microRNA information: hsa-let-7c-5p

SectionIDlink
Mature name: hsa-let-7c-5pmiRbase
Accession: MIMAT0000064miRbase
Precursor name: hsa-let-7c miRbase
Precursor accession: MI0000064miRbase
Symbol: MIRLET7CHGNC
RefSeq ID: NR_029480GenBank
Sequence: UGAGGUAGUAGGUUGUAUGGUU



Reported expression in cancers: hsa-let-7c-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-let-7c-5p

breast cancerdownregulation"To identify potential markers that can be used for ......"24866763Microarray
hsa-let-7c-5p

esophageal cancerupregulation"We measured the serum levels of miR-21 miR-145 miR ......"23838916qPCR
hsa-let-7c-5p

liver cancerdownregulation"Let 7c microRNA expression and clinical significan ......"22289550Reverse transcription PCR; qPCR
hsa-let-7c-5p

liver cancerdownregulation"Simultaneously 9 miRNAs were down-regulated in the ......"24273923
hsa-let-7c-5p

lung squamous cell cancerdownregulation"Decreased plasma let 7c and miR 152 as noninvasive ......"26309587Reverse transcription PCR
hsa-let-7c-5p

lymphomadownregulation"In particular down-regulation of hsa-let-7c was ob ......"18802929
hsa-let-7c-5p

pancreatic cancerupregulation"Metformin up-regulated the expression of miR-26a m ......"22245693
hsa-let-7c-5p

prostate cancerdownregulation"MicroRNA let 7c is downregulated in prostate cance ......"22479342qPCR; in situ hybridization
hsa-let-7c-5p

prostate cancerdownregulation"In this study we examined global miRNA expression ......"25075250in situ hybridization; Microarray



Reported cancer pathway affected by hsa-let-7c-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-let-7c-5p

endometrial cancercell cycle pathway"Integrated microRNA and mRNA transcriptome sequenc ......"25329664
hsa-let-7c-5p

liver cancerApoptosis pathway"The expression profiles of microRNAs in Huh7 hepat ......"20347499
hsa-let-7c-5p

liver cancercell cycle pathway; Apoptosis pathway"MicroRNA let 7c Inhibits Cell Proliferation and In ......"25909324Western blot; Luciferase
hsa-let-7c-5p

lung cancerApoptosis pathway"A sesquiterpene lactone antrocin from Antrodia cam ......"23880305Colony formation
hsa-let-7c-5p

retinoblastomacell cycle pathway"To investigate differential expression of microRNA ......"21941147



Reported cancer prognosis affected by hsa-let-7c-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-let-7c-5p

acute myeloid leukemiadifferentiation"miRNA let 7c promotes granulocytic differentiation ......"22964640
hsa-let-7c-5p

bladder cancerprogression; poor survival"Of the eight most important progression-related mi ......"25990459
hsa-let-7c-5p

bladder cancerpoor survival"We identified an eight-miRNA signature including t ......"25991007
hsa-let-7c-5p

colorectal cancermetastasis"We investigated the expression of metastasis-assoc ......"24653631
hsa-let-7c-5p

endometrial cancerstaging"Integrated microRNA and mRNA transcriptome sequenc ......"25329664
hsa-let-7c-5p

esophageal cancerprogression; worse prognosis; poor survival"We measured the serum levels of miR-21 miR-145 miR ......"23838916
hsa-let-7c-5p

liver cancerdifferentiation"Let 7c microRNA expression and clinical significan ......"22289550
hsa-let-7c-5p

liver cancerprogression"MicroRNA let 7c Inhibits Cell Proliferation and In ......"25909324Western blot; Luciferase
hsa-let-7c-5p

lung cancerstaging; metastasis"miRNAs were assessed by quantitative real-time PCR ......"19209007
hsa-let-7c-5p

lung squamous cell cancerstaging; metastasis; poor survival; motility"MicroRNA let 7c inhibits migration and invasion of ......"23981581
hsa-let-7c-5p

lung squamous cell cancerstaging; metastasis; differentiation"Decreased plasma let 7c and miR 152 as noninvasive ......"26309587
hsa-let-7c-5p

ovarian cancermalignant trasformation"Using customized TaqMan low density miRNA arrays w ......"27636713
hsa-let-7c-5p

pancreatic cancerstaging"The miRNAs expression profile of early stage was s ......"24785459
hsa-let-7c-5p

pancreatic cancerprogression"Up regulation of microRNA Let 7c by quercetin inhi ......"27521217Luciferase; Colony formation
hsa-let-7c-5p

prostate cancermetastasis"Change in expression of miR let7c miR 100 and miR ......"19372056
hsa-let-7c-5p

prostate cancerprogression; poor survival"We performed miRNA-microarray analysis in a high-r ......"23798998



