microRNA information: hsa-let-7f-2-3p

SectionIDlink
Mature name: hsa-let-7f-2-3pmiRbase
Accession: MIMAT0004487miRbase
Precursor name: hsa-let-7f-2 miRbase
Precursor accession: MI0000068miRbase
Symbol: MIRLET7F2HGNC
RefSeq ID: NR_029484GenBank
Sequence: CUAUACAGUCUACUGUCUUUCC



Reported expression in cancers: hsa-let-7f-2-3p

miRNAcancerregulationreportingPUBMEDmethod



Reported cancer pathway affected by hsa-let-7f-2-3p

miRNAcancerpathwayreportingPUBMEDfunctional study



Reported cancer prognosis affected by hsa-let-7f-2-3p

miRNAcancerprognosisreportingPUBMEDfunctional study



Reported gene related to hsa-let-7f-2-3p

miRNAcancergenereportingPUBMED



Expression profile in cancer corhorts: