microRNA information: hsa-let-7g-3p

SectionIDlink
Mature name: hsa-let-7g-3pmiRbase
Accession: MIMAT0004584miRbase
Precursor name: hsa-let-7g miRbase
Precursor accession: MI0000433miRbase
Symbol: MIRLET7GHGNC
RefSeq ID: NR_029660GenBank
Sequence: CUGUACAGGCCACUGCCUUGC



Reported expression in cancers: hsa-let-7g-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-let-7g-3p

breast cancerderegulation"We established primary cultures of CAFs and paired ......"22964023Microarray
hsa-let-7g-3p

breast cancerderegulation"The different expressions of miRNAs in CAFs versus ......"25270211Microarray
hsa-let-7g-3p

gastric cancerupregulation"miRNA expression was determined using a custom-des ......"22112324Microarray
hsa-let-7g-3p

head and neck cancerdownregulation"Conversely decreased expressions of miR-153 miR-20 ......"25677760
hsa-let-7g-3p

liver cancerdownregulation"Reexpression of Let 7g microRNA inhibits the proli ......"24724096qPCR; in situ hybridization
hsa-let-7g-3p

lung cancerdownregulation"The expression of 319 miRNAs was evaluated by Exiq ......"20818338Microarray
hsa-let-7g-3p

lymphomaderegulation"We found miR-34a miR-146a and miR-193b to be up-re ......"25862860
hsa-let-7g-3p

prostate cancerdownregulation"We investigated the expression profiles of 6 micro ......"20873592Microarray; in situ hybridization



Reported cancer pathway affected by hsa-let-7g-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-let-7g-3p

esophageal cancerApoptosis pathway"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271Western blot; Luciferase
hsa-let-7g-3p

gastric cancerApoptosis pathway"In order to identify miRNA signatures for gastric ......"22112324
hsa-let-7g-3p

liver cancerEpithelial mesenchymal transition pathway"Reexpression of Let 7g microRNA inhibits the proli ......"24724096Transwell assay; Western blot
hsa-let-7g-3p

lung cancercell cycle pathway"Ectopic expression of let-7g in K-RasG12D-expressi ......"18308936



Reported cancer prognosis affected by hsa-let-7g-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-let-7g-3p

B cell lymphomapoor survival"Finally eight miRNAs were found to correlate with ......"18537969
hsa-let-7g-3p

breast cancermetastasis"Here we report that the expression levels of three ......"23339187
hsa-let-7g-3p

colon cancerdrug resistance; tumorigenesis; poor survival"Non coding MicroRNAs hsa let 7g and hsa miR 181b a ......"18172508
hsa-let-7g-3p

esophageal cancerdrug resistance"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271Western blot; Luciferase
hsa-let-7g-3p

gastric cancerstaging; metastasis; poor survival"353 gastric samples from two independent subsets o ......"20022810
hsa-let-7g-3p

gastric cancerdrug resistance"In order to identify miRNA signatures for gastric ......"22112324
hsa-let-7g-3p

head and neck cancerworse prognosis"Conversely decreased expressions of miR-153 miR-20 ......"25677760
hsa-let-7g-3p

liver cancermetastasis"Identification of metastasis related microRNAs of ......"19912688
hsa-let-7g-3p

liver cancerworse prognosis; poor survival; staging"Reexpression of Let 7g microRNA inhibits the proli ......"24724096Transwell assay; Western blot
hsa-let-7g-3p

lung cancercell migration; worse prognosis; metastasis"Suppression of A549 lung cancer cell migration by ......"21472347
hsa-let-7g-3p

lung squamous cell cancerprogression; worse prognosis; poor survival"Let 7g and miR 21 expression in non small cell lun ......"23820752
hsa-let-7g-3p

pancreatic cancerstaging; differentiation"Expressions of miRNAs were determined with the Taq ......"22851141



