microRNA information: hsa-let-7g-5p

SectionIDlink
Mature name: hsa-let-7g-5pmiRbase
Accession: MIMAT0000414miRbase
Precursor name: hsa-let-7g miRbase
Precursor accession: MI0000433miRbase
Symbol: MIRLET7GHGNC
RefSeq ID: NR_029660GenBank
Sequence: UGAGGUAGUAGUUUGUACAGUU



Reported expression in cancers: hsa-let-7g-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-let-7g-5p

breast cancerderegulation"We established primary cultures of CAFs and paired ......"22964023Microarray
hsa-let-7g-5p

breast cancerderegulation"The different expressions of miRNAs in CAFs versus ......"25270211Microarray
hsa-let-7g-5p

gastric cancerupregulation"miRNA expression was determined using a custom-des ......"22112324Microarray
hsa-let-7g-5p

glioblastomadownregulation"miRNA microarray reveals specific expression in th ......"24858071Microarray
hsa-let-7g-5p

head and neck cancerdownregulation"Conversely decreased expressions of miR-153 miR-20 ......"25677760
hsa-let-7g-5p

liver cancerdownregulation"Reexpression of Let 7g microRNA inhibits the proli ......"24724096qPCR; in situ hybridization
hsa-let-7g-5p

lung cancerdownregulation"The expression of 319 miRNAs was evaluated by Exiq ......"20818338Microarray
hsa-let-7g-5p

lymphomaderegulation"We found miR-34a miR-146a and miR-193b to be up-re ......"25862860
hsa-let-7g-5p

prostate cancerdownregulation"We investigated the expression profiles of 6 micro ......"20873592Microarray; in situ hybridization



Reported cancer pathway affected by hsa-let-7g-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-let-7g-5p

esophageal cancerApoptosis pathway"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271Western blot; Luciferase
hsa-let-7g-5p

gastric cancerApoptosis pathway"In order to identify miRNA signatures for gastric ......"22112324
hsa-let-7g-5p

liver cancerEpithelial mesenchymal transition pathway"Reexpression of Let 7g microRNA inhibits the proli ......"24724096Transwell assay; Western blot
hsa-let-7g-5p

lung cancercell cycle pathway"Ectopic expression of let-7g in K-RasG12D-expressi ......"18308936



Reported cancer prognosis affected by hsa-let-7g-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-let-7g-5p

B cell lymphomapoor survival"Finally eight miRNAs were found to correlate with ......"18537969
hsa-let-7g-5p

breast cancermetastasis"Here we report that the expression levels of three ......"23339187
hsa-let-7g-5p

colon cancerdrug resistance; tumorigenesis; poor survival"Non coding MicroRNAs hsa let 7g and hsa miR 181b a ......"18172508
hsa-let-7g-5p

esophageal cancerdrug resistance"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271Western blot; Luciferase
hsa-let-7g-5p

gastric cancerstaging; metastasis; poor survival"353 gastric samples from two independent subsets o ......"20022810
hsa-let-7g-5p

gastric cancerdrug resistance"In order to identify miRNA signatures for gastric ......"22112324
hsa-let-7g-5p

head and neck cancerworse prognosis"Conversely decreased expressions of miR-153 miR-20 ......"25677760
hsa-let-7g-5p

liver cancermetastasis"Identification of metastasis related microRNAs of ......"19912688
hsa-let-7g-5p

liver cancerworse prognosis; poor survival; staging"Reexpression of Let 7g microRNA inhibits the proli ......"24724096Transwell assay; Western blot
hsa-let-7g-5p

lung cancercell migration; worse prognosis; metastasis"Suppression of A549 lung cancer cell migration by ......"21472347
hsa-let-7g-5p

lung squamous cell cancerprogression; worse prognosis; poor survival"Let 7g and miR 21 expression in non small cell lun ......"23820752
hsa-let-7g-5p

ovarian cancerprogression; poor survival"miRNA profiling by microarray real-time PCR and im ......"26782955
hsa-let-7g-5p

pancreatic cancerstaging; differentiation"Expressions of miRNAs were determined with the Taq ......"22851141



Reported gene related to hsa-let-7g-5p

miRNAcancergenereportingPUBMED
hsa-let-7g-5p

liver cancerHRAS"We found using Western-blotting that let-7g can re ......"24724096
hsa-let-7g-5p

lung cancerHRAS"Furthermore K-Ras and HMGA2 are well known as targ ......"21472347
hsa-let-7g-5p

lung squamous cell cancerHRAS"Noteworthy we observed a significant association b ......"23820752
hsa-let-7g-5p

lung cancerHMGA2"Furthermore K-Ras and HMGA2 are well known as targ ......"21472347
hsa-let-7g-5p

lung cancerHMGA2"In let-7g expressing tumors reductions in Ras fami ......"18308936
hsa-let-7g-5p

esophageal cancerABCC10"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271
hsa-let-7g-5p

esophageal cancerBAG3"BAG3 mediated miRNA let 7g and let 7i inhibit prol ......"26655271
hsa-let-7g-5p

liver cancerBCL2L1"Over-expression of let-7c or let-7g led to a clear ......"20347499
hsa-let-7g-5p

gastric cancerDDR1"Hsa let 7g miRNA regulates the anti tumor effects ......"25972194



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-let-7g-5p
COL1A2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -1.106; TCGA BRCA -0.462; TCGA CESC -0.827; TCGA COAD -1.155; TCGA ESCA -0.313; TCGA HNSC -0.364; TCGA KIRC -0.367; TCGA KIRP -0.509; TCGA LUAD -0.378; TCGA LUSC -0.748; TCGA PAAD -0.982; TCGA PRAD -0.243; TCGA THCA -0.375; TCGA STAD -0.314; TCGA UCEC -0.214
hsa-let-7g-5p
HMGA2
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; OV; PAAD; THCA; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget
TCGA BLCA -1.432; TCGA BRCA -0.258; TCGA CESC -0.849; TCGA HNSC -0.746; TCGA KIRP -0.952; TCGA LIHC -0.716; TCGA LUAD -0.582; TCGA OV -0.422; TCGA PAAD -0.528; TCGA THCA -0.967; TCGA UCEC -0.557
hsa-let-7g-5p
RAB21
9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.123; TCGA CESC -0.201; TCGA ESCA -0.168; TCGA HNSC -0.12; TCGA LUSC -0.115; TCGA PAAD -0.1; TCGA PRAD -0.129; TCGA STAD -0.126; TCGA UCEC -0.164
hsa-let-7g-5p
FN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRTarBase
TCGA BLCA -1.384; TCGA BRCA -0.225; TCGA CESC -0.904; TCGA COAD -1.347; TCGA ESCA -0.364; TCGA KIRC -0.348; TCGA LUAD -0.231; TCGA LUSC -0.703; TCGA PAAD -1.036; TCGA PRAD -0.539; TCGA SARC -0.312; TCGA THCA -0.789; TCGA STAD -0.843; TCGA UCEC -0.539
hsa-let-7g-5p
CDKN1A
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; THCA
MirTarget
TCGA BLCA -0.262; TCGA BRCA -0.235; TCGA CESC -0.317; TCGA ESCA -0.315; TCGA HNSC -0.399; TCGA KIRC -0.173; TCGA LGG -0.241; TCGA LUSC -0.397; TCGA THCA -0.245
hsa-let-7g-5p
MIB1
10 cancers: BLCA; COAD; KIRP; LGG; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.17; TCGA COAD -0.129; TCGA KIRP -0.181; TCGA LGG -0.125; TCGA OV -0.113; TCGA PAAD -0.216; TCGA PRAD -0.321; TCGA SARC -0.215; TCGA STAD -0.159; TCGA UCEC -0.277
hsa-let-7g-5p
CERCAM
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.442; TCGA BRCA -0.358; TCGA CESC -0.484; TCGA COAD -0.996; TCGA ESCA -0.393; TCGA HNSC -0.367; TCGA KIRC -0.171; TCGA KIRP -0.498; TCGA LUAD -0.324; TCGA LUSC -0.339; TCGA PAAD -0.502; TCGA PRAD -0.197; TCGA STAD -0.366; TCGA UCEC -0.187
