microRNA information: hsa-let-7a-5p

SectionIDlink
Mature name: hsa-let-7a-5pmiRbase
Accession: MIMAT0000062miRbase
Precursor name: hsa-let-7a-1 miRbase
Precursor accession: MI0000060miRbase
Symbol: MIRLET7A1HGNC
RefSeq ID: NR_029476GenBank
Sequence: UGAGGUAGUAGGUUGUAUAGUU



Reported expression in cancers: hsa-let-7a-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-let-7a-5p

breast cancerdownregulation"Previously we found that let-7 miRNAs were downreg ......"21826373
hsa-let-7a-5p

breast cancerdownregulation"The heterochronic microRNA let 7 inhibits cell mot ......"23339187
hsa-let-7a-5p

breast cancerdownregulation"Expression status of let 7a and miR 335 among brea ......"24942235
hsa-let-7a-5p

breast cancerdownregulation"Breast cancer specific TRAIL expression mediated b ......"25150312qPCR
hsa-let-7a-5p

colon cancerdownregulation"Recently let-7 miRNAs were found to regulate human ......"16651716
hsa-let-7a-5p

colon cancerdownregulation"Microarray analyses of miRNAs in exosome-enriched ......"24705249Microarray; qPCR
hsa-let-7a-5p

colorectal cancerupregulation"NIRF is frequently upregulated in colorectal cance ......"22018986
hsa-let-7a-5p

colorectal cancerupregulation"Of the 99 mCRC patients we studied differential mi ......"23098991Microarray
hsa-let-7a-5p

colorectal cancerupregulation"High expression of let-7 g was associated with a g ......"23932154
hsa-let-7a-5p

gastric cancerderegulation"miRNA expression signature was first analyzed by r ......"21628394qPCR
hsa-let-7a-5p

head and neck cancerderegulation"Significance was determined using significance ana ......"18798260Microarray
hsa-let-7a-5p

head and neck cancerderegulation"We found that expressions of miR‑424 let-7a miR ......"26323893
hsa-let-7a-5p

liver cancerdownregulation"In present study we found that the tumor suppresso ......"21814544
hsa-let-7a-5p

liver cancerdownregulation"Downregulation of let-7 miRNA in many human cancer ......"22289550
hsa-let-7a-5p

liver cancerdownregulation"The down-regulated let-7a was validated in another ......"24273923qPCR
hsa-let-7a-5p

liver cancerdownregulation"Let-7 family microRNAs have been reported to be do ......"24724096
hsa-let-7a-5p

lung cancerdownregulation"Reduced expression of the let 7 microRNAs in human ......"15172979
hsa-let-7a-5p

lung cancerdownregulation"Suppression of non small cell lung tumor developme ......"18308936
hsa-let-7a-5p

lung cancerdownregulation"Indeed some transcripts of the let-7 family that a ......"19275611
hsa-let-7a-5p

lung cancerdownregulation"Down-regulation of let-7 microRNA miRNA plays an i ......"20033209Reverse transcription PCR; qPCR
hsa-let-7a-5p

lung cancerdownregulation"Most miRs including all members of the let-7 famil ......"20068076qPCR
hsa-let-7a-5p

lung cancerdownregulation"MicroRNAs miRs are small noncoding RNA sequences t ......"24293999RNA-Seq
hsa-let-7a-5p

lymphomaupregulation"The major findings were: the detection of a panel ......"19945163
hsa-let-7a-5p

melanomadownregulation"A microRNA expression screen was performed analyzi ......"18379589qPCR
hsa-let-7a-5p

ovarian cancerdownregulation"Using microRNA microarrays we identify several miR ......"18560586Microarray
hsa-let-7a-5p

pancreatic cancerderegulation"We also found that the treatment of cells in vitro ......"22261338
hsa-let-7a-5p

pancreatic cancerderegulation"miR-122 let-7 family and miR-101 are down-regulate ......"22303361
hsa-let-7a-5p

prostate cancerdownregulation"Previous work has shown reduced expression levels ......"20418948
hsa-let-7a-5p

sarcomadownregulation"We detected decreased expression levels of some le ......"21412931



Reported cancer pathway affected by hsa-let-7a-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-let-7a-5p

breast cancerWnt signaling pathway; Apoptosis pathway; Notch signaling pathway"The miRNAs and their clusters such as the miR-200 ......"26712794
hsa-let-7a-5p

breast cancerApoptosis pathway"The tumor-suppressive let-7 family of microRNAs mi ......"27574028Western blot; Luciferase
hsa-let-7a-5p

cervical and endocervical cancerApoptosis pathway"The effects of lanthanum chloride on proliferation ......"26209160
hsa-let-7a-5p

colorectal cancercell cycle pathway"NIRF is frequently upregulated in colorectal cance ......"22018986Luciferase
hsa-let-7a-5p

esophageal cancerEpithelial mesenchymal transition pathway"HMGA2 is down regulated by microRNA let 7 and asso ......"24612219
hsa-let-7a-5p

head and neck cancerEpithelial mesenchymal transition pathway"The tumour suppressor roles of the let-7 family th ......"23340306
hsa-let-7a-5p

liver cancerApoptosis pathway"The let 7 family of microRNAs inhibits Bcl xL expr ......"20347499Western blot
hsa-let-7a-5p

lung cancercell cycle pathway"Reduced miR 31 and let 7 maintain the balance betw ......"22301433
hsa-let-7a-5p

lung cancerEpithelial mesenchymal transition pathway"Specifically let-7 and miR-9 are deregulated in bo ......"23365639
hsa-let-7a-5p

lung cancerApoptosis pathway"Specifically following HDAC inhibition MYC which n ......"26915294
hsa-let-7a-5p

lung squamous cell cancercell cycle pathway"Flow cytometry analysis revealed these miRNAs indu ......"19688090Flow cytometry
hsa-let-7a-5p

ovarian cancerApoptosis pathway"Estrogen combined with progesterone decreases cell ......"24643702MTT assay; Western blot
hsa-let-7a-5p

prostate cancercell cycle pathway"MicroRNA let 7a inhibits proliferation of human pr ......"20418948Western blot; Luciferase
hsa-let-7a-5p

prostate cancercell cycle pathway"Distinct microRNA expression profiles in prostate ......"22719071
hsa-let-7a-5p

prostate cancercell cycle pathway; Apoptosis pathway"Reduced microRNA miRNA let-7a expression and the a ......"23974362Western blot; Luciferase; Flow cytometry; MTT assay
hsa-let-7a-5p

sarcomaEpithelial mesenchymal transition pathway"Using miRNA microarrays capable of detecting a kno ......"24457375Cell proliferation assay; Cell Proliferation Assay
hsa-let-7a-5p

sarcomacell cycle pathway"Tumor suppressive microRNA let 7a inhibits cell pr ......"25647078
hsa-let-7a-5p

sarcomacell cycle pathway"c Myc Represses Tumor Suppressive microRNAs let 7a ......"26393798