Reported gene related to hsa-let-7g-3p

miRNAcancergenereportingPUBMED
hsa-let-7g-3p

liver cancerHRAS"We found using Western-blotting that let-7g can re ......"24724096
hsa-let-7g-3p

lung cancerHRAS"Furthermore K-Ras and HMGA2 are well known as targ ......"21472347
hsa-let-7g-3p

lung squamous cell cancerHRAS"Noteworthy we observed a significant association b ......"23820752
hsa-let-7g-3p

lung cancerHMGA2"Furthermore K-Ras and HMGA2 are well known as targ ......"21472347
hsa-let-7g-3p

lung cancerHMGA2"In let-7g expressing tumors reductions in Ras fami ......"18308936
hsa-let-7g-3p

esophageal cancerABCC10"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271
hsa-let-7g-3p

esophageal cancerBAG3"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271
hsa-let-7g-3p

liver cancerBCL2L1"Over-expression of let-7c or let-7g led to a clear ......"20347499
hsa-let-7g-3p

gastric cancerDDR1"Hsa let 7g miRNA regulates the anti tumor effects ......"25972194



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-let-7g-3p
RPS6KA2
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.247; TCGA BRCA -0.112; TCGA ESCA -0.188; TCGA HNSC -0.159; TCGA KIRC -0.114; TCGA LUAD -0.105; TCGA LUSC -0.281; TCGA PAAD -0.146; TCGA THCA -0.121; TCGA STAD -0.12; TCGA UCEC -0.109
hsa-let-7g-3p
EBF3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.412; TCGA BRCA -0.283; TCGA CESC -0.439; TCGA COAD -0.631; TCGA ESCA -0.583; TCGA KIRC -0.266; TCGA KIRP -0.304; TCGA LIHC -0.265; TCGA LUAD -0.182; TCGA PAAD -0.363; TCGA STAD -0.307; TCGA UCEC -0.218
hsa-let-7g-3p
NID1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; OV; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.356; TCGA CESC -0.276; TCGA COAD -0.257; TCGA ESCA -0.212; TCGA HNSC -0.237; TCGA OV -0.185; TCGA PAAD -0.301; TCGA THCA -0.247; TCGA STAD -0.181; TCGA UCEC -0.162
hsa-let-7g-3p
REEP1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.836; TCGA BRCA -0.25; TCGA COAD -0.354; TCGA ESCA -0.685; TCGA HNSC -0.165; TCGA LUAD -0.241; TCGA PRAD -0.136; TCGA SARC -0.538; TCGA STAD -0.625; TCGA UCEC -0.222
hsa-let-7g-3p
ADRA1D
9 cancers: BLCA; COAD; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.614; TCGA COAD -0.429; TCGA LIHC -0.354; TCGA LUAD -0.181; TCGA LUSC -0.28; TCGA OV -0.22; TCGA PRAD -0.241; TCGA STAD -0.539; TCGA UCEC -0.415
hsa-let-7g-3p
BNC2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.87; TCGA BRCA -0.104; TCGA CESC -0.47; TCGA COAD -0.691; TCGA ESCA -0.932; TCGA HNSC -0.243; TCGA LUAD -0.118; TCGA LUSC -0.214; TCGA PAAD -0.667; TCGA STAD -0.454; TCGA UCEC -0.582
hsa-let-7g-3p
BAG3
10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.199; TCGA BRCA -0.084; TCGA CESC -0.195; TCGA HNSC -0.054; TCGA LUAD -0.066; TCGA PAAD -0.343; TCGA SARC -0.068; TCGA THCA -0.178; TCGA STAD -0.175; TCGA UCEC -0.082
hsa-let-7g-3p
NUDT10