hsa-let-7g-5p
MAP4K4
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; THCA
MirTarget
TCGA BLCA -0.44; TCGA CESC -0.341; TCGA COAD -0.232; TCGA ESCA -0.21; TCGA HNSC -0.311; TCGA KIRC -0.25; TCGA KIRP -0.151; TCGA LUAD -0.102; TCGA LUSC -0.157; TCGA OV -0.148; TCGA PAAD -0.135; TCGA THCA -0.166
hsa-let-7g-5p
CPEB1
10 cancers: BLCA; BRCA; COAD; ESCA; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.472; TCGA BRCA -0.248; TCGA COAD -1.774; TCGA ESCA -0.435; TCGA OV -0.355; TCGA PAAD -0.427; TCGA PRAD -1.128; TCGA SARC -0.62; TCGA STAD -1.384; TCGA UCEC -0.388
hsa-let-7g-5p
ADAMTS15
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC
MirTarget; miRNATAP
TCGA BLCA -1.643; TCGA BRCA -0.713; TCGA CESC -1.022; TCGA COAD -0.586; TCGA ESCA -0.525; TCGA HNSC -0.433; TCGA LUSC -0.894; TCGA PRAD -0.832; TCGA SARC -0.662
hsa-let-7g-5p
IGF1R
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.303; TCGA CESC -0.324; TCGA COAD -0.152; TCGA ESCA -0.545; TCGA HNSC -0.156; TCGA LUSC -0.245; TCGA PAAD -0.19; TCGA PRAD -0.209; TCGA SARC -0.33; TCGA STAD -0.271
hsa-let-7g-5p
CD59
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.315; TCGA CESC -0.218; TCGA COAD -0.209; TCGA ESCA -0.241; TCGA HNSC -0.237; TCGA LUSC -0.399; TCGA PRAD -0.229; TCGA THCA -0.072; TCGA STAD -0.231; TCGA UCEC -0.076
hsa-let-7g-5p
ITGB3
11 cancers: BLCA; BRCA; CESC; COAD; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.178; TCGA BRCA -0.15; TCGA CESC -0.627; TCGA COAD -1.069; TCGA KIRP -0.891; TCGA LUSC -0.686; TCGA PAAD -0.514; TCGA PRAD -1.229; TCGA SARC -0.661; TCGA STAD -0.576; TCGA UCEC -0.69
hsa-let-7g-5p
BZW1
10 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LUSC; OV; PAAD; PRAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.085; TCGA BRCA -0.126; TCGA HNSC -0.206; TCGA KIRP -0.176; TCGA LGG -0.076; TCGA LUSC -0.192; TCGA OV -0.16; TCGA PAAD -0.224; TCGA PRAD -0.108; TCGA UCEC -0.194
hsa-let-7g-5p
PRRX1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.424; TCGA BRCA -0.153; TCGA CESC -0.372; TCGA COAD -1.207; TCGA ESCA -0.471; TCGA LGG -0.241; TCGA LIHC -0.299; TCGA LUSC -0.36; TCGA PAAD -0.89; TCGA PRAD -0.591; TCGA STAD -0.595; TCGA UCEC -0.313
hsa-let-7g-5p
SNX16
10 cancers: BLCA; CESC; ESCA; KIRP; LGG; LUSC; PAAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.128; TCGA CESC -0.22; TCGA ESCA -0.113; TCGA KIRP -0.137; TCGA LGG -0.089; TCGA LUSC -0.219; TCGA PAAD -0.252; TCGA SARC -0.356; TCGA THCA -0.086; TCGA UCEC -0.222
hsa-let-7g-5p
NAA30
12 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.196; TCGA CESC -0.18; TCGA ESCA -0.116; TCGA HNSC -0.18; TCGA LGG -0.075; TCGA LUSC -0.159; TCGA OV -0.063; TCGA PAAD -0.097; TCGA PRAD -0.128; TCGA SARC -0.122; TCGA STAD -0.145; TCGA UCEC -0.284
hsa-let-7g-5p
PAPPA
