA LUSC -0.13; TCGA OV -0.16; TCGA PAAD -0.141; TCGA STAD -0.101; TCGA UCEC -0.106 |
hsa-let-7a-5p | GOLT1B | 9 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; UCEC | TargetScan | TCGA BLCA -0.123; TCGA BRCA -0.207; TCGA HNSC -0.125; TCGA LIHC -0.097; TCGA LUAD -0.103; TCGA LUSC -0.24; TCGA OV -0.134; TCGA PAAD -0.127; TCGA UCEC -0.143 |
hsa-let-7a-5p | GPR137 | 9 cancers: BLCA; BRCA; COAD; KIRP; LGG; LUAD; OV; PAAD; STAD | TargetScan; miRNATAP | TCGA BLCA -0.092; TCGA BRCA -0.105; TCGA COAD -0.128; TCGA KIRP -0.121; TCGA LGG -0.126; TCGA LUAD -0.153; TCGA OV -0.116; TCGA PAAD -0.143; TCGA STAD -0.183 |
hsa-let-7a-5p | INPP5A | 9 cancers: BLCA; BRCA; CESC; COAD; LGG; OV; SARC; STAD; UCEC | TargetScan; miRNATAP | TCGA BLCA -0.311; TCGA BRCA -0.066; TCGA CESC -0.156; TCGA COAD -0.169; TCGA LGG -0.075; TCGA OV -0.163; TCGA SARC -0.301; TCGA STAD -0.289; TCGA UCEC -0.159 |
hsa-let-7a-5p | MED8 | 9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; UCEC | TargetScan; miRNATAP | TCGA BLCA -0.115; TCGA BRCA -0.213; TCGA CESC -0.161; TCGA HNSC -0.216; TCGA LIHC -0.23; TCGA LUAD -0.1; TCGA LUSC -0.152; TCGA OV -0.112; TCGA UCEC -0.119 |
hsa-let-7a-5p | PLEKHO1 | 9 cancers: BLCA; BRCA; COAD; LIHC; LUAD; PRAD; SARC; THCA; STAD | TargetScan; miRNATAP | TCGA BLCA -0.744; TCGA BRCA -0.233; TCGA COAD -0.309; TCGA LIHC -0.304; TCGA LUAD -0.105; TCGA PRAD -0.528; TCGA SARC -0.286; TCGA THCA -0.161; TCGA STAD -0.406 |
hsa-let-7a-5p | RBM38 | 12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | TargetScan; miRNATAP | TCGA BLCA -0.165; TCGA BRCA -0.395; TCGA COAD -0.271; TCGA HNSC -0.101; TCGA LGG -0.096; TCGA LUAD -0.223; TCGA LUSC -0.227; TCGA OV -0.123; TCGA PRAD -0.596; TCGA SARC -0.668; TCGA STAD -0.167; TCGA UCEC -0.199 |
hsa-let-7a-5p | SLC8A2 | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | TargetScan; mirMAP; miRNATAP | TCGA BLCA -0.539; TCGA COAD -1.16; TCGA ESCA -0.611; TCGA HNSC -0.33; TCGA LUAD -0.339; TCGA LUSC -0.539; TCGA PRAD -0.775; TCGA SARC -0.608; TCGA STAD -1.166; TCGA UCEC -0.818 |
hsa-let-7a-5p | SPEG | 11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC | TargetScan; miRNATAP | TCGA BLCA -1.342; TCGA COAD -1.42; TCGA HNSC -0.346; TCGA KIRC -0.447; TCGA KIRP -0.562; TCGA LGG -0.113; TCGA LUAD -0.413; TCGA PRAD -1.156; TCGA SARC -1.237; TCGA STAD -0.848; TCGA UCEC -0.812 |
hsa-let-7a-5p | LOXL3 | 9 cancers: BLCA; BRCA; CESC; LUAD; OV; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.677; TCGA BRCA -0.123; TCGA CESC -0.241; TCGA LUAD -0.189; TCGA OV -0.244; TCGA PRAD -0.441; TCGA THCA -0.173; TCGA STAD -0.205; TCGA UCEC -0.306 |
hsa-let-7a-5p | CS | 9 cancers: BRCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA | miRNAWalker2 validate | TCGA BRCA -0.071; TCGA CESC -0.126; TCGA KIRC -0.079; TCGA KIRP -0.185; TCGA LIHC -0.105; TCGA LUAD -0.059; TCGA LUSC -0.177; TCGA PAAD -0.101; TCGA THCA -0.136 |
hsa-let-7a-5p | E2F1 | 9 cancers: BRCA; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BRCA -0.564; TCGA HNSC -0.321; TCGA LIHC -0.451; TCGA LUAD -0.523; TCGA LUSC -0.594; TCGA OV -0.284; TCGA SARC -0.231; TCGA THCA -0.553; TCGA UCEC -0.253 |
hsa-let-7a-5p | GADD45GIP1 | 9 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.183; TCGA HNSC -0.321; TCGA KIRP -0.227; TCGA LGG -0.117; TCGA LIHC -0.411; TCGA LUAD -0.163; TCGA LUSC -0.334; TCGA THCA -0.194; TCGA STAD -0.203 |
hsa-let-7a-5p | HMGA1 | 9 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; TargetScan; miRNATAP | TCGA BRCA -0.452; TCGA CESC -0.253; TCGA HNSC -0.22; TCGA KIRP -0.251; TCGA LIHC -0.493; TCGA LUAD -0.363; TCGA LUSC -0.78; TCGA OV -0.308; TCGA UCEC -0.53 |
hsa-let-7a-5p | HMGA2 | 9 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; TargetScan | TCGA BRCA -0.245; TCGA CESC -1.416; TCGA COAD -0.393; TCGA HNSC -0.767; TCGA LIHC -0.523; TCGA LUAD -0.438; TCGA LUSC -1.721; TCGA OV -0.774; TCGA UCEC -0.787 |
hsa-let-7a-5p | MRPL15 | 10 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC | miRNAWalker2 validate | TCGA BRCA -0.329; TCGA CESC -0.141; TCGA HNSC -0.222; TCGA KIRP -0.168; TCGA LIHC -0.208; TCGA LUAD -0.152; TCGA LUSC -0.438; TCGA OV -0.094; TCGA THCA -0.11; TCGA UCEC -0.174 |
hsa-let-7a-5p | NKIRAS2 | 12 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; TargetScan; miRNATAP | TCGA BRCA -0.128; TCGA HNSC -0.068; TCGA KIRP -0.113; TCGA LGG -0.113; TCGA LIHC -0.115; TCGA LUAD -0.183; TCGA LUSC -0.261; TCGA OV -0.11; TCGA SARC -0.094; TCGA THCA -0.061; TCGA STAD -0.154; TCGA UCEC -0.112 |
hsa-let-7a-5p | PREB | 12 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.19; TCGA CESC -0.193; TCGA HNSC -0.101; TCGA KIRP -0.122; TCGA LIHC -0.122; TCGA LUAD -0.162; TCGA LUSC -0.23; TCGA OV -0.161; TCGA SARC -0.146; TCGA THCA -0.093; TCGA STAD -0.183; TCGA UCEC -0.084 |
hsa-let-7a-5p | PTGES2 | 9 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; THCA | miRNAWalker2 validate | TCGA BRCA -0.147; TCGA CESC -0.13; TCGA HNSC -0.146; TCGA KIRP -0.199; TCGA LGG -0.107; TCGA LIHC -0.28; TCGA LUAD -0.25; TCGA LUSC -0.349; TCGA THCA -0.11 |
hsa-let-7a-5p | SHMT2 | 9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA | miRNAWalker2 validate | TCGA BRCA -0.224; TCGA KIRP -0.19; TCGA LGG -0.105; TCGA LIHC -0.114; TCGA LUAD -0.263; TCGA LUSC -0.509; TCGA OV -0.163; TCGA PAAD -0.162; TCGA THCA -0.231 |
hsa-let-7a-5p | SNRPC | 9 cancers: BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC | miRNAWalker2 validate | TCGA BRCA -0.251; TCGA HNSC -0.234; TCGA KIRP -0.116; TCGA LIHC -0.313; TCGA LUAD -0.163; TCGA LUSC -0.328; TCGA OV -0.293; TCGA THCA -0.084; TCGA UCEC -0.129 |
hsa-let-7a-5p | WDR46 | 10 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC | miRNAWalker2 validate | TCGA BRCA -0.101; TCGA CESC -0.179; TCGA HNSC -0.143; TCGA KIRP -0.087; TCGA LIHC -0.199; TCGA LUAD -0.148; TCGA LUSC -0.26; TCGA OV -0.11; TCGA THCA -0.078; TCGA UCEC -0.1 |
hsa-let-7a-5p | WIPI2 | 12 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC | miRNAWalker2 validate; TargetScan | TCGA BRCA -0.1; TCGA CESC -0.134; TCGA COAD -0.142; TCGA HNSC -0.093; TCGA KIRC -0.088; TCGA KIRP -0.12; TCGA LIHC -0.125; TCGA LUAD -0.106; TCGA LUSC -0.134; TCGA OV -0.117; TCGA THCA -0.058; TCGA UCEC -0.14 |
hsa-let-7a-5p | IGF2BP1 | 9 cancers: BRCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; OV; UCEC | miRTarBase; MirTarget; TargetScan; miRNATAP; RAID | TCGA BRCA -0.829; TCGA CESC -1.054; TCGA HNSC -0.642; TCGA KIRC -0.547; TCGA LIHC -1.349; TCGA LUAD -1.164; TCGA LUSC -1.627; TCGA OV -1.046; TCGA UCEC -1.675 |
hsa-let-7a-5p | CDC34 | 12 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC | miRTarBase; MirTarget; TargetScan; miRNATAP | TCGA BRCA -0.311; TCGA CESC -0.165; TCGA HNSC -0.306; TCGA KIRP -0.162; TCGA LGG -0.168; TCGA LIHC -0.23; TCGA LUAD -0.34; TCGA LUSC -0.377; TCGA OV -0.203; TCGA THCA -0.217; TCGA STAD -0.198; TCGA UCEC -0.138 |
hsa-let-7a-5p | SLC5A6 | 9 cancers: BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; OV; UCEC | MirTarget; TargetScan; miRNATAP | TCGA BRCA -0.375; TCGA CESC -0.197; TCGA COAD -0.242; TCGA KIRC -0.091; TCGA KIRP -0.105; TCGA LUAD -0.217; TCGA LUSC -0.473; TCGA OV -0.251; TCGA UCEC -0.168 |
hsa-let-7a-5p | ABCB9 | 11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA | MirTarget; TargetScan | TCGA BRCA -0.224; TCGA CESC -0.193; TCGA HNSC -0.095; TCGA KIRC -0.206; TCGA KIRP -0.256; TCGA LIHC -0.199; TCGA LUAD -0.329; TCGA LUSC -0.404; TCGA OV -0.112; TCGA PAAD -0.203; TCGA THCA -0.13 |
hsa-let-7a-5p | IGF2BP2 | 10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; UCEC | MirTarget; TargetScan; miRNATAP | TCGA BRCA -0.411; TCGA CESC -0.894; TCGA HNSC -0.394; TCGA KIRC -0.628; TCGA KIRP -0.46; TCGA LUAD -0.231; TCGA LUSC -0.736; TCGA OV -0.378; TCGA PRAD -0.777; TCGA UCEC -1.723 |
hsa-let-7a-5p | RPUSD3 | 10 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD | MirTarget | TCGA BRCA -0.229; TCGA HNSC -0.199; TCGA KIRP -0.177; TCGA LGG -0.056; TCGA LIHC -0.259; TCGA LUAD -0.09; TCGA LUSC -0.298; TCGA OV -0.087; TCGA THCA -0.167; TCGA STAD -0.206 |
hsa-let-7a-5p | ARID3A | 9 cancers: BRCA; CESC; COAD; KIRC; LIHC; LUAD; LUSC; PAAD; UCEC | TargetScan | TCGA BRCA -0.19; TCGA CESC -0.467; TCGA COAD -0.532; TCGA KIRC -0.124; TCGA LIHC -0.634; TCGA LUAD -0.449; TCGA LUSC -0.264; TCGA PAAD -0.207; TCGA UCEC -0.487 |
hsa-let-7a-5p | B3GAT3 | 9 cancers: BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD | TargetScan | TCGA BRCA -0.164; TCGA HNSC -0.264; TCGA KIRP -0.151; TCGA LIHC -0.376; TCGA LUAD -0.284; TCGA LUSC -0.224; TCGA PAAD -0.163; TCGA THCA -0.077; TCGA STAD -0.274 |