Reported cancer prognosis affected by hsa-let-7a-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-let-7a-5p

acute myeloid leukemiadifferentiation"We studied miRNA expression of leukemic blasts of ......"20425795
hsa-let-7a-5p

acute myeloid leukemiapoor survival"MicroRNA let 7a 3 gene methylation is associated w ......"24703161
hsa-let-7a-5p

bladder cancerpoor survival"A let 7 microRNA binding site polymorphism in the ......"27620744
hsa-let-7a-5p

breast cancermalignant trasformation"To obtain insight into miRNA deregulation in breas ......"18089790
hsa-let-7a-5p

breast cancermalignant trasformation"Real-time quantitative PCR RQ-PCR is a sensitive a ......"18718003
hsa-let-7a-5p

breast cancertumorigenesis; staging; malignant trasformation"Let 7 family miRNAs regulate estrogen receptor alp ......"20535543Luciferase
hsa-let-7a-5p

breast cancermetastasis"To identify microRNAs miRNA involved in metastasis ......"21057539
hsa-let-7a-5p

breast cancerdrug resistance"let 7 microRNAs induce tamoxifen sensitivity by do ......"21826373Luciferase
hsa-let-7a-5p

breast cancertumorigenesis"LIN28: a regulator of tumor suppressing activity o ......"22081076
hsa-let-7a-5p

breast cancercell migration"MicroRNA let 7a suppresses breast cancer cell migr ......"22251626Luciferase
hsa-let-7a-5p

breast cancerdrug resistance"Lin28 mediates paclitaxel resistance by modulating ......"22808086
hsa-let-7a-5p

breast cancermotility; metastasis"The heterochronic microRNA let 7 inhibits cell mot ......"23339187
hsa-let-7a-5p

breast cancermalignant trasformation"The Wnt β catenin pathway represses let 7 microRN ......"23613467
hsa-let-7a-5p

breast cancermalignant trasformation"Here we identified 33 miRNAs with similar deregula ......"24104550
hsa-let-7a-5p

breast cancerdrug resistance"Breast cancer specific TRAIL expression mediated b ......"25150312Luciferase
hsa-let-7a-5p

breast cancermetastasis; motility"Among these we identified miRNAs previously associ ......"25277099
hsa-let-7a-5p

breast cancerstaging"MiR 208a stimulates the cocktail of SOX2 and β ca ......"26460550
hsa-let-7a-5p

breast cancerrecurrence"Multiple Let-7 family members were negatively corr ......"26717565
hsa-let-7a-5p

breast cancerdrug resistance"Specifically we will discuss key miRNAs involved i ......"27721895
hsa-let-7a-5p

colon cancerstaging"Microarray analyses of miRNAs in exosome-enriched ......"24705249
hsa-let-7a-5p

colon cancerstaging"Association study of the let 7 miRNA complementary ......"24727325
hsa-let-7a-5p

colon cancermetastasis"Nine dysregulated miRNA pairs fell into three miRN ......"25287248
hsa-let-7a-5p

colorectal cancerpoor survival"Genetic modulation of the Let 7 microRNA binding t ......"20177422
hsa-let-7a-5p

colorectal cancerdrug resistance; poor survival"A let 7 microRNA binding site polymorphism in 3' u ......"20603437
hsa-let-7a-5p

colorectal cancerstaging; poor survival"A let 7 microRNA SNP in the KRAS 3'UTR is prognost ......"21994416
hsa-let-7a-5p

colorectal cancercell migration"NIRF is frequently upregulated in colorectal cance ......"22018986Luciferase
hsa-let-7a-5p

colorectal cancermetastasis"Expression of target miRs in micro-dissected paraf ......"22120473
hsa-let-7a-5p

colorectal cancerprogression; poor survival"High let 7a microRNA levels in KRAS mutated colore ......"22584434
hsa-let-7a-5p

colorectal cancerdrug resistance"The LCS6 polymorphism in the binding site of let 7 ......"23324806
hsa-let-7a-5p

colorectal cancerworse prognosis"High expression of let-7 g was associated with a g ......"23932154
hsa-let-7a-5p

colorectal cancermetastasis"Expressions of target miRNAs in serum were evaluat ......"24653631
hsa-let-7a-5p

colorectal cancerdrug resistance"We identified a miRNA profile that was analysed by ......"25197016
hsa-let-7a-5p

colorectal cancerprogression"rs712 polymorphism within let 7 microRNA binding s ......"26543374
hsa-let-7a-5p

colorectal cancertumorigenesis"In contrast expression levels of let-7a-5p 7e-5p 7 ......"26643896
hsa-let-7a-5p

colorectal cancerstaging"Simultaneous Underexpression of let 7a 5p and let ......"26793011
hsa-let-7a-5p

colorectal cancerpoor survival; immune evasion; immune resistance"MicroRNA let 7 T cells and patient survival in col ......"27737877
hsa-let-7a-5p

esophageal cancermetastasis; tumorigenesis"Role of microRNA let 7 and effect to HMGA2 in esop ......"21598109Western blot
hsa-let-7a-5p

esophageal cancerstaging"Expression of circulating microRNA 20a and let 7a ......"25914476
hsa-let-7a-5p

gastric cancerpoor survival"Several microarray studies have reported microRNA ......"19951901
hsa-let-7a-5p

gastric cancermetastasis; tumorigenesis"Let 7 microRNA family is selectively secreted into ......"20949044Western blot
hsa-let-7a-5p

gastric cancerdifferentiation"CSC characteristics were checked using spheroid fo ......"22374783Colony formation
hsa-let-7a-5p

gastric cancerpoor survival; worse prognosis"A new polymorphism biomarker rs629367 associated w ......"24760009
hsa-let-7a-5p

head and neck cancerdrug resistance; metastasis; poor survival"MicroRNA let 7a represses chemoresistance and tumo ......"21292542
hsa-let-7a-5p

liver cancermotility; drug resistance"We evaluated the expression of microRNA in human H ......"21352471
hsa-let-7a-5p

lung cancerpoor survival"Reduced expression of the let 7 microRNAs in human ......"15172979
hsa-let-7a-5p

lung cancerdifferentiation"Reduced miR 31 and let 7 maintain the balance betw ......"22301433
hsa-let-7a-5p

lung cancermalignant trasformation"Targeted delivery of let 7a microRNA encapsulated ......"24293999
hsa-let-7a-5p

lung cancerpoor survival"Specifically following HDAC inhibition MYC which n ......"26915294
hsa-let-7a-5p

lung squamous cell cancerprogression"Flow cytometry analysis revealed these miRNAs indu ......"19688090Flow cytometry
hsa-let-7a-5p

lung squamous cell cancerstaging; recurrence"In an exploratory study we determined whether expr ......"20975375
hsa-let-7a-5p

lung squamous cell cancermetastasis"MicroRNA let 7a inhibits the proliferation and inv ......"23134218Cell proliferation assay; Cell Proliferation Assay
hsa-let-7a-5p