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.744; TCGA BRCA -0.132; TCGA CESC -0.367; TCGA COAD -0.701; TCGA ESCA -0.631; TCGA LUAD -0.137; TCGA OV -0.2; TCGA PAAD -0.368; TCGA THCA -0.193; TCGA STAD -0.559; TCGA UCEC -0.234
hsa-let-7g-3p
PTPN5
9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.538; TCGA ESCA -0.844; TCGA HNSC -0.39; TCGA LUAD -0.301; TCGA LUSC -0.264; TCGA PAAD -0.459; TCGA THCA -0.281; TCGA STAD -0.449; TCGA UCEC -0.436
hsa-let-7g-3p
ACTC1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -2.01; TCGA BRCA -0.17; TCGA CESC -0.47; TCGA COAD -0.96; TCGA ESCA -1.44; TCGA HNSC -0.984; TCGA PRAD -0.191; TCGA SARC -0.893; TCGA THCA -0.387; TCGA STAD -0.554; TCGA UCEC -0.341
hsa-let-7g-3p
INPP5A
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.163; TCGA CESC -0.104; TCGA ESCA -0.247; TCGA HNSC -0.126; TCGA KIRC -0.069; TCGA LUAD -0.079; TCGA SARC -0.084; TCGA STAD -0.204; TCGA UCEC -0.209
hsa-let-7g-3p
PAM
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.306; TCGA COAD -0.26; TCGA ESCA -0.343; TCGA HNSC -0.086; TCGA LUAD -0.06; TCGA LUSC -0.176; TCGA PRAD -0.055; TCGA THCA -0.166; TCGA STAD -0.219
hsa-let-7g-3p
STARD8
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.38; TCGA BRCA -0.161; TCGA CESC -0.245; TCGA COAD -0.334; TCGA ESCA -0.276; TCGA HNSC -0.111; TCGA LUAD -0.149; TCGA LUSC -0.288; TCGA STAD -0.093; TCGA UCEC -0.27
hsa-let-7g-3p
GAPT
10 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.511; TCGA CESC -0.241; TCGA COAD -0.575; TCGA ESCA -0.309; TCGA LUAD -0.201; TCGA LUSC -0.237; TCGA SARC -0.338; TCGA THCA -0.24; TCGA STAD -0.162; TCGA UCEC -0.232
hsa-let-7g-3p
MAP3K8
9 cancers: BLCA; BRCA; ESCA; KIRC; LUSC; PAAD; PRAD; SARC; UCEC
MirTarget
TCGA BLCA -0.12; TCGA BRCA -0.108; TCGA ESCA -0.281; TCGA KIRC -0.243; TCGA LUSC -0.219; TCGA PAAD -0.253; TCGA PRAD -0.076; TCGA SARC -0.247; TCGA UCEC -0.135
hsa-let-7g-3p
CLDN11
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.351; TCGA BRCA -0.443; TCGA CESC -0.353; TCGA COAD -0.637; TCGA ESCA -0.504; TCGA HNSC -0.228; TCGA LUAD -0.175; TCGA LUSC -0.277; TCGA PAAD -0.616; TCGA PRAD -0.09; TCGA THCA -0.245; TCGA STAD -0.278; TCGA UCEC -0.283
hsa-let-7g-3p
NAV3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.692; TCGA BRCA -0.202; TCGA CESC -0.565; TCGA COAD -0.613; TCGA ESCA -0.579; TCGA HNSC -0.369; TCGA LUAD -0.128; TCGA LUSC -0.222; TCGA PAAD -0.318; TCGA THCA -0.201; TCGA STAD -0.326; TCGA UCEC -0.326
hsa-let-7g-3p
IL33
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.798; TCGA BRCA -0.422; TCGA CESC -0.409; TCGA COAD -0.484; TCGA ESCA -0.696; TCGA LUAD -0.243; TCGA LUSC -0.384; TCGA PRAD -0.102; TCGA SARC -0.624; TCGA STAD -0.408; TCGA UCEC -0.309
hsa-let-7g-3p
MBNL1
9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.224; TCGA CESC -0.145; TCGA COAD -0.113; TCGA ESCA -0.159; TCGA LUAD -0.146; TCGA LUSC -0.052; TCGA SARC -0.274; TCGA STAD -0.153; TCGA UCEC -0.141