hsa-let-7a-5p | CPSF4 | 10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA | TargetScan | TCGA BRCA -0.161; TCGA HNSC -0.17; TCGA KIRC -0.109; TCGA KIRP -0.098; TCGA LGG -0.075; TCGA LIHC -0.266; TCGA LUAD -0.21; TCGA LUSC -0.322; TCGA OV -0.116; TCGA THCA -0.118 |
hsa-let-7a-5p | DOCK3 | 12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | TargetScan; miRNATAP | TCGA BRCA -0.398; TCGA CESC -0.425; TCGA HNSC -0.243; TCGA KIRC -0.643; TCGA KIRP -0.378; TCGA LIHC -0.453; TCGA LUAD -0.346; TCGA LUSC -0.456; TCGA PRAD -0.632; TCGA SARC -1.053; TCGA STAD -0.437; TCGA UCEC -0.58 |
hsa-let-7a-5p | EIF2B2 | 9 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; STAD; UCEC | TargetScan | TCGA BRCA -0.06; TCGA CESC -0.192; TCGA HNSC -0.154; TCGA LIHC -0.126; TCGA LUAD -0.061; TCGA LUSC -0.238; TCGA OV -0.111; TCGA STAD -0.155; TCGA UCEC -0.087 |
hsa-let-7a-5p | ERGIC2 | 11 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC | TargetScan | TCGA BRCA -0.221; TCGA CESC -0.13; TCGA HNSC -0.16; TCGA KIRP -0.097; TCGA LIHC -0.122; TCGA LUAD -0.077; TCGA LUSC -0.339; TCGA OV -0.09; TCGA SARC -0.094; TCGA THCA -0.094; TCGA UCEC -0.114 |
hsa-let-7a-5p | FASTK | 10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD | TargetScan | TCGA BRCA -0.197; TCGA HNSC -0.285; TCGA KIRC -0.147; TCGA KIRP -0.179; TCGA LGG -0.143; TCGA LIHC -0.237; TCGA LUAD -0.342; TCGA LUSC -0.312; TCGA THCA -0.156; TCGA STAD -0.103 |
hsa-let-7a-5p | FBXL19 | 11 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; UCEC | TargetScan; miRNATAP | TCGA BRCA -0.147; TCGA COAD -0.225; TCGA HNSC -0.129; TCGA KIRP -0.19; TCGA LGG -0.13; TCGA LIHC -0.19; TCGA LUAD -0.424; TCGA LUSC -0.42; TCGA OV -0.137; TCGA THCA -0.052; TCGA UCEC -0.103 |
hsa-let-7a-5p | GEMIN7 | 9 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; THCA; UCEC | TargetScan | TCGA BRCA -0.154; TCGA CESC -0.192; TCGA HNSC -0.276; TCGA LIHC -0.302; TCGA LUAD -0.149; TCGA LUSC -0.411; TCGA OV -0.198; TCGA THCA -0.165; TCGA UCEC -0.129 |
hsa-let-7a-5p | GIPC1 | 10 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD | TargetScan; miRNATAP | TCGA BRCA -0.25; TCGA CESC -0.176; TCGA HNSC -0.269; TCGA KIRP -0.129; TCGA LGG -0.097; TCGA LIHC -0.204; TCGA LUAD -0.121; TCGA LUSC -0.234; TCGA THCA -0.188; TCGA STAD -0.16 |
hsa-let-7a-5p | PQLC2 | 9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD | TargetScan | TCGA BRCA -0.077; TCGA HNSC -0.218; TCGA LGG -0.122; TCGA LIHC -0.282; TCGA LUAD -0.21; TCGA LUSC -0.193; TCGA OV -0.098; TCGA THCA -0.165; TCGA STAD -0.113 |
hsa-let-7a-5p | SLC12A9 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC | TargetScan | TCGA BRCA -0.11; TCGA CESC -0.186; TCGA COAD -0.22; TCGA HNSC -0.134; TCGA KIRC -0.133; TCGA LGG -0.075; TCGA LIHC -0.163; TCGA LUAD -0.226; TCGA LUSC -0.139 |