lung squamous cell cancerpoor survival"The clinical and functional significance of RNA-in ......"23349018RNAi
hsa-let-7a-5p

lung squamous cell cancermetastasis; staging; poor survival"Different members of let-7 family have been report ......"23981581
hsa-let-7a-5p

lung squamous cell cancerpoor survival"Systemic nanodelivery of miR-34 and let-7 suppress ......"25174400
hsa-let-7a-5p

lung squamous cell cancerstaging"Expression of microRNA let 7a miR 155 and miR 205 ......"27296000
hsa-let-7a-5p

melanomamalignant trasformation"A microRNA expression screen was performed analyzi ......"18379589
hsa-let-7a-5p

melanomamalignant trasformation; progression"Integrin beta 3 expression is regulated by let 7a ......"18679415
hsa-let-7a-5p

melanomaprogression"In situ analysis of melanoma samples using progres ......"23728176
hsa-let-7a-5p

melanomadifferentiation"Metabolic reprogramming of metastatic breast cance ......"25669981
hsa-let-7a-5p

ovarian cancerworse prognosis"We highlight the role of the let-7 and miR-200 fam ......"20083225
hsa-let-7a-5p

ovarian cancerdrug resistance"Luciferase assays and real-time PCRs showed that t ......"21109987Luciferase
hsa-let-7a-5p

ovarian cancermetastasis"miRNA microarray was applied to compare the miRNA ......"21122376
hsa-let-7a-5p

ovarian cancerdrug resistance; poor survival; staging; progression"Let-7 is a family of small non-coding RNAs regulat ......"21571355
hsa-let-7a-5p

ovarian cancerworse prognosis; staging"Two families of miRNAs miR-200 and let-7 are frequ ......"23237306
hsa-let-7a-5p

ovarian cancerpoor survival"Estrogen combined with progesterone decreases cell ......"24643702MTT assay; Western blot
hsa-let-7a-5p

ovarian cancerpoor survival; worse prognosis"MicroRNA let 7a modifies the effect of self renewa ......"25630839
hsa-let-7a-5p

pancreatic cancerprogression"let 7 MicroRNA transfer in pancreatic cancer deriv ......"19323605
hsa-let-7a-5p

pancreatic cancerpoor survival"The expression of miR-21 was significantly higher ......"21139804
hsa-let-7a-5p

pancreatic cancertumorigenesis"miR-122 let-7 family and miR-101 are down-regulate ......"22303361
hsa-let-7a-5p

pancreatic cancermetastasis"We therefore established a screening strategy to f ......"23733161Western blot
hsa-let-7a-5p

pancreatic cancerpoor survival"Quantitative real-time PCR qRT-PCR was subsequentl ......"26819679
hsa-let-7a-5p

pancreatic cancerdrug resistance"In particular modulations of let-7 miR-29a miR-17- ......"27539232
hsa-let-7a-5p

prostate cancerprogression; poor survival"Distinct microRNA expression profile in prostate c ......"23798998
hsa-let-7a-5p

prostate cancerprogression"Reduced microRNA miRNA let-7a expression and the a ......"23974362Western blot; Luciferase; Flow cytometry; MTT assay
hsa-let-7a-5p

prostate cancerdrug resistance; metastasis"Loss of let 7 microRNA upregulates IL 6 in bone ma ......"23977098Luciferase
hsa-let-7a-5p

prostate cancermalignant trasformation"Role of miRNA let 7 and its major targets in prost ......"25276782
hsa-let-7a-5p

sarcomamalignant trasformation"Let 7 microRNA and HMGA2 levels of expression are ......"21412931
hsa-let-7a-5p

sarcomaprogression"Tumor suppressive microRNA let 7a inhibits cell pr ......"25647078
hsa-let-7a-5p

sarcomaprogression"c Myc Represses Tumor Suppressive microRNAs let 7a ......"26393798
hsa-let-7a-5p

thyroid cancerdifferentiation"Effects of let 7 microRNA on Cell Growth and Diffe ......"19956384



Reported gene related to hsa-let-7a-5p

miRNAcancergenereportingPUBMED
hsa-let-7a-5p

bladder cancerKRAS"A let 7 microRNA binding site polymorphism in the ......"27620744
hsa-let-7a-5p

colon cancerKRAS"Association study of the let 7 miRNA complementary ......"24727325
hsa-let-7a-5p

colorectal cancerKRAS"A let 7 microRNA binding site polymorphism in 3' u ......"20603437
hsa-let-7a-5p

colorectal cancerKRAS"Let 7 microRNA binding site polymorphism in the 3' ......"24890702
hsa-let-7a-5p

colorectal cancerKRAS"The LCS6 polymorphism in the binding site of let 7 ......"23324806
hsa-let-7a-5p

colorectal cancerKRAS"A let 7 microRNA SNP in the KRAS 3'UTR is prognost ......"21994416
hsa-let-7a-5p

colorectal cancerKRAS"Let 7 miRNA binding site polymorphism in the KRAS ......"23167843
hsa-let-7a-5p

colorectal cancerKRAS"Genetic modulation of the Let 7 microRNA binding t ......"20177422
hsa-let-7a-5p

colorectal cancerKRAS"A let 7 microRNA binding site polymorphism in KRAS ......"25183481
hsa-let-7a-5p

colorectal cancerKRAS"High let 7a microRNA levels in KRAS mutated colore ......"22584434
hsa-let-7a-5p

lung squamous cell cancerKRAS"A SNP in a let 7 microRNA complementary site in th ......"18922928
hsa-let-7a-5p

esophageal cancerHMGA2"Role of microRNA let 7 and effect to HMGA2 in esop ......"21598109
hsa-let-7a-5p

esophageal cancerHMGA2"HMGA2 is down regulated by microRNA let 7 and asso ......"24612219
hsa-let-7a-5p

gastric cancerHMGA2"Since let-7 miRNAs generally play a tumor-suppress ......"20949044
hsa-let-7a-5p

gastric cancerHMGA2"Recent studies report that HMGA2 is negatively reg ......"18413822
hsa-let-7a-5p

lung cancerHMGA2"MiR-98 a member in the let-7 family acts as a nega ......"23700794
hsa-let-7a-5p

lung squamous cell cancerHMGA2"MicroRNA let 7a inhibits the proliferation and inv ......"23134218
hsa-let-7a-5p

ovarian cancerHMGA2"HMGA2 mRNA and let-7 family microRNA were detected ......"23073586
hsa-let-7a-5p

sarcomaHMGA2"Let 7 microRNA and HMGA2 levels of expression are ......"21412931
hsa-let-7a-5p

glioblastomaHRAS"Transfection of let-7 miRNA reduced expression of ......"20607356
hsa-let-7a-5p

lung cancerHRAS"Using an established orthotopic mouse lung cancer ......"18344688
hsa-let-7a-5p