hsa-let-7g-3p
RORA
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BLCA -0.27; TCGA CESC -0.424; TCGA COAD -0.375; TCGA ESCA -0.469; TCGA HNSC -0.099; TCGA KIRC -0.175; TCGA LUAD -0.095; TCGA LUSC -0.111; TCGA STAD -0.241; TCGA UCEC -0.15
hsa-let-7g-3p
FZD4
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.156; TCGA BRCA -0.181; TCGA COAD -0.251; TCGA ESCA -0.235; TCGA HNSC -0.13; TCGA KIRC -0.117; TCGA LUAD -0.086; TCGA LUSC -0.287; TCGA STAD -0.175; TCGA UCEC -0.24
hsa-let-7g-3p
HMCN1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.362; TCGA BRCA -0.09; TCGA CESC -0.298; TCGA COAD -0.619; TCGA ESCA -0.937; TCGA HNSC -0.235; TCGA KIRC -0.174; TCGA LUAD -0.16; TCGA LUSC -0.212; TCGA OV -0.156; TCGA PAAD -0.461; TCGA THCA -0.332; TCGA STAD -0.333
hsa-let-7g-3p
CHRD
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.534; TCGA BRCA -0.386; TCGA CESC -0.244; TCGA COAD -0.41; TCGA ESCA -0.643; TCGA HNSC -0.272; TCGA KIRC -0.263; TCGA KIRP -0.239; TCGA LGG -0.08; TCGA LUSC -0.179; TCGA PAAD -0.322; TCGA THCA -0.142; TCGA STAD -0.221; TCGA UCEC -0.372
hsa-let-7g-3p
ZBTB47
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.173; TCGA BRCA -0.147; TCGA COAD -0.182; TCGA ESCA -0.408; TCGA HNSC -0.137; TCGA LUAD -0.101; TCGA LUSC -0.182; TCGA PAAD -0.174; TCGA SARC -0.134; TCGA STAD -0.242; TCGA UCEC -0.104
hsa-let-7g-3p
RBMS3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
MirTarget
TCGA BLCA -0.632; TCGA BRCA -0.153; TCGA CESC -0.305; TCGA COAD -0.557; TCGA ESCA -0.589; TCGA HNSC -0.234; TCGA LUAD -0.237; TCGA LUSC -0.258; TCGA PAAD -0.443; TCGA STAD -0.403
hsa-let-7g-3p
BCL6
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; PAAD; SARC; STAD
MirTarget
TCGA BLCA -0.082; TCGA BRCA -0.054; TCGA CESC -0.118; TCGA COAD -0.172; TCGA ESCA -0.361; TCGA KIRC -0.212; TCGA LGG -0.06; TCGA LUAD -0.071; TCGA PAAD -0.265; TCGA SARC -0.224; TCGA STAD -0.186
hsa-let-7g-3p
PDGFRA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.514; TCGA BRCA -0.084; TCGA CESC -0.385; TCGA COAD -0.448; TCGA ESCA -0.427; TCGA HNSC -0.242; TCGA LUAD -0.124; TCGA OV -0.223; TCGA PAAD -0.486; TCGA THCA -0.278; TCGA STAD -0.114; TCGA UCEC -0.215
hsa-let-7g-3p
ADCYAP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.753; TCGA BRCA -0.267; TCGA CESC -0.465; TCGA COAD -1.107; TCGA ESCA -1.2; TCGA HNSC -0.234; TCGA KIRP -0.438; TCGA PAAD -0.528; TCGA PRAD -0.264; TCGA SARC -0.739; TCGA THCA -0.318; TCGA STAD -0.495; TCGA UCEC -0.449
hsa-let-7g-3p
MBNL2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.142; TCGA CESC -0.182; TCGA COAD -0.116; TCGA ESCA -0.212; TCGA HNSC -0.13; TCGA LUAD -0.089; TCGA PRAD -0.077; TCGA SARC -0.103; TCGA STAD -0.155; TCGA UCEC -0.177
hsa-let-7g-3p
OSR2
10 cancers: BLCA; BRCA; CESC; KIRP; LIHC; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.344; TCGA BRCA -0.184; TCGA CESC -0.204; TCGA KIRP -0.301; TCGA LIHC -0.517; TCGA PAAD -0.64; TCGA SARC -0.274; TCGA THCA -0.326; TCGA STAD -0.139; TCGA UCEC -0.46