Reported gene related to hsa-let-7c-5p

miRNAcancergenereportingPUBMED
hsa-let-7c-5p

prostate cancerAR"MicroRNA let 7c suppresses androgen receptor expre ......"22128178
hsa-let-7c-5p

thyroid cancerATM"In the present study we investigated the expressio ......"19370508
hsa-let-7c-5p

liver cancerBCL2L1"Over-expression of let-7c or let-7g led to a clear ......"20347499
hsa-let-7c-5p

liver cancerCDC25A"MicroRNA let 7c Inhibits Cell Proliferation and In ......"25909324
hsa-let-7c-5p

prostate cancerCFTR"Validation of the data using an independent high-r ......"23798998
hsa-let-7c-5p

breast cancerERBB2"We confirmed that miR125b directly targets HER2 an ......"25388283
hsa-let-7c-5p

lung squamous cell cancerITGB3"MicroRNA let 7c inhibits migration and invasion of ......"23981581
hsa-let-7c-5p

prostate cancerLIN28A"Furthermore let-7c expression is downregulated in ......"22479342
hsa-let-7c-5p

breast cancerLINC00478"We found 78 miRNAs differentially expressed betwee ......"25388283
hsa-let-7c-5p

lung squamous cell cancerMAP4K3"MicroRNA let 7c inhibits migration and invasion of ......"23981581
hsa-let-7c-5p

breast cancerMYB"Let-7c were among the identified downregulated epi ......"25122196
hsa-let-7c-5p

prostate cancerMYC"MicroRNA let 7c suppresses androgen receptor expre ......"22128178
hsa-let-7c-5p

pancreatic cancerNUMBL"Up regulation of microRNA Let 7c by quercetin inhi ......"27521217
hsa-let-7c-5p

acute myeloid leukemiaPBX2"Moreover we identified PBX2 a well-known homeodoma ......"22964640
hsa-let-7c-5p

gastric cancerPGC"There were significant negative correlations betwe ......"25549793
hsa-let-7c-5p

lung cancerSOAT1"Additionally antrocin increased microRNA let-7c ex ......"23880305