11 cancers: BLCA; BRCA; CESC; COAD; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.789; TCGA BRCA -0.187; TCGA CESC -0.632; TCGA COAD -1.004; TCGA LGG -0.434; TCGA LUSC -0.722; TCGA PAAD -0.597; TCGA PRAD -0.833; TCGA SARC -0.439; TCGA STAD -0.263; TCGA UCEC -0.703
hsa-let-7g-5p
GDF6
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.965; TCGA BRCA -0.211; TCGA CESC -0.899; TCGA COAD -1.513; TCGA ESCA -0.8; TCGA HNSC -0.382; TCGA KIRC -1.05; TCGA LUSC -0.441; TCGA OV -0.367; TCGA PAAD -0.909; TCGA PRAD -0.35; TCGA STAD -1.069; TCGA UCEC -0.729
hsa-let-7g-5p
COL3A1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.14; TCGA BRCA -0.416; TCGA CESC -0.787; TCGA COAD -1.238; TCGA ESCA -0.282; TCGA HNSC -0.308; TCGA KIRC -0.32; TCGA KIRP -0.504; TCGA LUAD -0.432; TCGA LUSC -0.758; TCGA PAAD -1.04; TCGA PRAD -0.247; TCGA THCA -0.405; TCGA STAD -0.382; TCGA UCEC -0.332
hsa-let-7g-5p
NGF
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.062; TCGA BRCA -0.148; TCGA CESC -0.755; TCGA ESCA -0.834; TCGA HNSC -1.054; TCGA KIRC -0.604; TCGA OV -0.374; TCGA SARC -0.284; TCGA THCA -0.232; TCGA STAD -0.784; TCGA UCEC -0.366
hsa-let-7g-5p
ERCC4
10 cancers: BLCA; COAD; ESCA; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.202; TCGA COAD -0.103; TCGA ESCA -0.086; TCGA LGG -0.089; TCGA LUSC -0.118; TCGA PAAD -0.171; TCGA PRAD -0.364; TCGA SARC -0.212; TCGA STAD -0.153; TCGA UCEC -0.16
hsa-let-7g-5p
DCN
9 cancers: BLCA; BRCA; CESC; COAD; KIRP; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -1.369; TCGA BRCA -0.304; TCGA CESC -0.508; TCGA COAD -1.286; TCGA KIRP -0.607; TCGA PAAD -0.89; TCGA PRAD -0.504; TCGA STAD -0.83; TCGA UCEC -0.518
hsa-let-7g-5p
SEMA4C
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.146; TCGA BRCA -0.156; TCGA COAD -0.158; TCGA KIRC -0.321; TCGA KIRP -0.244; TCGA LUAD -0.184; TCGA PRAD -0.158; TCGA THCA -0.169; TCGA STAD -0.418; TCGA UCEC -0.227
hsa-let-7g-5p
IGDCC4
9 cancers: BLCA; CESC; COAD; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.675; TCGA CESC -0.428; TCGA COAD -0.606; TCGA LIHC -0.493; TCGA LUAD -0.222; TCGA PAAD -0.639; TCGA PRAD -0.398; TCGA STAD -0.311; TCGA UCEC -0.225
hsa-let-7g-5p
KLHL13
10 cancers: BLCA; ESCA; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.212; TCGA ESCA -0.699; TCGA KIRP -0.371; TCGA LGG -0.262; TCGA PAAD -0.417; TCGA PRAD -0.659; TCGA SARC -1.07; TCGA THCA -0.26; TCGA STAD -1.063; TCGA UCEC -0.335
hsa-let-7g-5p
CHRD
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.855; TCGA BRCA -0.703; TCGA COAD -0.945; TCGA KIRC -0.319; TCGA LIHC -0.183; TCGA LUAD -0.273; TCGA PAAD -0.368; TCGA THCA -0.175; TCGA STAD -0.727; TCGA UCEC -0.323
hsa-let-7g-5p
TSPAN18
9 cancers: BLCA; COAD; KIRC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.882; TCGA COAD -0.749; TCGA KIRC -0.448; TCGA OV -0.312; TCGA PAAD -0.407; TCGA PRAD -0.813; TCGA SARC -0.427; TCGA STAD -0.869; TCGA UCEC -0.691
hsa-let-7g-5p