hsa-let-7g-3p
FLI1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.331; TCGA BRCA -0.108; TCGA CESC -0.159; TCGA COAD -0.394; TCGA ESCA -0.232; TCGA KIRC -0.126; TCGA LUAD -0.145; TCGA LUSC -0.228; TCGA THCA -0.08; TCGA STAD -0.082; TCGA UCEC -0.274
hsa-let-7g-3p
DACT3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.876; TCGA BRCA -0.209; TCGA CESC -0.472; TCGA COAD -0.704; TCGA ESCA -0.935; TCGA HNSC -0.221; TCGA KIRC -0.243; TCGA LUAD -0.11; TCGA LUSC -0.289; TCGA OV -0.149; TCGA PAAD -0.506; TCGA PRAD -0.108; TCGA SARC -0.391; TCGA STAD -0.544; TCGA UCEC -0.55
hsa-let-7g-3p
RELL1
11 cancers: BLCA; BRCA; COAD; KIRC; LGG; LUAD; PAAD; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.138; TCGA BRCA -0.053; TCGA COAD -0.113; TCGA KIRC -0.107; TCGA LGG -0.069; TCGA LUAD -0.148; TCGA PAAD -0.135; TCGA PRAD -0.06; TCGA SARC -0.138; TCGA THCA -0.136; TCGA UCEC -0.092
hsa-let-7g-3p
TMEM130
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BLCA -0.504; TCGA BRCA -0.213; TCGA CESC -0.269; TCGA COAD -0.733; TCGA ESCA -0.476; TCGA KIRP -0.393; TCGA LUAD -0.196; TCGA LUSC -0.299; TCGA STAD -0.343; TCGA UCEC -0.149
hsa-let-7g-3p
APBB2
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; PAAD; STAD
MirTarget
TCGA BLCA -0.192; TCGA BRCA -0.057; TCGA CESC -0.118; TCGA COAD -0.087; TCGA KIRC -0.082; TCGA LUAD -0.112; TCGA LUSC -0.187; TCGA PAAD -0.19; TCGA STAD -0.106
hsa-let-7g-3p
ITGA10
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.25; TCGA COAD -0.22; TCGA ESCA -0.392; TCGA HNSC -0.134; TCGA KIRC -0.502; TCGA KIRP -0.233; TCGA LUAD -0.12; TCGA LUSC -0.398; TCGA PAAD -0.329; TCGA SARC -0.363; TCGA STAD -0.215
hsa-let-7g-3p
TSHZ3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.593; TCGA BRCA -0.099; TCGA CESC -0.376; TCGA COAD -0.475; TCGA ESCA -0.63; TCGA HNSC -0.11; TCGA LUAD -0.077; TCGA LUSC -0.139; TCGA PAAD -0.219; TCGA STAD -0.314; TCGA UCEC -0.296
hsa-let-7g-3p
MAGI2
9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.224; TCGA CESC -0.218; TCGA COAD -0.25; TCGA ESCA -0.578; TCGA LUAD -0.129; TCGA LUSC -0.112; TCGA SARC -0.109; TCGA STAD -0.379; TCGA UCEC -0.231
hsa-let-7g-3p
FOXN3
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.237; TCGA CESC -0.13; TCGA COAD -0.169; TCGA ESCA -0.341; TCGA HNSC -0.097; TCGA LUAD -0.076; TCGA SARC -0.218; TCGA THCA -0.142; TCGA STAD -0.209; TCGA UCEC -0.098
hsa-let-7g-3p
GAS7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.706; TCGA BRCA -0.202; TCGA CESC -0.228; TCGA COAD -0.506; TCGA ESCA -0.702; TCGA HNSC -0.241; TCGA LUAD -0.156; TCGA LUSC -0.165; TCGA PAAD -0.291; TCGA THCA -0.213; TCGA STAD -0.268; TCGA UCEC -0.157
hsa-let-7g-3p
ADAMTS5
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.357; TCGA CESC -0.266; TCGA COAD -0.273; TCGA ESCA -0.405; TCGA HNSC -0.258; TCGA KIRC -0.145; TCGA LGG -0.169; TCGA OV -0.273; TCGA PAAD -0.25; TCGA STAD -0.15; TCGA UCEC -0.322