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-let-7c-5p
CCNB2
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.085; TCGA BRCA -0.664; TCGA COAD -0.185; TCGA ESCA -0.196; TCGA HNSC -0.203; TCGA KIRC -0.529; TCGA KIRP -0.372; TCGA LIHC -0.854; TCGA LUAD -0.617; TCGA LUSC -0.414; TCGA PRAD -0.178; TCGA THCA -0.396; TCGA STAD -0.359; TCGA UCEC -0.276
hsa-let-7c-5p
CCNF
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.12; TCGA BRCA -0.39; TCGA COAD -0.186; TCGA ESCA -0.107; TCGA HNSC -0.122; TCGA KIRC -0.267; TCGA KIRP -0.198; TCGA LGG -0.209; TCGA LIHC -0.504; TCGA LUAD -0.399; TCGA LUSC -0.193; TCGA PAAD -0.182; TCGA THCA -0.151; TCGA STAD -0.339; TCGA UCEC -0.176
hsa-let-7c-5p
CNOT3
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.055; TCGA BRCA -0.127; TCGA COAD -0.075; TCGA KIRC -0.07; TCGA LIHC -0.137; TCGA LUAD -0.154; TCGA LUSC -0.073; TCGA PAAD -0.208; TCGA PRAD -0.088; TCGA STAD -0.078
hsa-let-7c-5p
DOT1L
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.102; TCGA BRCA -0.106; TCGA COAD -0.133; TCGA ESCA -0.092; TCGA KIRC -0.109; TCGA LGG -0.203; TCGA LIHC -0.15; TCGA LUAD -0.118; TCGA PAAD -0.204; TCGA PRAD -0.173; TCGA STAD -0.182; TCGA UCEC -0.091
hsa-let-7c-5p
EWSR1
10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.072; TCGA BRCA -0.09; TCGA COAD -0.094; TCGA HNSC -0.08; TCGA LIHC -0.076; TCGA LUAD -0.081; TCGA LUSC -0.055; TCGA PAAD -0.1; TCGA PRAD -0.071; TCGA STAD -0.116
hsa-let-7c-5p
FAM103A1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.097; TCGA BRCA -0.161; TCGA COAD -0.083; TCGA ESCA -0.058; TCGA HNSC -0.087; TCGA KIRC -0.058; TCGA KIRP -0.053; TCGA LIHC -0.146; TCGA LUAD -0.098; TCGA PRAD -0.075; TCGA SARC -0.051; TCGA STAD -0.086
hsa-let-7c-5p
FANCI
18 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.099; TCGA BRCA -0.411; TCGA COAD -0.169; TCGA ESCA -0.154; TCGA HNSC -0.131; TCGA KIRC -0.238; TCGA KIRP -0.141; TCGA LGG -0.232; TCGA LIHC -0.553; TCGA LUAD -0.401; TCGA LUSC -0.273; TCGA OV -0.09; TCGA PAAD -0.163; TCGA PRAD -0.089; TCGA SARC -0.13; TCGA THCA -0.431; TCGA STAD -0.269; TCGA UCEC -0.154
hsa-let-7c-5p
GPS1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.084; TCGA BRCA -0.209; TCGA CESC -0.072; TCGA COAD -0.116; TCGA ESCA -0.088; TCGA HNSC -0.085; TCGA LGG -0.062; TCGA LIHC -0.069; TCGA LUAD -0.106; TCGA LUSC -0.07; TCGA OV -0.056; TCGA PAAD -0.268; TCGA THCA -0.056; TCGA STAD -0.074; TCGA UCEC -0.058
hsa-let-7c-5p
GSK3A
9 cancers: BLCA; BRCA; COAD; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.059; TCGA BRCA -0.154; TCGA COAD -0.076; TCGA LIHC -0.102; TCGA LUAD -0.116; TCGA LUSC -0.071; TCGA PAAD -0.113; TCGA THCA -0.057; TCGA STAD -0.073
hsa-let-7c-5p
IVNS1ABP
9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.076; TCGA CESC -0.054; TCGA COAD -0.059; TCGA HNSC -0.154; TCGA KIRP -0.089; TCGA LUAD -0.082; TCGA LUSC -0.057; TCGA STAD -0.189; TCGA UCEC -0.158
hsa-let-7c-5p
MESDC1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; OV; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.069; TCGA BRCA -0.15; TCGA CESC -0.081; TCGA COAD -0.114; TCGA ESCA -0.178; TCGA OV -0.078; TCGA PRAD -0.081; TCGA THCA -0.056; TCGA STAD -0.114
hsa-let-7c-5p
PAK4
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.085; TCGA BRCA -0.216; TCGA CESC -0.055; TCGA COAD -0.106; TCGA ESCA -0.062; TCGA LIHC -0.146; TCGA LUAD -0.115; TCGA LUSC -0.116; TCGA PAAD -0.25; TCGA STAD -0.125
hsa-let-7c-5p
PCGF3
10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; PAAD; PRAD; STAD