lung cancerHRAS"k-Ras and c-Myc two key oncogenes in lung cancer h ......"20033209
hsa-let-7a-5p

lung squamous cell cancerHRAS"MicroRNA let 7a inhibits the proliferation and inv ......"23134218
hsa-let-7a-5p

pancreatic cancerHRAS"Because let-7 microRNA targets the K-ras oncogene ......"19323605
hsa-let-7a-5p

breast cancerLIN28A"We identified an inverse relationship between miR- ......"26460550
hsa-let-7a-5p

breast cancerLIN28A"Lin28 mediates paclitaxel resistance by modulating ......"22808086
hsa-let-7a-5p

breast cancerLIN28A"LIN28 is a RNA-binding protein that has been well ......"22081076
hsa-let-7a-5p

breast cancerLIN28A"The Wnt β catenin pathway represses let 7 microRN ......"23613467
hsa-let-7a-5p

prostate cancerLIN28A"Furthermore let-7c expression is downregulated in ......"22479342
hsa-let-7a-5p

colorectal cancerEGFR"The LCS6 polymorphism in the binding site of let 7 ......"23324806
hsa-let-7a-5p

colorectal cancerEGFR"High let 7a microRNA levels in KRAS mutated colore ......"22584434
hsa-let-7a-5p

lung cancerEGFR"We elected to validate our model in vitro by testi ......"23365639
hsa-let-7a-5p

lung cancerMYC"We elected to validate our model in vitro by testi ......"23365639
hsa-let-7a-5p

lung cancerMYC"k-Ras and c-Myc two key oncogenes in lung cancer h ......"20033209
hsa-let-7a-5p

lymphomaMYC"MicroRNA let 7a down regulates MYC and reverts MYC ......"17942906
hsa-let-7a-5p

lung cancerBCL2"As a result transcript levels of the tumor-suppres ......"26915294
hsa-let-7a-5p

ovarian cancerBCL2"Estrogen combined with progesterone decreases cell ......"24643702
hsa-let-7a-5p

liver cancerBCL2L1"The let 7 family of microRNAs inhibits Bcl xL expr ......"20347499
hsa-let-7a-5p

lung cancerBCL2L1"As a result transcript levels of the tumor-suppres ......"26915294
hsa-let-7a-5p

breast cancerDICER1"In let-7a overexpressed ZR75-1 and MM-231 cells DI ......"26460550
hsa-let-7a-5p

melanomaDICER1"Importantly we discovered that ADAR1 fundamentally ......"23728176
hsa-let-7a-5p

prostate cancerE2F2"MicroRNA let 7a inhibits proliferation of human pr ......"20418948
hsa-let-7a-5p

sarcomaE2F2"Tumor suppressive microRNA let 7a inhibits cell pr ......"25647078
hsa-let-7a-5p

breast cancerESR1"Let 7 family miRNAs regulate estrogen receptor alp ......"20535543
hsa-let-7a-5p

breast cancerESR1"let 7 microRNAs induce tamoxifen sensitivity by do ......"21826373
hsa-let-7a-5p

lymphomaHGS"Our studies here demonstrate that PRDM1/blimp-1 is ......"18583325
hsa-let-7a-5p

ovarian cancerHGS"The hazards ratios HRs for death and disease progr ......"21571355
hsa-let-7a-5p

liver cancerIL6"Knocking down IL-6 and Twist in HSCs significantly ......"21352471
hsa-let-7a-5p

prostate cancerIL6"Loss of let 7 microRNA upregulates IL 6 in bone ma ......"23977098
hsa-let-7a-5p

colorectal cancerNRGN"This method was able to detect let-7a miRNA in as ......"17944059
hsa-let-7a-5p

gastric cancerNRGN"The dynamic range and sensitivity of the let-7a mi ......"17569129
hsa-let-7a-5p

melanomaADAR"Importantly we discovered that ADAR1 fundamentally ......"23728176
hsa-let-7a-5p

melanomaBHLHE22"Transfection of melanoma cells with let-7a pre-miR ......"18679415
hsa-let-7a-5p

esophageal cancerBRD2"Let-7 expressions were detected in esophageal canc ......"21598109
hsa-let-7a-5p

breast cancerCCL21"The expression of CCR7 its ligand CCL21 and let-7a ......"22251626
hsa-let-7a-5p

prostate cancerCCND2"MicroRNA let 7a inhibits proliferation of human pr ......"20418948
hsa-let-7a-5p

breast cancerCCR7"In the present study the authors demonstrated that ......"22251626
hsa-let-7a-5p

acute myeloid leukemiaCEBPA"MicroRNA let 7a 3 gene methylation is associated w ......"24703161
hsa-let-7a-5p

gastric cancerDDR1"Let-7 g improved the effects of X-rays on GC cells ......"25972194
hsa-let-7a-5p

lung cancerEFNA1"Targeted delivery of let 7a microRNA encapsulated ......"24293999
hsa-let-7a-5p

breast cancerERBB2"For instance an abundant expression of multiple le ......"25907662
hsa-let-7a-5p

B cell lymphomaGBA"Let-7 in particular let-7b is overexpressed in DLB ......"20651244
hsa-let-7a-5p

head and neck cancerHMI"Subsequently microarray analysis followed by Ingen ......"27588466
hsa-let-7a-5p

prostate cancerIGF1R"Reduced microRNA miRNA let-7a expression and the a ......"23974362
hsa-let-7a-5p

melanomaITGA9"Transfection of melanoma cells with let-7a pre-miR ......"18679415
hsa-let-7a-5p

breast cancerKDM5B"In MCF-7 cells with stable RNAi-mediated suppressi ......"21969366
hsa-let-7a-5p

ovarian cancerKLK6"The transient transfection of hsa-let-7a to OVCAR- ......"23136250
hsa-let-7a-5p

lung cancerLAT2"A549-let-7a cell line and A549-control cell line t ......"20033209
hsa-let-7a-5p

lung squamous cell cancerLCS1"The purpose of this study was to identify single n ......"18922928
hsa-let-7a-5p

melanomaLIN28B"Mechanistically we discovered that Lin28B a well-c ......"26071398
hsa-let-7a-5p

breast cancerLMNA"Twenty-five differentially expressed miRNAs P < 0. ......"20535543
hsa-let-7a-5p

pancreatic cancerMAP2K6"Restoring let-7 levels in cancer-derived cell line ......"19323605
hsa-let-7a-5p

head and neck cancerMMP8"However the role of let-7 in head and neck cancer ......"21292542
hsa-let-7a-5p

colorectal cancerMTUS1"In contrast let-7a-5p 7e-5p 7f-5p miR-125a-5p and ......"26643896
hsa-let-7a-5p

head and neck cancerNANOG"Most importantly overexpression of let-7 or knockd ......"21292542
hsa-let-7a-5p

thyroid cancerNKX2-1"In addition let-7 enhanced transcriptional express ......"19956384
hsa-let-7a-5p

glioblastomaNRAS"Transfection of let-7 miRNA reduced expression of ......"20607356
hsa-let-7a-5p

gastric cancerPGC"This study examined the expression patterns of ser ......"25549793
hsa-let-7a-5p

ovarian cancerPGRMC1"In conclusion we propose that PGRMC1 expression is ......"21109987
hsa-let-7a-5p

ovarian cancerPIWIL1"MicroRNA let 7a modifies the effect of self renewa ......"25630839
hsa-let-7a-5p