hsa-let-7g-3p
FAM131B
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.359; TCGA BRCA -0.142; TCGA CESC -0.36; TCGA COAD -0.289; TCGA ESCA -0.339; TCGA KIRC -0.153; TCGA KIRP -0.189; TCGA THCA -0.22; TCGA STAD -0.166; TCGA UCEC -0.356
hsa-let-7g-3p
WSCD1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.382; TCGA BRCA -0.313; TCGA CESC -0.274; TCGA COAD -0.22; TCGA ESCA -0.475; TCGA HNSC -0.187; TCGA LGG -0.133; TCGA LIHC -0.205; TCGA LUAD -0.104; TCGA THCA -0.09; TCGA STAD -0.247; TCGA UCEC -0.402
hsa-let-7g-3p
SV2B
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; OV; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.652; TCGA BRCA -0.177; TCGA COAD -0.878; TCGA ESCA -0.653; TCGA LUAD -0.16; TCGA OV -0.221; TCGA THCA -0.266; TCGA STAD -0.293; TCGA UCEC -0.479
hsa-let-7g-3p
C3orf70
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.383; TCGA CESC -0.596; TCGA COAD -0.185; TCGA ESCA -0.623; TCGA KIRC -0.221; TCGA LUAD -0.142; TCGA OV -0.141; TCGA PRAD -0.078; TCGA SARC -0.411; TCGA THCA -0.116; TCGA STAD -0.558; TCGA UCEC -0.538
hsa-let-7g-3p
ADAMTSL1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; OV; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.628; TCGA BRCA -0.094; TCGA CESC -0.252; TCGA COAD -0.468; TCGA ESCA -0.924; TCGA HNSC -0.226; TCGA OV -0.239; TCGA PAAD -0.47; TCGA THCA -0.327; TCGA STAD -0.249; TCGA UCEC -0.291
hsa-let-7g-3p
RIMS3
10 cancers: BLCA; CESC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.217; TCGA CESC -0.244; TCGA LIHC -0.264; TCGA LUAD -0.114; TCGA LUSC -0.236; TCGA PRAD -0.08; TCGA SARC -0.485; TCGA THCA -0.19; TCGA STAD -0.295; TCGA UCEC -0.281
hsa-let-7g-3p
TCF4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.405; TCGA BRCA -0.062; TCGA CESC -0.3; TCGA COAD -0.453; TCGA ESCA -0.327; TCGA HNSC -0.106; TCGA KIRC -0.211; TCGA LUAD -0.119; TCGA LUSC -0.108; TCGA PAAD -0.24; TCGA STAD -0.197; TCGA UCEC -0.178
hsa-let-7g-3p
NAMPT
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; PAAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.196; TCGA COAD -0.082; TCGA ESCA -0.195; TCGA HNSC -0.114; TCGA KIRP -0.104; TCGA PAAD -0.18; TCGA SARC -0.207; TCGA THCA -0.226; TCGA UCEC -0.149
hsa-let-7g-3p
CACNB4
12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.538; TCGA BRCA -0.174; TCGA COAD -0.344; TCGA ESCA -0.387; TCGA KIRP -0.242; TCGA LIHC -0.648; TCGA LUAD -0.243; TCGA LUSC -0.25; TCGA PRAD -0.102; TCGA SARC -0.26; TCGA STAD -0.27; TCGA UCEC -0.171
hsa-let-7g-3p
FGF13
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.407; TCGA BRCA -0.095; TCGA COAD -0.337; TCGA ESCA -0.44; TCGA HNSC -0.19; TCGA PRAD -0.055; TCGA SARC -0.224; TCGA THCA -0.191; TCGA STAD -0.377
hsa-let-7g-3p