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.186; TCGA BRCA -0.051; TCGA COAD -0.076; TCGA KIRC -0.189; TCGA LGG -0.122; TCGA LIHC -0.114; TCGA LUAD -0.169; TCGA PAAD -0.188; TCGA PRAD -0.092; TCGA STAD -0.06
hsa-let-7c-5p
PTGES2
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.086; TCGA BRCA -0.186; TCGA CESC -0.082; TCGA COAD -0.181; TCGA ESCA -0.23; TCGA HNSC -0.096; TCGA KIRP -0.059; TCGA LGG -0.14; TCGA LIHC -0.15; TCGA LUAD -0.2; TCGA LUSC -0.223; TCGA OV -0.078; TCGA PAAD -0.254; TCGA PRAD -0.074; TCGA THCA -0.122; TCGA STAD -0.22; TCGA UCEC -0.122
hsa-let-7c-5p
PTK2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.113; TCGA BRCA -0.146; TCGA CESC -0.057; TCGA ESCA -0.091; TCGA HNSC -0.08; TCGA KIRP -0.08; TCGA LIHC -0.112; TCGA LUAD -0.054; TCGA PRAD -0.114; TCGA SARC -0.076; TCGA STAD -0.09
hsa-let-7c-5p
RAPGEFL1
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD
miRNAWalker2 validate
TCGA BLCA -0.323; TCGA BRCA -0.233; TCGA COAD -0.144; TCGA KIRC -0.426; TCGA KIRP -0.315; TCGA LGG -0.256; TCGA LIHC -0.105; TCGA LUAD -0.234; TCGA LUSC -0.307; TCGA STAD -0.249
hsa-let-7c-5p
RPL18A
10 cancers: BLCA; CESC; COAD; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; THCA
miRNAWalker2 validate
TCGA BLCA -0.066; TCGA CESC -0.093; TCGA COAD -0.078; TCGA KIRP -0.164; TCGA LGG -0.164; TCGA LIHC -0.184; TCGA LUSC -0.105; TCGA PAAD -0.164; TCGA PRAD -0.182; TCGA THCA -0.164
hsa-let-7c-5p
RPS24
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA
miRNAWalker2 validate
TCGA BLCA -0.065; TCGA CESC -0.067; TCGA HNSC -0.083; TCGA KIRC -0.14; TCGA KIRP -0.178; TCGA LGG -0.147; TCGA LIHC -0.197; TCGA LUAD -0.08; TCGA LUSC -0.087; TCGA THCA -0.071
hsa-let-7c-5p
SF3B4
12 cancers: BLCA; BRCA; COAD; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.066; TCGA BRCA -0.181; TCGA COAD -0.078; TCGA KIRP -0.053; TCGA LGG -0.096; TCGA LIHC -0.219; TCGA LUAD -0.17; TCGA LUSC -0.134; TCGA PAAD -0.117; TCGA PRAD -0.085; TCGA STAD -0.067; TCGA UCEC -0.083
hsa-let-7c-5p
SLC25A1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.133; TCGA BRCA -0.066; TCGA CESC -0.064; TCGA COAD -0.168; TCGA HNSC -0.09; TCGA LGG -0.092; TCGA LUAD -0.114; TCGA LUSC -0.155; TCGA PAAD -0.196; TCGA SARC -0.068; TCGA STAD -0.157; TCGA UCEC -0.134
hsa-let-7c-5p
SMARCD1
9 cancers: BLCA; COAD; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.056; TCGA COAD -0.063; TCGA HNSC -0.073; TCGA LGG -0.148; TCGA LIHC -0.178; TCGA LUAD -0.088; TCGA PAAD -0.142; TCGA PRAD -0.152; TCGA STAD -0.08
hsa-let-7c-5p
TAZ
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.087; TCGA BRCA -0.098; TCGA COAD -0.079; TCGA ESCA -0.085; TCGA HNSC -0.131; TCGA KIRC -0.16; TCGA LGG -0.117; TCGA LIHC -0.161; TCGA LUAD -0.147; TCGA LUSC -0.122; TCGA PAAD -0.204; TCGA PRAD -0.144; TCGA THCA -0.12; TCGA STAD -0.052; TCGA UCEC -0.107
hsa-let-7c-5p
TMEM165
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.127; TCGA BRCA -0.147; TCGA CESC -0.079; TCGA COAD -0.071; TCGA HNSC -0.07; TCGA KIRC -0.115; TCGA KIRP -0.064; TCGA LIHC -0.145; TCGA LUAD -0.086; TCGA SARC -0.062; TCGA THCA -0.113; TCGA STAD -0.161; TCGA UCEC -0.133
hsa-let-7c-5p
TMEM184B
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.069; TCGA BRCA -0.094; TCGA CESC -0.077; TCGA ESCA -0.093; TCGA HNSC -0.094; TCGA LGG -0.065; TCGA LIHC -0.171; TCGA PAAD -0.137; TCGA THCA -0.112; TCGA STAD -0.061; TCGA UCEC -0.127
hsa-let-7c-5p
TUT1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.072; TCGA BRCA -0.088; TCGA COAD -0.067; TCGA ESCA -0.074; TCGA HNSC -0.052; TCGA LGG -0.141; TCGA LUAD -0.093; TCGA LUSC -0.054; TCGA PAAD -0.117; TCGA PRAD -0.102; TCGA STAD -0.071
hsa-let-7c-5p
ZNF581