B cell lymphomaPRDM1"Data obtained from expression analysis luciferase ......"20651244
hsa-let-7a-5p

breast cancerRASSF1"RASSF1A resulted more frequently methylated in men ......"23160909
hsa-let-7a-5p

melanomaROS1"Moreover let-7a causes mitochondrial ROS productio ......"25669981
hsa-let-7a-5p

lung squamous cell cancerSCLC1"Among them five downregulated miRNAs let-7 miR-20 ......"23117485
hsa-let-7a-5p

sarcomaSERPINH1"Using a quantitative shotgun proteomics approach w ......"24457375
hsa-let-7a-5p

ovarian cancerSLC10A4"E2 + P4 promoted the expression of let-7a and miR- ......"24643702
hsa-let-7a-5p

pancreatic cancerSOCS3"MicroRNA let 7 downregulates STAT3 phosphorylation ......"24491408
hsa-let-7a-5p

breast cancerSOX2"We identified an inverse relationship between miR- ......"26460550
hsa-let-7a-5p

colon cancerSTAB2"Nine dysregulated miRNA pairs fell into three miRN ......"25287248
hsa-let-7a-5p

pancreatic cancerSTAT3"MicroRNA let 7 downregulates STAT3 phosphorylation ......"24491408
hsa-let-7a-5p

breast cancerTAM"Transfection of let-7 mimics to Tam-resistant MCF7 ......"21826373
hsa-let-7a-5p

colorectal cancerTGFBR1"rs868 is contained in a let-7 miRNA binding site i ......"27234654
hsa-let-7a-5p

liver cancerTRIM71"Lin-41 is a stem cell-specific E3 ligase and a kno ......"23097274
hsa-let-7a-5p

liver cancerTWIST1"Knocking down IL-6 and Twist in HSCs significantly ......"21352471
hsa-let-7a-5p