COL24A1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.196; TCGA BRCA -0.241; TCGA CESC -0.431; TCGA COAD -1.319; TCGA ESCA -0.388; TCGA HNSC -0.384; TCGA LIHC -0.736; TCGA LUAD -0.253; TCGA LUSC -0.402; TCGA PAAD -0.921; TCGA THCA -0.375; TCGA STAD -0.627
hsa-let-7g-5p
USP32
10 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.122; TCGA CESC -0.219; TCGA ESCA -0.094; TCGA HNSC -0.173; TCGA LUAD -0.117; TCGA LUSC -0.096; TCGA PAAD -0.216; TCGA PRAD -0.268; TCGA STAD -0.088; TCGA UCEC -0.113
hsa-let-7g-5p
RALB
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.244; TCGA BRCA -0.143; TCGA CESC -0.18; TCGA ESCA -0.23; TCGA HNSC -0.214; TCGA PAAD -0.235; TCGA PRAD -0.215; TCGA THCA -0.087; TCGA UCEC -0.287
hsa-let-7g-5p
DMD
9 cancers: BLCA; CESC; COAD; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.202; TCGA CESC -0.472; TCGA COAD -0.658; TCGA KIRP -0.361; TCGA PAAD -0.345; TCGA PRAD -1.046; TCGA SARC -0.858; TCGA STAD -1.441; TCGA UCEC -0.534
hsa-let-7g-5p
BACH1
10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; LUSC; PAAD; PRAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.268; TCGA CESC -0.227; TCGA COAD -0.107; TCGA ESCA -0.147; TCGA KIRP -0.227; TCGA LGG -0.117; TCGA LUSC -0.286; TCGA PAAD -0.361; TCGA PRAD -0.211; TCGA UCEC -0.332
hsa-let-7g-5p
PLXND1
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.338; TCGA BRCA -0.127; TCGA COAD -0.388; TCGA KIRC -0.507; TCGA LIHC -0.14; TCGA LUAD -0.168; TCGA LUSC -0.224; TCGA PRAD -0.134; TCGA THCA -0.241; TCGA UCEC -0.337
hsa-let-7g-5p
RDX
10 cancers: BLCA; COAD; ESCA; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.239; TCGA COAD -0.785; TCGA ESCA -0.35; TCGA LUSC -0.204; TCGA OV -0.082; TCGA PAAD -0.481; TCGA PRAD -0.375; TCGA SARC -0.231; TCGA STAD -0.588; TCGA UCEC -0.149
hsa-let-7g-5p
ARPP19
9 cancers: BLCA; CESC; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.083; TCGA CESC -0.188; TCGA ESCA -0.119; TCGA LUSC -0.102; TCGA PAAD -0.162; TCGA PRAD -0.218; TCGA SARC -0.168; TCGA STAD -0.188; TCGA UCEC -0.144
hsa-let-7g-5p
COL5A2
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.988; TCGA BRCA -0.35; TCGA CESC -0.782; TCGA COAD -1.018; TCGA HNSC -0.483; TCGA KIRC -0.433; TCGA KIRP -0.324; TCGA LUAD -0.46; TCGA LUSC -0.731; TCGA PAAD -0.953; TCGA THCA -0.302; TCGA STAD -0.245; TCGA UCEC -0.263
hsa-let-7g-5p
BCAP29
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.168; TCGA COAD -0.132; TCGA ESCA -0.162; TCGA HNSC -0.12; TCGA KIRC -0.095; TCGA LUSC -0.123; TCGA PAAD -0.104; TCGA SARC -0.137; TCGA STAD -0.251; TCGA UCEC -0.17
hsa-let-7g-5p
MDGA1
9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.943; TCGA BRCA -0.205; TCGA COAD -0.653; TCGA ESCA -0.574; TCGA KIRP -0.388; TCGA LGG -0.203; TCGA PAAD -0.301; TCGA STAD -0.482; TCGA UCEC -0.436
hsa-let-7g-5p
ST8SIA2
10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; OV; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.618; TCGA BRCA -0.326; TCGA ESCA -0.616; TCGA HNSC -0.469; TCGA LGG -0.773; TCGA OV -0.355; TCGA PAAD -0.916; TCGA PRAD -0.456; TCGA THCA -0.583; TCGA STAD -0.878