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
miRNAWalker2 validate
TCGA BLCA -0.09; TCGA BRCA -0.125; TCGA CESC -0.121; TCGA COAD -0.063; TCGA HNSC -0.102; TCGA KIRC -0.117; TCGA KIRP -0.164; TCGA LIHC -0.316; TCGA LUAD -0.09; TCGA LUSC -0.085; TCGA PAAD -0.221; TCGA PRAD -0.126; TCGA THCA -0.287
hsa-let-7c-5p
ANKRD49
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC
MirTarget
TCGA BLCA -0.107; TCGA CESC -0.085; TCGA COAD -0.071; TCGA ESCA -0.071; TCGA HNSC -0.088; TCGA KIRC -0.091; TCGA LIHC -0.101; TCGA LUAD -0.085; TCGA LUSC -0.074; TCGA PRAD -0.076; TCGA SARC -0.056
hsa-let-7c-5p
AP1S1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.142; TCGA BRCA -0.239; TCGA COAD -0.144; TCGA ESCA -0.122; TCGA HNSC -0.157; TCGA KIRP -0.129; TCGA LGG -0.198; TCGA LIHC -0.068; TCGA LUAD -0.123; TCGA LUSC -0.177; TCGA PAAD -0.197; TCGA THCA -0.267; TCGA STAD -0.225; TCGA UCEC -0.125
hsa-let-7c-5p
DCAF15
11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.101; TCGA BRCA -0.076; TCGA COAD -0.105; TCGA HNSC -0.082; TCGA LGG -0.073; TCGA LIHC -0.101; TCGA LUAD -0.098; TCGA LUSC -0.106; TCGA PAAD -0.183; TCGA PRAD -0.128; TCGA STAD -0.081
hsa-let-7c-5p
PARD6B
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.125; TCGA BRCA -0.418; TCGA CESC -0.117; TCGA COAD -0.164; TCGA ESCA -0.263; TCGA LIHC -0.142; TCGA PRAD -0.089; TCGA SARC -0.3; TCGA STAD -0.202
hsa-let-7c-5p
ESPL1
13 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.128; TCGA BRCA -0.608; TCGA COAD -0.161; TCGA KIRC -0.24; TCGA KIRP -0.212; TCGA LGG -0.328; TCGA LIHC -0.454; TCGA LUAD -0.767; TCGA LUSC -0.359; TCGA PRAD -0.31; TCGA THCA -0.523; TCGA STAD -0.341; TCGA UCEC -0.308
hsa-let-7c-5p
CDC34
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.117; TCGA BRCA -0.147; TCGA COAD -0.126; TCGA ESCA -0.099; TCGA HNSC -0.105; TCGA KIRP -0.081; TCGA LUAD -0.22; TCGA LUSC -0.093; TCGA PAAD -0.323; TCGA THCA -0.176; TCGA STAD -0.081; TCGA UCEC -0.072
hsa-let-7c-5p
BZW2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.069; TCGA BRCA -0.129; TCGA CESC -0.122; TCGA COAD -0.111; TCGA ESCA -0.213; TCGA KIRC -0.144; TCGA KIRP -0.072; TCGA LGG -0.301; TCGA LIHC -0.203; TCGA LUAD -0.171; TCGA LUSC -0.159; TCGA PRAD -0.321; TCGA THCA -0.063; TCGA STAD -0.242
hsa-let-7c-5p
TTLL4
10 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.053; TCGA COAD -0.079; TCGA ESCA -0.115; TCGA KIRC -0.126; TCGA KIRP -0.094; TCGA LIHC -0.45; TCGA LUAD -0.156; TCGA PRAD -0.107; TCGA STAD -0.187; TCGA UCEC -0.113
hsa-let-7c-5p
MDFI
9 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA
MirTarget
TCGA BLCA -0.153; TCGA CESC -0.154; TCGA HNSC -0.334; TCGA KIRP -0.384; TCGA LIHC -0.45; TCGA LUAD -0.271; TCGA LUSC -0.16; TCGA PRAD -0.537; TCGA THCA -0.259
hsa-let-7c-5p
CDC25A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.106; TCGA BRCA -0.484; TCGA CESC -0.123; TCGA COAD -0.222; TCGA ESCA -0.206; TCGA HNSC -0.084; TCGA LGG -0.215; TCGA LIHC -0.515; TCGA LUAD -0.547; TCGA LUSC -0.315; TCGA PAAD -0.351; TCGA SARC -0.082; TCGA THCA -0.109; TCGA STAD -0.433; TCGA UCEC -0.19
hsa-let-7c-5p
ABCB9
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA
MirTarget
TCGA BLCA -0.07; TCGA BRCA -0.251; TCGA COAD -0.116; TCGA HNSC -0.063; TCGA KIRC -0.214; TCGA KIRP -0.116; TCGA LGG -0.101; TCGA LIHC -0.274; TCGA LUAD -0.193; TCGA LUSC -0.133; TCGA PAAD -0.237; TCGA THCA -0.078
hsa-let-7c-5p
MARS2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.11; TCGA BRCA -0.11; TCGA CESC -0.085; TCGA COAD -0.137; TCGA ESCA -0.151; TCGA KIRP -0.116; TCGA LUAD -0.139; TCGA LUSC -0.152; TCGA PRAD -0.1; TCGA SARC -0.073; TCGA STAD -0.238; TCGA UCEC -0.063