CADM3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.283; TCGA BRCA -0.57; TCGA CESC -0.483; TCGA COAD -1.215; TCGA ESCA -1.465; TCGA HNSC -0.251; TCGA LUAD -0.146; TCGA PRAD -0.173; TCGA SARC -0.583; TCGA THCA -0.481; TCGA STAD -0.655; TCGA UCEC -0.377
hsa-let-7g-3p
EBF1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; STAD; UCEC
miRNATAP
TCGA BLCA -0.564; TCGA BRCA -0.216; TCGA CESC -0.312; TCGA COAD -0.426; TCGA ESCA -0.493; TCGA HNSC -0.175; TCGA KIRC -0.253; TCGA LIHC -0.179; TCGA LUAD -0.141; TCGA LUSC -0.156; TCGA OV -0.15; TCGA STAD -0.311; TCGA UCEC -0.228
hsa-let-7g-3p
ANTXR1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.366; TCGA CESC -0.291; TCGA COAD -0.634; TCGA ESCA -0.422; TCGA HNSC -0.095; TCGA LGG -0.073; TCGA LUAD -0.1; TCGA PAAD -0.595; TCGA THCA -0.134; TCGA STAD -0.177; TCGA UCEC -0.201
hsa-let-7g-3p
FYN
9 cancers: BLCA; COAD; KIRC; LGG; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.308; TCGA COAD -0.224; TCGA KIRC -0.133; TCGA LGG -0.072; TCGA LUAD -0.083; TCGA LUSC -0.103; TCGA THCA -0.105; TCGA STAD -0.068; TCGA UCEC -0.292
hsa-let-7g-3p
EPHA3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.597; TCGA CESC -0.36; TCGA COAD -0.511; TCGA ESCA -0.669; TCGA HNSC -0.162; TCGA LUAD -0.186; TCGA OV -0.18; TCGA PAAD -0.371; TCGA PRAD -0.088; TCGA STAD -0.373; TCGA UCEC -0.278
hsa-let-7g-3p
SLITRK3
11 cancers: BLCA; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.929; TCGA COAD -1.041; TCGA ESCA -1.961; TCGA LUAD -0.23; TCGA LUSC -0.324; TCGA OV -0.269; TCGA PAAD -0.808; TCGA PRAD -0.167; TCGA SARC -0.59; TCGA STAD -0.703; TCGA UCEC -0.653
hsa-let-7g-3p
DLC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.278; TCGA BRCA -0.141; TCGA CESC -0.25; TCGA COAD -0.338; TCGA ESCA -0.441; TCGA HNSC -0.211; TCGA KIRC -0.109; TCGA LUAD -0.297; TCGA LUSC -0.438; TCGA THCA -0.107; TCGA STAD -0.25; TCGA UCEC -0.217
hsa-let-7g-3p
RBPMS
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.282; TCGA BRCA -0.209; TCGA COAD -0.308; TCGA ESCA -0.607; TCGA HNSC -0.123; TCGA KIRC -0.095; TCGA LUAD -0.117; TCGA LUSC -0.234; TCGA PAAD -0.292; TCGA PRAD -0.093; TCGA SARC -0.551; TCGA STAD -0.336; TCGA UCEC -0.17
hsa-let-7g-3p
MEF2D
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.172; TCGA BRCA -0.064; TCGA COAD -0.095; TCGA ESCA -0.123; TCGA HNSC -0.073; TCGA KIRC -0.105; TCGA LUSC -0.082; TCGA SARC -0.116; TCGA THCA -0.055; TCGA STAD -0.081; TCGA UCEC -0.124
hsa-let-7g-3p
KCNAB1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.317; TCGA BRCA -0.058; TCGA COAD -0.404; TCGA ESCA -0.254; TCGA HNSC -0.176; TCGA KIRC -0.347; TCGA LUAD -0.253; TCGA LUSC -0.234; TCGA OV -0.129; TCGA PRAD -0.124; TCGA STAD -0.225; TCGA UCEC -0.237
hsa-let-7g-3p
RARA
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUSC; PAAD; THCA
miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.157; TCGA COAD -0.07; TCGA HNSC -0.088; TCGA KIRC -0.148; TCGA LGG -0.118; TCGA LUSC -0.096; TCGA PAAD -0.178; TCGA THCA -0.077