hsa-let-7g-5p
PLXDC1
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.492; TCGA BRCA -0.241; TCGA CESC -0.25; TCGA COAD -0.454; TCGA KIRC -0.751; TCGA KIRP -0.263; TCGA LIHC -0.279; TCGA PAAD -0.337; TCGA THCA -0.325; TCGA STAD -0.281; TCGA UCEC -0.192
hsa-let-7g-5p
SLC6A17
10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.941; TCGA CESC -0.663; TCGA COAD -0.892; TCGA ESCA -0.464; TCGA KIRP -0.851; TCGA LUAD -0.73; TCGA LUSC -0.694; TCGA SARC -0.858; TCGA STAD -0.732; TCGA UCEC -0.404
hsa-let-7g-5p
BBX
9 cancers: BLCA; COAD; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.186; TCGA COAD -0.137; TCGA KIRP -0.142; TCGA LUSC -0.142; TCGA PAAD -0.159; TCGA PRAD -0.462; TCGA SARC -0.208; TCGA STAD -0.232; TCGA UCEC -0.103
hsa-let-7g-5p
PTPRD
10 cancers: BLCA; BRCA; CESC; HNSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.333; TCGA BRCA -0.174; TCGA CESC -1.257; TCGA HNSC -0.46; TCGA OV -0.293; TCGA PAAD -0.51; TCGA PRAD -0.382; TCGA SARC -0.609; TCGA STAD -0.532; TCGA UCEC -0.461
hsa-let-7g-5p
KPNA4
9 cancers: BLCA; ESCA; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.168; TCGA ESCA -0.173; TCGA HNSC -0.158; TCGA LUSC -0.123; TCGA OV -0.09; TCGA PAAD -0.136; TCGA PRAD -0.137; TCGA STAD -0.19; TCGA UCEC -0.158
hsa-let-7g-5p
TGFBR1
12 cancers: BLCA; CESC; COAD; KIRP; LGG; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.498; TCGA CESC -0.268; TCGA COAD -0.348; TCGA KIRP -0.157; TCGA LGG -0.119; TCGA LUSC -0.265; TCGA OV -0.08; TCGA PAAD -0.267; TCGA PRAD -0.203; TCGA THCA -0.131; TCGA STAD -0.472; TCGA UCEC -0.234
hsa-let-7g-5p
PGM2L1
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; THCA
miRNATAP
TCGA BLCA -0.718; TCGA CESC -0.457; TCGA COAD -0.329; TCGA KIRC -0.238; TCGA KIRP -0.356; TCGA LUAD -0.162; TCGA LUSC -0.35; TCGA PAAD -0.326; TCGA THCA -0.175
hsa-let-7g-5p
BNC2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.539; TCGA BRCA -0.249; TCGA CESC -0.647; TCGA COAD -1.442; TCGA ESCA -0.328; TCGA LUSC -0.515; TCGA PAAD -0.962; TCGA PRAD -0.932; TCGA SARC -0.239; TCGA STAD -1.168; TCGA UCEC -0.869
hsa-let-7g-5p
ABL2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.291; TCGA CESC -0.268; TCGA COAD -0.178; TCGA ESCA -0.152; TCGA HNSC -0.26; TCGA KIRC -0.134; TCGA KIRP -0.175; TCGA LGG -0.133; TCGA LUSC -0.265; TCGA PAAD -0.159; TCGA STAD -0.123
hsa-let-7g-5p
CPEB2
9 cancers: BLCA; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.38; TCGA ESCA -0.25; TCGA HNSC -0.367; TCGA KIRP -0.152; TCGA LUSC -0.207; TCGA PAAD -0.168; TCGA PRAD -0.409; TCGA SARC -0.368; TCGA STAD -0.268
hsa-let-7g-5p
OSMR
11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.341; TCGA COAD -1.192; TCGA ESCA -0.314; TCGA KIRC -0.269; TCGA KIRP -0.575; TCGA LUSC -0.501; TCGA PAAD -0.586; TCGA PRAD -0.618; TCGA SARC -0.491; TCGA STAD -0.367; TCGA UCEC -0.242
hsa-let-7g-5p
DLC1