hsa-let-7c-5p
RAB11FIP4
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.205; TCGA BRCA -0.268; TCGA COAD -0.114; TCGA ESCA -0.218; TCGA LIHC -0.367; TCGA PRAD -0.258; TCGA THCA -0.065; TCGA STAD -0.223; TCGA UCEC -0.136
hsa-let-7c-5p
ZC3H3
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.085; TCGA BRCA -0.201; TCGA CESC -0.051; TCGA COAD -0.104; TCGA HNSC -0.087; TCGA KIRC -0.12; TCGA LGG -0.1; TCGA LIHC -0.199; TCGA LUAD -0.176; TCGA LUSC -0.097; TCGA PAAD -0.192; TCGA PRAD -0.078; TCGA STAD -0.123; TCGA UCEC -0.1
hsa-let-7c-5p
RPUSD3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.078; TCGA BRCA -0.143; TCGA CESC -0.051; TCGA COAD -0.12; TCGA ESCA -0.106; TCGA HNSC -0.054; TCGA LGG -0.111; TCGA LUAD -0.081; TCGA LUSC -0.145; TCGA PAAD -0.159; TCGA SARC -0.058; TCGA THCA -0.107; TCGA STAD -0.096; TCGA UCEC -0.079
hsa-let-7c-5p
RPUSD2
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.093; TCGA BRCA -0.093; TCGA CESC -0.064; TCGA COAD -0.115; TCGA HNSC -0.054; TCGA LGG -0.099; TCGA LUSC -0.11; TCGA PAAD -0.09; TCGA PRAD -0.09; TCGA STAD -0.094
hsa-let-7c-5p
ELF4
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA; STAD
MirTarget
TCGA BLCA -0.134; TCGA BRCA -0.073; TCGA ESCA -0.111; TCGA HNSC -0.096; TCGA KIRC -0.147; TCGA KIRP -0.202; TCGA LIHC -0.136; TCGA LUSC -0.112; TCGA THCA -0.426; TCGA STAD -0.116
hsa-let-7c-5p
ABCC10
9 cancers: BLCA; BRCA; COAD; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.121; TCGA BRCA -0.059; TCGA COAD -0.053; TCGA LIHC -0.302; TCGA LUAD -0.141; TCGA LUSC -0.108; TCGA PAAD -0.097; TCGA PRAD -0.147; TCGA STAD -0.069
hsa-let-7c-5p
STX3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.131; TCGA BRCA -0.178; TCGA CESC -0.128; TCGA COAD -0.147; TCGA ESCA -0.286; TCGA HNSC -0.141; TCGA LIHC -0.201; TCGA PRAD -0.163; TCGA SARC -0.163; TCGA THCA -0.167; TCGA STAD -0.185; TCGA UCEC -0.202
hsa-let-7c-5p
GRPEL2
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.079; TCGA BRCA -0.144; TCGA COAD -0.118; TCGA HNSC -0.053; TCGA KIRC -0.078; TCGA KIRP -0.101; TCGA LGG -0.218; TCGA LIHC -0.167; TCGA LUSC -0.143; TCGA PAAD -0.065; TCGA PRAD -0.061; TCGA SARC -0.091; TCGA STAD -0.091
hsa-let-7c-5p
PRSS22
9 cancers: BLCA; BRCA; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.263; TCGA BRCA -0.241; TCGA LUAD -0.15; TCGA LUSC -0.336; TCGA OV -0.225; TCGA PRAD -0.159; TCGA THCA -0.209; TCGA STAD -0.232; TCGA UCEC -0.46
hsa-let-7c-5p
HMGA1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.114; TCGA BRCA -0.3; TCGA CESC -0.136; TCGA COAD -0.212; TCGA ESCA -0.155; TCGA HNSC -0.151; TCGA KIRP -0.13; TCGA LIHC -0.518; TCGA LUAD -0.434; TCGA LUSC -0.338; TCGA PAAD -0.243; TCGA SARC -0.153; TCGA THCA -0.169; TCGA STAD -0.278; TCGA UCEC -0.284
hsa-let-7c-5p
SLC20A1
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.229; TCGA BRCA -0.151; TCGA CESC -0.15; TCGA ESCA -0.161; TCGA HNSC -0.219; TCGA KIRC -0.209; TCGA KIRP -0.289; TCGA LUAD -0.22; TCGA LUSC -0.135; TCGA OV -0.087; TCGA PRAD -0.086; TCGA SARC -0.172; TCGA THCA -0.464; TCGA STAD -0.102; TCGA UCEC -0.107
hsa-let-7c-5p
NME6
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.08; TCGA BRCA -0.112; TCGA CESC -0.072; TCGA COAD -0.094; TCGA ESCA -0.123; TCGA KIRP -0.085; TCGA LIHC -0.215; TCGA LUAD -0.09; TCGA PAAD -0.103; TCGA THCA -0.148; TCGA STAD -0.104; TCGA UCEC -0.068
hsa-let-7c-5p
CLDN12
9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.085; TCGA CESC -0.059; TCGA COAD -0.155; TCGA ESCA -0.264; TCGA LUAD -0.181; TCGA LUSC -0.059; TCGA PAAD -0.15; TCGA THCA -0.16; TCGA STAD -0.209
hsa-let-7c-5p