hsa-let-7g-3p
PCDH10
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.695; TCGA BRCA -0.157; TCGA CESC -0.485; TCGA ESCA -1.029; TCGA HNSC -0.311; TCGA KIRC -0.317; TCGA LUAD -0.15; TCGA LUSC -0.258; TCGA THCA -0.271; TCGA STAD -0.888; TCGA UCEC -0.239
hsa-let-7g-3p
MCTP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.492; TCGA BRCA -0.112; TCGA CESC -0.241; TCGA COAD -0.511; TCGA ESCA -0.419; TCGA LUAD -0.132; TCGA LUSC -0.247; TCGA PAAD -0.429; TCGA SARC -0.218; TCGA THCA -0.244; TCGA STAD -0.083; TCGA UCEC -0.268
hsa-let-7g-3p
NLGN2
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.091; TCGA BRCA -0.118; TCGA COAD -0.299; TCGA ESCA -0.345; TCGA KIRC -0.152; TCGA LGG -0.098; TCGA PAAD -0.244; TCGA THCA -0.094; TCGA STAD -0.246; TCGA UCEC -0.136
hsa-let-7g-3p
COL8A1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.474; TCGA CESC -0.398; TCGA COAD -0.651; TCGA ESCA -0.673; TCGA HNSC -0.261; TCGA LUAD -0.111; TCGA LUSC -0.222; TCGA PAAD -0.963; TCGA SARC -0.588; TCGA THCA -0.354; TCGA STAD -0.245; TCGA UCEC -0.16
hsa-let-7g-3p
TMTC1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.53; TCGA BRCA -0.144; TCGA COAD -0.489; TCGA ESCA -0.661; TCGA HNSC -0.204; TCGA LUAD -0.173; TCGA THCA -0.168; TCGA STAD -0.393; TCGA UCEC -0.207
hsa-let-7g-3p
SORBS1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.946; TCGA BRCA -0.143; TCGA CESC -0.373; TCGA COAD -0.436; TCGA ESCA -1.021; TCGA HNSC -0.276; TCGA LUAD -0.265; TCGA LUSC -0.322; TCGA PRAD -0.108; TCGA SARC -0.663; TCGA THCA -0.138; TCGA STAD -0.641; TCGA UCEC -0.474
hsa-let-7g-3p
TNS1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.868; TCGA BRCA -0.2; TCGA COAD -0.675; TCGA ESCA -0.967; TCGA HNSC -0.226; TCGA LUAD -0.192; TCGA LUSC -0.347; TCGA PAAD -0.319; TCGA PRAD -0.091; TCGA SARC -0.551; TCGA STAD -0.509; TCGA UCEC -0.356
hsa-let-7g-3p
ARHGEF17
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.284; TCGA BRCA -0.109; TCGA COAD -0.329; TCGA ESCA -0.404; TCGA HNSC -0.087; TCGA KIRC -0.204; TCGA LUSC -0.218; TCGA PAAD -0.22; TCGA SARC -0.179; TCGA STAD -0.254; TCGA UCEC -0.085
hsa-let-7g-3p
FLRT3
10 cancers: BRCA; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.182; TCGA COAD -0.235; TCGA HNSC -0.417; TCGA LUAD -0.261; TCGA LUSC -0.381; TCGA OV -0.249; TCGA PAAD -0.464; TCGA PRAD -0.142; TCGA THCA -0.202; TCGA UCEC -0.435
hsa-let-7g-3p
RBMS1
9 cancers: CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.189; TCGA COAD -0.454; TCGA ESCA -0.297; TCGA LUAD -0.087; TCGA LUSC -0.08; TCGA PAAD -0.303; TCGA PRAD -0.085; TCGA STAD -0.235; TCGA UCEC -0.263
hsa-let-7g-3p
DOCK9
10 cancers: CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.189; TCGA ESCA -0.317; TCGA HNSC -0.094; TCGA KIRC -0.132; TCGA LUAD -0.182; TCGA LUSC -0.118; TCGA PAAD -0.176; TCGA THCA -0.113; TCGA STAD -0.079; TCGA UCEC -0.075





Enriched cancer pathways of putative targets