sarcomaVIM"Using a quantitative shotgun proteomics approach w ......"24457375



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-let-7a-5p
C2CD4A
10 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.434; TCGA BRCA -0.406; TCGA CESC -0.726; TCGA KIRC -0.413; TCGA LUAD -0.765; TCGA LUSC -0.869; TCGA PRAD -0.336; TCGA SARC -0.328; TCGA THCA -0.776; TCGA UCEC -0.45
hsa-let-7a-5p
CDC25B
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.203; TCGA BRCA -0.432; TCGA CESC -0.201; TCGA HNSC -0.2; TCGA KIRC -0.157; TCGA LGG -0.101; TCGA LIHC -0.209; TCGA LUAD -0.283; TCGA LUSC -0.2; TCGA THCA -0.185; TCGA UCEC -0.404
hsa-let-7a-5p
KLHDC8B
9 cancers: BLCA; COAD; ESCA; LGG; LIHC; PRAD; SARC; STAD; UCEC
MirTarget; TargetScan; miRNATAP
TCGA BLCA -0.26; TCGA COAD -0.258; TCGA ESCA -0.228; TCGA LGG -0.143; TCGA LIHC -0.139; TCGA PRAD -0.13; TCGA SARC -0.269; TCGA STAD -0.292; TCGA UCEC -0.353
hsa-let-7a-5p
IGF2BP3
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; UCEC
MirTarget; TargetScan
TCGA BLCA -0.737; TCGA BRCA -0.46; TCGA CESC -0.812; TCGA KIRC -0.408; TCGA KIRP -0.436; TCGA LIHC -0.773; TCGA LUAD -0.726; TCGA LUSC -1.447; TCGA OV -0.733; TCGA UCEC -0.861
hsa-let-7a-5p
GLRX
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; PRAD; THCA; STAD; UCEC
MirTarget; TargetScan
TCGA BLCA -0.298; TCGA BRCA -0.152; TCGA ESCA -0.27; TCGA HNSC -0.18; TCGA KIRP -0.195; TCGA LIHC -0.209; TCGA PRAD -0.242; TCGA THCA -0.272; TCGA STAD -0.266; TCGA UCEC -0.242
hsa-let-7a-5p
DLGAP4
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
MirTarget; TargetScan
TCGA BLCA -0.113; TCGA BRCA -0.12; TCGA CESC -0.131; TCGA COAD -0.277; TCGA HNSC -0.118; TCGA LIHC -0.122; TCGA LUAD -0.172; TCGA LUSC -0.147; TCGA OV -0.069; TCGA PRAD -0.064; TCGA THCA -0.09; TCGA STAD -0.119
hsa-let-7a-5p
ADAMTS14
9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PRAD; THCA; UCEC
TargetScan
TCGA BLCA -0.58; TCGA BRCA -0.419; TCGA CESC -0.597; TCGA HNSC -0.263; TCGA LUAD -0.562; TCGA LUSC -0.359; TCGA PRAD -0.205; TCGA THCA -0.82; TCGA UCEC -0.315
hsa-let-7a-5p
DPH3
9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; OV; PRAD; STAD; UCEC
TargetScan
TCGA BLCA -0.226; TCGA BRCA -0.105; TCGA CESC -0.14; TCGA HNSC -0.093; TCGA LIHC -0.207; TCGA OV -0.082; TCGA PRAD -0.2; TCGA STAD -0.099; TCGA UCEC -0.196
hsa-let-7a-5p
EIF2S2
10 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC
TargetScan
TCGA BLCA -0.084; TCGA BRCA -0.257; TCGA HNSC -0.26; TCGA KIRP -0.167; TCGA LIHC -0.249; TCGA LUAD -0.065; TCGA LUSC -0.337; TCGA OV -0.136; TCGA THCA -0.123; TCGA UCEC -0.174
hsa-let-7a-5p
FADS3
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; THCA; UCEC
TargetScan
TCGA BLCA -0.25; TCGA BRCA -0.247; TCGA CESC -0.495; TCGA HNSC -0.341; TCGA KIRP -0.298; TCGA LIHC -0.292; TCGA LUAD -0.126; TCGA THCA -0.322; TCGA UCEC -0.157
hsa-let-7a-5p
FBXO32
10 cancers: BLCA; COAD; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
TargetScan; miRNATAP
TCGA BLCA -0.773; TCGA COAD -0.434; TCGA LIHC -0.409; TCGA LUAD -0.285; TCGA LUSC -0.666; TCGA PRAD -0.44; TCGA SARC -0.983; TCGA THCA -0.456; TCGA STAD -0.385; TCGA UCEC -0.238
hsa-let-7a-5p
FKRP
10 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
TargetScan
TCGA BLCA -0.098; TCGA COAD -0.151; TCGA HNSC -0.085; TCGA KIRP -0.094; TCGA LUAD -0.122; TCGA LUSC -0.13; TCGA OV -0.16; TCGA PAAD -0.141; TCGA STAD -0.101; TCGA UCEC -0.106
hsa-let-7a-5p
GOLT1B
9 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; UCEC
TargetScan
TCGA BLCA -0.123; TCGA BRCA -0.207; TCGA HNSC -0.125; TCGA LIHC -0.097; TCGA LUAD -0.103; TCGA LUSC -0.24; TCGA OV -0.134; TCGA PAAD -0.127; TCGA UCEC -0.143
hsa-let-7a-5p
GPR137
9 cancers: BLCA; BRCA; COAD; KIRP; LGG; LUAD; OV; PAAD; STAD
TargetScan; miRNATAP
TCGA BLCA -0.092; TCGA BRCA -0.105; TCGA COAD -0.128; TCGA KIRP -0.121; TCGA LGG -0.126; TCGA LUAD -0.153; TCGA OV -0.116; TCGA PAAD -0.143; TCGA STAD -0.183
hsa-let-7a-5p
INPP5A
9 cancers: BLCA; BRCA; CESC; COAD; LGG; OV; SARC; STAD; UCEC
TargetScan; miRNATAP
TCGA BLCA -0.311; TCGA BRCA -0.066; TCGA CESC -0.156; TCGA COAD -0.169; TCGA LGG -0.075; TCGA OV -0.163; TCGA SARC -0.301; TCGA STAD -0.289; TCGA UCEC -0.159
hsa-let-7a-5p
MED8
9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; UCEC
TargetScan; miRNATAP
TCGA BLCA -0.115; TCGA BRCA -0.213; TCGA CESC -0.161; TCGA HNSC -0.216; TCGA LIHC -0.23; TCGA LUAD -0.1; TCGA LUSC -0.152; TCGA OV -0.112; TCGA UCEC -0.119
hsa-let-7a-5p
PLEKHO1
9 cancers: BLCA; BRCA; COAD; LIHC; LUAD; PRAD; SARC; THCA; STAD
TargetScan; miRNATAP
TCGA BLCA -0.744; TCGA BRCA -0.233; TCGA COAD -0.309; TCGA LIHC -0.304; TCGA LUAD -0.105; TCGA PRAD -0.528; TCGA SARC -0.286; TCGA THCA -0.161; TCGA STAD -0.406
hsa-let-7a-5p
RBM38
12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
TargetScan; miRNATAP
TCGA BLCA -0.165; TCGA BRCA -0.395; TCGA COAD -0.271; TCGA HNSC -0.101; TCGA LGG -0.096; TCGA LUAD -0.223; TCGA LUSC -0.227; TCGA OV -0.123; TCGA PRAD -0.596; TCGA SARC -0.668; TCGA STAD -0.167; TCGA UCEC -0.199
hsa-let-7a-5p
SLC8A2
10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
TargetScan; mirMAP; miRNATAP
TCGA BLCA -0.539; TCGA COAD -1.16; TCGA ESCA -0.611; TCGA HNSC -0.33; TCGA LUAD -0.339; TCGA LUSC -0.539; TCGA PRAD -0.775; TCGA SARC -0.608; TCGA STAD -1.166; TCGA UCEC -0.818
hsa-let-7a-5p
SPEG
11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
TargetScan; miRNATAP
TCGA BLCA -1.342; TCGA COAD -1.42; TCGA HNSC -0.346; TCGA KIRC -0.447; TCGA KIRP -0.562; TCGA LGG -0.113; TCGA LUAD -0.413; TCGA PRAD -1.156; TCGA SARC -1.237; TCGA STAD -0.848; TCGA UCEC -0.812
hsa-let-7a-5p
LOXL3