FAM104A
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD
MirTarget
TCGA BLCA -0.062; TCGA BRCA -0.149; TCGA COAD -0.093; TCGA HNSC -0.067; TCGA KIRC -0.076; TCGA KIRP -0.084; TCGA LGG -0.076; TCGA LIHC -0.102; TCGA LUAD -0.133; TCGA LUSC -0.084; TCGA OV -0.081; TCGA PAAD -0.131; TCGA STAD -0.058
hsa-let-7c-5p
PTBP1
10 cancers: BLCA; BRCA; COAD; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
RAID
TCGA BLCA -0.093; TCGA BRCA -0.151; TCGA COAD -0.101; TCGA LIHC -0.086; TCGA LUAD -0.116; TCGA LUSC -0.065; TCGA PAAD -0.153; TCGA PRAD -0.098; TCGA STAD -0.143; TCGA UCEC -0.05
hsa-let-7c-5p
CSNK2A1
9 cancers: BRCA; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD
miRNAWalker2 validate
TCGA BRCA -0.113; TCGA ESCA -0.099; TCGA KIRP -0.061; TCGA LGG -0.076; TCGA LIHC -0.118; TCGA LUAD -0.088; TCGA LUSC -0.099; TCGA PRAD -0.11; TCGA STAD -0.111
hsa-let-7c-5p
GARS
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.145; TCGA CESC -0.083; TCGA COAD -0.107; TCGA ESCA -0.148; TCGA HNSC -0.137; TCGA KIRC -0.115; TCGA KIRP -0.11; TCGA LIHC -0.162; TCGA LUAD -0.224; TCGA LUSC -0.199; TCGA PAAD -0.175; TCGA THCA -0.319; TCGA STAD -0.185; TCGA UCEC -0.116
hsa-let-7c-5p
GORASP2
11 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD
miRNAWalker2 validate
TCGA BRCA -0.099; TCGA CESC -0.06; TCGA COAD -0.058; TCGA ESCA -0.058; TCGA KIRC -0.066; TCGA KIRP -0.079; TCGA LIHC -0.079; TCGA LUAD -0.123; TCGA LUSC -0.091; TCGA PAAD -0.055; TCGA STAD -0.114
hsa-let-7c-5p
LDHA
13 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.158; TCGA CESC -0.17; TCGA COAD -0.161; TCGA HNSC -0.243; TCGA KIRC -0.14; TCGA KIRP -0.141; TCGA LUAD -0.242; TCGA LUSC -0.203; TCGA PRAD -0.208; TCGA SARC -0.138; TCGA THCA -0.289; TCGA STAD -0.163; TCGA UCEC -0.221
hsa-let-7c-5p
PSMB2
10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LUAD; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.117; TCGA COAD -0.1; TCGA HNSC -0.151; TCGA KIRC -0.094; TCGA KIRP -0.064; TCGA LUAD -0.077; TCGA PAAD -0.098; TCGA THCA -0.142; TCGA STAD -0.147; TCGA UCEC -0.096
hsa-let-7c-5p
ZNF526
9 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA
miRNAWalker2 validate
TCGA BRCA -0.06; TCGA CESC -0.074; TCGA HNSC -0.056; TCGA KIRP -0.055; TCGA LIHC -0.148; TCGA LUAD -0.082; TCGA LUSC -0.051; TCGA PAAD -0.095; TCGA THCA -0.057
hsa-let-7c-5p
ENTPD7
11 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.126; TCGA CESC -0.186; TCGA ESCA -0.088; TCGA HNSC -0.151; TCGA LUAD -0.2; TCGA LUSC -0.148; TCGA OV -0.095; TCGA PRAD -0.146; TCGA THCA -0.096; TCGA STAD -0.093; TCGA UCEC -0.145
hsa-let-7c-5p
SEMA4F
9 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; THCA
MirTarget
TCGA BRCA -0.059; TCGA CESC -0.078; TCGA HNSC -0.195; TCGA KIRP -0.122; TCGA LGG -0.199; TCGA LIHC -0.273; TCGA LUSC -0.112; TCGA PAAD -0.123; TCGA THCA -0.079
hsa-let-7c-5p
IGF2BP1
9 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; SARC; UCEC
MirTarget; RAID
TCGA BRCA -0.305; TCGA CESC -0.577; TCGA HNSC -0.464; TCGA LIHC -1.643; TCGA LUAD -0.933; TCGA LUSC -0.421; TCGA OV -0.298; TCGA SARC -0.606; TCGA UCEC -0.325
hsa-let-7c-5p
TSEN34
11 cancers: BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD
MirTarget
TCGA BRCA -0.192; TCGA COAD -0.076; TCGA HNSC -0.064; TCGA KIRP -0.071; TCGA LIHC -0.085; TCGA LUAD -0.135; TCGA LUSC -0.084; TCGA OV -0.06; TCGA PAAD -0.228; TCGA THCA -0.06; TCGA STAD -0.065
hsa-let-7c-5p
SUB1
9 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.116; TCGA COAD -0.067; TCGA HNSC -0.139; TCGA KIRP -0.064; TCGA LGG -0.154; TCGA LIHC -0.152; TCGA PRAD -0.103; TCGA THCA -0.057; TCGA STAD -0.066