hsa-let-7a-5p | SMUG1 | 9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA | TargetScan | TCGA BRCA -0.097; TCGA HNSC -0.205; TCGA KIRC -0.087; TCGA KIRP -0.173; TCGA LIHC -0.212; TCGA LUAD -0.222; TCGA LUSC -0.367; TCGA OV -0.175; TCGA THCA -0.092 |
hsa-let-7a-5p | TARBP2 | 13 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC | TargetScan | TCGA BRCA -0.141; TCGA CESC -0.159; TCGA HNSC -0.202; TCGA KIRC -0.107; TCGA KIRP -0.229; TCGA LGG -0.105; TCGA LIHC -0.293; TCGA LUAD -0.197; TCGA LUSC -0.348; TCGA OV -0.232; TCGA PAAD -0.198; TCGA THCA -0.068; TCGA UCEC -0.115 |
hsa-let-7a-5p | TEAD3 | 10 cancers: BRCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | TargetScan; miRNATAP | TCGA BRCA -0.087; TCGA COAD -0.261; TCGA HNSC -0.096; TCGA LUAD -0.081; TCGA LUSC -0.205; TCGA OV -0.156; TCGA PRAD -0.303; TCGA SARC -0.525; TCGA STAD -0.307; TCGA UCEC -0.162 |
hsa-let-7a-5p | TIMM17B | 12 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | TargetScan; miRNATAP | TCGA BRCA -0.288; TCGA HNSC -0.196; TCGA KIRP -0.154; TCGA LGG -0.1; TCGA LIHC -0.397; TCGA LUAD -0.305; TCGA LUSC -0.382; TCGA OV -0.194; TCGA SARC -0.105; TCGA THCA -0.108; TCGA STAD -0.321; TCGA UCEC -0.185 |
hsa-let-7a-5p | ZNRF1 | 11 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD | mirMAP | TCGA BRCA -0.301; TCGA COAD -0.211; TCGA HNSC -0.092; TCGA KIRP -0.194; TCGA LGG -0.101; TCGA LIHC -0.148; TCGA LUAD -0.103; TCGA LUSC -0.34; TCGA OV -0.119; TCGA PRAD -0.105; TCGA STAD -0.128 |
hsa-let-7a-5p | NLK | 10 cancers: CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC | TargetScan; miRNATAP | TCGA CESC -0.118; TCGA HNSC -0.124; TCGA KIRP -0.089; TCGA LIHC -0.088; TCGA LUAD -0.104; TCGA LUSC -0.12; TCGA OV -0.086; TCGA PAAD -0.129; TCGA SARC -0.084; TCGA UCEC -0.078 |
hsa-let-7a-5p | RASL10B | 10 cancers: CESC; COAD; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | TargetScan | TCGA CESC -0.386; TCGA COAD -0.72; TCGA LGG -0.095; TCGA LUAD -0.302; TCGA LUSC -0.456; TCGA OV -0.328; TCGA PRAD -0.552; TCGA SARC -0.382; TCGA STAD -0.557; TCGA UCEC -0.584 |
hsa-let-7a-5p | TBKBP1 | 9 cancers: COAD; KIRP; LGG; LIHC; LUAD; OV; THCA; STAD; UCEC | MirTarget; TargetScan; miRNATAP | TCGA COAD -0.398; TCGA KIRP -0.21; TCGA LGG -0.184; TCGA LIHC -0.278; TCGA LUAD -0.294; TCGA OV -0.315; TCGA THCA -0.078; TCGA STAD -0.31; TCGA UCEC -0.327 |
hsa-let-7a-5p | ATG4B | 9 cancers: COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV | TargetScan | TCGA COAD -0.112; TCGA HNSC -0.184; TCGA KIRC -0.125; TCGA KIRP -0.119; TCGA LGG -0.138; TCGA LIHC -0.172; TCGA LUAD -0.272; TCGA LUSC -0.189; TCGA OV -0.089 |
hsa-let-7a-5p | SOX12 | 9 cancers: KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; UCEC | mirMAP | TCGA KIRC -0.184; TCGA KIRP -0.206; TCGA LGG -0.193; TCGA LIHC -0.312; TCGA LUAD -0.332; TCGA LUSC -0.599; TCGA OV -0.178; TCGA THCA -0.087; TCGA UCEC -0.149 |
Enriched cancer pathways of putative targets