9 cancers: BLCA; BRCA; CESC; LUAD; OV; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.677; TCGA BRCA -0.123; TCGA CESC -0.241; TCGA LUAD -0.189; TCGA OV -0.244; TCGA PRAD -0.441; TCGA THCA -0.173; TCGA STAD -0.205; TCGA UCEC -0.306
hsa-let-7a-5p
CS
9 cancers: BRCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA
miRNAWalker2 validate
TCGA BRCA -0.071; TCGA CESC -0.126; TCGA KIRC -0.079; TCGA KIRP -0.185; TCGA LIHC -0.105; TCGA LUAD -0.059; TCGA LUSC -0.177; TCGA PAAD -0.101; TCGA THCA -0.136
hsa-let-7a-5p
E2F1
9 cancers: BRCA; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.564; TCGA HNSC -0.321; TCGA LIHC -0.451; TCGA LUAD -0.523; TCGA LUSC -0.594; TCGA OV -0.284; TCGA SARC -0.231; TCGA THCA -0.553; TCGA UCEC -0.253
hsa-let-7a-5p
GADD45GIP1
9 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA BRCA -0.183; TCGA HNSC -0.321; TCGA KIRP -0.227; TCGA LGG -0.117; TCGA LIHC -0.411; TCGA LUAD -0.163; TCGA LUSC -0.334; TCGA THCA -0.194; TCGA STAD -0.203
hsa-let-7a-5p
HMGA1
9 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; TargetScan; miRNATAP
TCGA BRCA -0.452; TCGA CESC -0.253; TCGA HNSC -0.22; TCGA KIRP -0.251; TCGA LIHC -0.493; TCGA LUAD -0.363; TCGA LUSC -0.78; TCGA OV -0.308; TCGA UCEC -0.53
hsa-let-7a-5p
HMGA2
9 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; TargetScan
TCGA BRCA -0.245; TCGA CESC -1.416; TCGA COAD -0.393; TCGA HNSC -0.767; TCGA LIHC -0.523; TCGA LUAD -0.438; TCGA LUSC -1.721; TCGA OV -0.774; TCGA UCEC -0.787
hsa-let-7a-5p
MRPL15
10 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.329; TCGA CESC -0.141; TCGA HNSC -0.222; TCGA KIRP -0.168; TCGA LIHC -0.208; TCGA LUAD -0.152; TCGA LUSC -0.438; TCGA OV -0.094; TCGA THCA -0.11; TCGA UCEC -0.174
hsa-let-7a-5p
NKIRAS2
12 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; TargetScan; miRNATAP
TCGA BRCA -0.128; TCGA HNSC -0.068; TCGA KIRP -0.113; TCGA LGG -0.113; TCGA LIHC -0.115; TCGA LUAD -0.183; TCGA LUSC -0.261; TCGA OV -0.11; TCGA SARC -0.094; TCGA THCA -0.061; TCGA STAD -0.154; TCGA UCEC -0.112
hsa-let-7a-5p
PREB
12 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.19; TCGA CESC -0.193; TCGA HNSC -0.101; TCGA KIRP -0.122; TCGA LIHC -0.122; TCGA LUAD -0.162; TCGA LUSC -0.23; TCGA OV -0.161; TCGA SARC -0.146; TCGA THCA -0.093; TCGA STAD -0.183; TCGA UCEC -0.084
hsa-let-7a-5p
PTGES2
9 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; THCA
miRNAWalker2 validate
TCGA BRCA -0.147; TCGA CESC -0.13; TCGA HNSC -0.146; TCGA KIRP -0.199; TCGA LGG -0.107; TCGA LIHC -0.28; TCGA LUAD -0.25; TCGA LUSC -0.349; TCGA THCA -0.11
hsa-let-7a-5p
SHMT2
9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA
miRNAWalker2 validate
TCGA BRCA -0.224; TCGA KIRP -0.19; TCGA LGG -0.105; TCGA LIHC -0.114; TCGA LUAD -0.263; TCGA LUSC -0.509; TCGA OV -0.163; TCGA PAAD -0.162; TCGA THCA -0.231
hsa-let-7a-5p
SNRPC
9 cancers: BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.251; TCGA HNSC -0.234; TCGA KIRP -0.116; TCGA LIHC -0.313; TCGA LUAD -0.163; TCGA LUSC -0.328; TCGA OV -0.293; TCGA THCA -0.084; TCGA UCEC -0.129
hsa-let-7a-5p
WDR46
10 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.101; TCGA CESC -0.179; TCGA HNSC -0.143; TCGA KIRP -0.087; TCGA LIHC -0.199; TCGA LUAD -0.148; TCGA LUSC -0.26; TCGA OV -0.11; TCGA THCA -0.078; TCGA UCEC -0.1
hsa-let-7a-5p
WIPI2
12 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC
miRNAWalker2 validate; TargetScan
TCGA BRCA -0.1; TCGA CESC -0.134; TCGA COAD -0.142; TCGA HNSC -0.093; TCGA KIRC -0.088; TCGA KIRP -0.12; TCGA LIHC -0.125; TCGA LUAD -0.106; TCGA LUSC -0.134; TCGA OV -0.117; TCGA THCA -0.058; TCGA UCEC -0.14
hsa-let-7a-5p
IGF2BP1
9 cancers: BRCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; OV; UCEC
miRTarBase; MirTarget; TargetScan; miRNATAP; RAID
TCGA BRCA -0.829; TCGA CESC -1.054; TCGA HNSC -0.642; TCGA KIRC -0.547; TCGA LIHC -1.349; TCGA LUAD -1.164; TCGA LUSC -1.627; TCGA OV -1.046; TCGA UCEC -1.675
hsa-let-7a-5p
CDC34
12 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC
miRTarBase; MirTarget; TargetScan; miRNATAP
TCGA BRCA -0.311; TCGA CESC -0.165; TCGA HNSC -0.306; TCGA KIRP -0.162; TCGA LGG -0.168; TCGA LIHC -0.23; TCGA LUAD -0.34; TCGA LUSC -0.377; TCGA OV -0.203; TCGA THCA -0.217; TCGA STAD -0.198; TCGA UCEC -0.138
hsa-let-7a-5p
SLC5A6
9 cancers: BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; OV; UCEC
MirTarget; TargetScan; miRNATAP
TCGA BRCA -0.375; TCGA CESC -0.197; TCGA COAD -0.242; TCGA KIRC -0.091; TCGA KIRP -0.105; TCGA LUAD -0.217; TCGA LUSC -0.473; TCGA OV -0.251; TCGA UCEC -0.168
hsa-let-7a-5p
ABCB9
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA
MirTarget; TargetScan
TCGA BRCA -0.224; TCGA CESC -0.193; TCGA HNSC -0.095; TCGA KIRC -0.206; TCGA KIRP -0.256; TCGA LIHC -0.199; TCGA LUAD -0.329; TCGA LUSC -0.404; TCGA OV -0.112; TCGA PAAD -0.203; TCGA THCA -0.13
hsa-let-7a-5p
IGF2BP2
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; UCEC
MirTarget; TargetScan; miRNATAP
TCGA BRCA -0.411; TCGA CESC -0.894; TCGA HNSC -0.394; TCGA KIRC -0.628; TCGA KIRP -0.46; TCGA LUAD -0.231; TCGA LUSC -0.736; TCGA OV -0.378; TCGA PRAD -0.777; TCGA UCEC -1.723
hsa-let-7a-5p
RPUSD3
10 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD
MirTarget
TCGA BRCA -0.229; TCGA HNSC -0.199; TCGA KIRP -0.177; TCGA LGG -0.056; TCGA LIHC -0.259; TCGA LUAD -0.09; TCGA LUSC -0.298; TCGA OV -0.087; TCGA THCA -0.167; TCGA STAD -0.206
hsa-let-7a-5p
ARID3A
9 cancers: BRCA; CESC; COAD; KIRC; LIHC; LUAD; LUSC; PAAD; UCEC
TargetScan
TCGA BRCA -0.19; TCGA CESC -0.467; TCGA COAD -0.532; TCGA KIRC -0.124; TCGA LIHC -0.634; TCGA LUAD -0.449; TCGA LUSC -0.264; TCGA PAAD -0.207; TCGA UCEC -0.487
hsa-let-7a-5p
B3GAT3
9 cancers: BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD
TargetScan
TCGA BRCA -0.164; TCGA HNSC -0.264; TCGA KIRP -0.151; TCGA LIHC -0.376; TCGA LUAD -0.284; TCGA LUSC -0.224; TCGA PAAD -0.163; TCGA THCA -0.077; TCGA STAD -0.274
hsa-let-7a-5p
CPSF4
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA
TargetScan
TCGA BRCA -0.161; TCGA HNSC -0.17; TCGA KIRC -0.109; TCGA KIRP -0.098; TCGA LGG -0.075; TCGA LIHC -0.266; TCGA LUAD -0.21; TCGA LUSC -0.322; TCGA OV -0.116; TCGA THCA -0.118
hsa-let-7a-5p
DOCK3
12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
TargetScan; miRNATAP
TCGA BRCA -0.398; TCGA CESC -0.425; TCGA HNSC -0.243; TCGA KIRC -0.643; TCGA KIRP -0.378; TCGA LIHC -0.453; TCGA LUAD -0.346; TCGA LUSC -0.456; TCGA PRAD -0.632; TCGA SARC -1.053; TCGA STAD -0.437; TCGA UCEC -0.58
hsa-let-7a-5p
EIF2B2
9 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; STAD; UCEC
TargetScan
TCGA BRCA -0.06; TCGA CESC -0.192; TCGA HNSC -0.154; TCGA LIHC -0.126; TCGA LUAD -0.061; TCGA LUSC -0.238; TCGA OV -0.111; TCGA STAD -0.155; TCGA UCEC -0.087
hsa-let-7a-5p
ERGIC2
11 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC
TargetScan
TCGA BRCA -0.221; TCGA CESC -0.13; TCGA HNSC -0.16; TCGA KIRP -0.097; TCGA LIHC -0.122; TCGA LUAD -0.077; TCGA LUSC -0.339; TCGA OV -0.09; TCGA SARC -0.094; TCGA THCA -0.094; TCGA UCEC -0.114
hsa-let-7a-5p
FASTK
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
TargetScan
TCGA BRCA -0.197; TCGA HNSC -0.285; TCGA KIRC -0.147; TCGA KIRP -0.179; TCGA LGG -0.143; TCGA LIHC -0.237; TCGA LUAD -0.342; TCGA LUSC -0.312; TCGA THCA -0.156; TCGA STAD -0.103
hsa-let-7a-5p
FBXL19
11 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; UCEC
TargetScan; miRNATAP
TCGA BRCA -0.147; TCGA COAD -0.225; TCGA HNSC -0.129; TCGA KIRP -0.19; TCGA LGG -0.13; TCGA LIHC -0.19; TCGA LUAD -0.424; TCGA LUSC -0.42; TCGA OV -0.137; TCGA THCA -0.052; TCGA UCEC -0.103
hsa-let-7a-5p
GEMIN7
9 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; THCA; UCEC
TargetScan
TCGA BRCA -0.154; TCGA CESC -0.192; TCGA HNSC -0.276; TCGA LIHC -0.302; TCGA LUAD -0.149; TCGA LUSC -0.411; TCGA OV -0.198; TCGA THCA -0.165; TCGA UCEC -0.129
hsa-let-7a-5p
GIPC1
10 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
TargetScan; miRNATAP
TCGA BRCA -0.25; TCGA CESC -0.176; TCGA HNSC -0.269; TCGA KIRP -0.129; TCGA LGG -0.097; TCGA LIHC -0.204; TCGA LUAD -0.121; TCGA LUSC -0.234; TCGA THCA -0.188; TCGA STAD -0.16
hsa-let-7a-5p
PQLC2
9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD
TargetScan
TCGA BRCA -0.077; TCGA HNSC -0.218; TCGA LGG -0.122; TCGA LIHC -0.282; TCGA LUAD -0.21; TCGA LUSC -0.193; TCGA OV -0.098; TCGA THCA -0.165; TCGA STAD -0.113
hsa-let-7a-5p
SLC12A9
9 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC
TargetScan
TCGA BRCA -0.11; TCGA CESC -0.186; TCGA COAD -0.22; TCGA HNSC -0.134; TCGA KIRC -0.133; TCGA LGG -0.075; TCGA LIHC -0.163; TCGA LUAD -0.226; TCGA LUSC -0.139
hsa-let-7a-5p
SMUG1
9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA
TargetScan
TCGA BRCA -0.097; TCGA HNSC -0.205; TCGA KIRC -0.087; TCGA KIRP -0.173; TCGA LIHC -0.212; TCGA LUAD -0.222; TCGA LUSC -0.367; TCGA OV -0.175; TCGA THCA -0.092
hsa-let-7a-5p
TARBP2
13 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC
TargetScan
TCGA BRCA -0.141; TCGA CESC -0.159; TCGA HNSC -0.202; TCGA KIRC -0.107; TCGA KIRP -0.229; TCGA LGG -0.105; TCGA LIHC -0.293; TCGA LUAD -0.197; TCGA LUSC -0.348; TCGA OV -0.232; TCGA PAAD -0.198; TCGA THCA -0.068; TCGA UCEC -0.115
hsa-let-7a-5p
TEAD3
10 cancers: BRCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
TargetScan; miRNATAP
TCGA BRCA -0.087; TCGA COAD -0.261; TCGA HNSC -0.096; TCGA LUAD -0.081; TCGA LUSC -0.205; TCGA OV -0.156; TCGA PRAD -0.303; TCGA SARC -0.525; TCGA STAD -0.307; TCGA UCEC -0.162
hsa-let-7a-5p
TIMM17B
12 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
TargetScan; miRNATAP
TCGA BRCA -0.288; TCGA HNSC -0.196; TCGA KIRP -0.154; TCGA LGG -0.1; TCGA LIHC -0.397; TCGA LUAD -0.305; TCGA LUSC -0.382; TCGA OV -0.194; TCGA SARC -0.105; TCGA THCA -0.108; TCGA STAD -0.321; TCGA UCEC -0.185
hsa-let-7a-5p
ZNRF1
11 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD
mirMAP
TCGA BRCA -0.301; TCGA COAD -0.211; TCGA HNSC -0.092; TCGA KIRP -0.194; TCGA LGG -0.101; TCGA LIHC -0.148; TCGA LUAD -0.103; TCGA LUSC -0.34; TCGA OV -0.119; TCGA PRAD -0.105; TCGA STAD -0.128
hsa-let-7a-5p
NLK
10 cancers: CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC
TargetScan; miRNATAP
TCGA CESC -0.118; TCGA HNSC -0.124; TCGA KIRP -0.089; TCGA LIHC -0.088; TCGA LUAD -0.104; TCGA LUSC -0.12; TCGA OV -0.086; TCGA PAAD -0.129; TCGA SARC -0.084; TCGA UCEC -0.078
hsa-let-7a-5p
RASL10B
10 cancers: CESC; COAD; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
TargetScan
TCGA CESC -0.386; TCGA COAD -0.72; TCGA LGG -0.095; TCGA LUAD -0.302; TCGA LUSC -0.456; TCGA OV -0.328; TCGA PRAD -0.552; TCGA SARC -0.382; TCGA STAD -0.557; TCGA UCEC -0.584
hsa-let-7a-5p
TBKBP1
9 cancers: COAD; KIRP; LGG; LIHC; LUAD; OV; THCA; STAD; UCEC
MirTarget; TargetScan; miRNATAP
TCGA COAD -0.398; TCGA KIRP -0.21; TCGA LGG -0.184; TCGA LIHC -0.278; TCGA LUAD -0.294; TCGA OV -0.315; TCGA THCA -0.078; TCGA STAD -0.31; TCGA UCEC -0.327
hsa-let-7a-5p
ATG4B
9 cancers: COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV
TargetScan
TCGA COAD -0.112; TCGA HNSC -0.184; TCGA KIRC -0.125; TCGA KIRP -0.119; TCGA LGG -0.138; TCGA LIHC -0.172; TCGA LUAD -0.272; TCGA LUSC -0.189; TCGA OV -0.089
hsa-let-7a-5p
SOX12
9 cancers: KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; UCEC
mirMAP
TCGA KIRC -0.184; TCGA KIRP -0.206; TCGA LGG -0.193; TCGA LIHC -0.312; TCGA LUAD -0.332; TCGA LUSC -0.599; TCGA OV -0.178; TCGA THCA -0.087; TCGA UCEC -0.149





Enriched cancer pathways of putative targets