hsa-let-7c-5p
AEN
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.092; TCGA CESC -0.107; TCGA COAD -0.164; TCGA ESCA -0.193; TCGA HNSC -0.105; TCGA LGG -0.312; TCGA LUAD -0.121; TCGA LUSC -0.053; TCGA PAAD -0.098; TCGA THCA -0.197; TCGA STAD -0.178; TCGA UCEC -0.071
hsa-let-7c-5p
SLC17A9
13 cancers: BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.346; TCGA CESC -0.165; TCGA ESCA -0.584; TCGA KIRC -0.55; TCGA LIHC -0.199; TCGA LUAD -0.397; TCGA LUSC -0.114; TCGA OV -0.141; TCGA PAAD -0.236; TCGA SARC -0.277; TCGA THCA -0.299; TCGA STAD -0.202; TCGA UCEC -0.25
hsa-let-7c-5p
CASP3
10 cancers: BRCA; COAD; ESCA; KIRC; LUAD; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.132; TCGA COAD -0.09; TCGA ESCA -0.095; TCGA KIRC -0.15; TCGA LUAD -0.075; TCGA OV -0.103; TCGA PRAD -0.085; TCGA THCA -0.098; TCGA STAD -0.197; TCGA UCEC -0.113
hsa-let-7c-5p
SLC25A32
10 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; STAD
MirTarget
TCGA BRCA -0.084; TCGA CESC -0.079; TCGA ESCA -0.106; TCGA HNSC -0.125; TCGA KIRP -0.078; TCGA LGG -0.08; TCGA LUAD -0.097; TCGA LUSC -0.062; TCGA OV -0.073; TCGA STAD -0.117
hsa-let-7c-5p
DLGAP4
9 cancers: BRCA; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; PAAD; THCA
MirTarget
TCGA BRCA -0.069; TCGA ESCA -0.063; TCGA HNSC -0.117; TCGA KIRC -0.163; TCGA LGG -0.153; TCGA LIHC -0.178; TCGA LUAD -0.101; TCGA PAAD -0.225; TCGA THCA -0.164
hsa-let-7c-5p
RAD18
12 cancers: BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.09; TCGA CESC -0.081; TCGA COAD -0.132; TCGA ESCA -0.152; TCGA KIRP -0.133; TCGA LIHC -0.162; TCGA LUAD -0.15; TCGA LUSC -0.1; TCGA SARC -0.129; TCGA THCA -0.08; TCGA STAD -0.189; TCGA UCEC -0.051
hsa-let-7c-5p
E2F2
11 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.502; TCGA COAD -0.267; TCGA KIRC -0.372; TCGA KIRP -0.213; TCGA LIHC -0.606; TCGA LUAD -0.455; TCGA LUSC -0.184; TCGA PRAD -0.232; TCGA THCA -0.404; TCGA STAD -0.417; TCGA UCEC -0.353
hsa-let-7c-5p
EIF4A3
11 cancers: BRCA; CESC; COAD; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD
RAID
TCGA BRCA -0.192; TCGA CESC -0.061; TCGA COAD -0.119; TCGA KIRP -0.061; TCGA LIHC -0.09; TCGA LUAD -0.17; TCGA LUSC -0.156; TCGA OV -0.067; TCGA PAAD -0.083; TCGA PRAD -0.055; TCGA STAD -0.151
hsa-let-7c-5p
RPS13
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA CESC -0.066; TCGA COAD -0.093; TCGA HNSC -0.071; TCGA KIRC -0.108; TCGA KIRP -0.147; TCGA LGG -0.158; TCGA LIHC -0.102; TCGA PRAD -0.123; TCGA THCA -0.079; TCGA STAD -0.076
hsa-let-7c-5p
CERCAM
9 cancers: CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; UCEC
MirTarget
TCGA CESC -0.134; TCGA HNSC -0.257; TCGA KIRP -0.289; TCGA LGG -0.128; TCGA LIHC -0.138; TCGA LUAD -0.167; TCGA LUSC -0.165; TCGA OV -0.142; TCGA UCEC -0.114
hsa-let-7c-5p
SLC5A6
12 cancers: CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.062; TCGA ESCA -0.139; TCGA KIRC -0.088; TCGA KIRP -0.118; TCGA LGG -0.085; TCGA LUAD -0.223; TCGA LUSC -0.183; TCGA PAAD -0.1; TCGA PRAD -0.181; TCGA THCA -0.075; TCGA STAD -0.186; TCGA UCEC -0.144
hsa-let-7c-5p
IGF2BP2
9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; STAD
MirTarget
TCGA CESC -0.404; TCGA COAD -0.118; TCGA ESCA -0.341; TCGA HNSC -0.528; TCGA KIRC -0.408; TCGA LIHC -0.67; TCGA LUAD -0.213; TCGA LUSC -0.375; TCGA STAD -0.256
hsa-let-7c-5p
MXD1
9 cancers: COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA COAD -0.133; TCGA HNSC -0.078; TCGA KIRC -0.152; TCGA KIRP -0.114; TCGA LGG -0.09; TCGA LUAD -0.147; TCGA LUSC -0.159; TCGA STAD -0.141; TCGA UCEC -0.124





Enriched cancer pathways of putative targets