9 cancers: BLCA; BRCA; CESC; COAD; KIRP; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.134; TCGA CESC -0.483; TCGA COAD -0.645; TCGA KIRP -0.334; TCGA PAAD -0.224; TCGA PRAD -0.339; TCGA STAD -0.643; TCGA UCEC -0.256
hsa-let-7g-5p
ATP2B4
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.767; TCGA CESC -0.217; TCGA COAD -0.81; TCGA ESCA -0.399; TCGA KIRC -0.122; TCGA KIRP -0.327; TCGA LUSC -0.205; TCGA PRAD -0.969; TCGA SARC -0.622; TCGA STAD -1.007; TCGA UCEC -0.123
hsa-let-7g-5p
PXDN
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.033; TCGA BRCA -0.192; TCGA CESC -0.775; TCGA COAD -0.817; TCGA HNSC -0.315; TCGA KIRC -0.361; TCGA LGG -0.282; TCGA LUAD -0.343; TCGA LUSC -0.549; TCGA PAAD -0.611; TCGA PRAD -0.253; TCGA THCA -0.327; TCGA STAD -0.281; TCGA UCEC -0.637
hsa-let-7g-5p
SYT11
9 cancers: BLCA; COAD; KIRP; OV; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.843; TCGA COAD -1.027; TCGA KIRP -0.233; TCGA OV -0.257; TCGA PRAD -0.591; TCGA SARC -0.356; TCGA THCA -0.156; TCGA STAD -0.725; TCGA UCEC -0.537
hsa-let-7g-5p
MEF2D
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.266; TCGA BRCA -0.118; TCGA COAD -0.176; TCGA KIRC -0.177; TCGA KIRP -0.092; TCGA PRAD -0.214; TCGA SARC -0.169; TCGA STAD -0.234; TCGA UCEC -0.189
hsa-let-7g-5p
XYLT1
9 cancers: BLCA; COAD; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.449; TCGA COAD -0.273; TCGA KIRC -0.136; TCGA KIRP -0.247; TCGA LUSC -0.324; TCGA PAAD -0.419; TCGA PRAD -0.513; TCGA STAD -0.28; TCGA UCEC -0.447
hsa-let-7g-5p
NRK
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.545; TCGA BRCA -0.307; TCGA CESC -0.774; TCGA COAD -1.626; TCGA ESCA -0.472; TCGA PAAD -1.096; TCGA PRAD -0.956; TCGA SARC -1.341; TCGA STAD -1.64; TCGA UCEC -0.715
hsa-let-7g-5p
TMOD2
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.299; TCGA CESC -0.303; TCGA COAD -0.407; TCGA KIRC -0.194; TCGA KIRP -0.306; TCGA PRAD -0.407; TCGA THCA -0.112; TCGA STAD -0.618; TCGA UCEC -0.514
hsa-let-7g-5p
SGCD
9 cancers: BLCA; BRCA; CESC; COAD; LUSC; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -1.743; TCGA BRCA -0.371; TCGA CESC -0.684; TCGA COAD -1.45; TCGA LUSC -0.563; TCGA PAAD -0.757; TCGA PRAD -0.359; TCGA SARC -0.515; TCGA STAD -1.173
hsa-let-7g-5p
ASAP1
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.259; TCGA CESC -0.213; TCGA COAD -0.237; TCGA ESCA -0.219; TCGA KIRC -0.237; TCGA LUAD -0.192; TCGA LUSC -0.114; TCGA PAAD -0.213; TCGA PRAD -0.386; TCGA THCA -0.076; TCGA STAD -0.216; TCGA UCEC -0.314
hsa-let-7g-5p
TAOK1
9 cancers: BLCA; COAD; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.207; TCGA COAD -0.355; TCGA KIRP -0.398; TCGA LUAD -0.161; TCGA LUSC -0.251; TCGA PAAD -0.337; TCGA PRAD -0.867; TCGA SARC -0.429; TCGA STAD -0.171
hsa-let-7g-5p
TECPR2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.278; TCGA BRCA -0.093; TCGA CESC -0.22; TCGA COAD -0.138; TCGA ESCA -0.186; TCGA HNSC -0.083; TCGA LUAD -0.08; TCGA LUSC -0.15; TCGA PRAD -0.232; TCGA SARC -0.225; TCGA STAD -0.34
hsa-let-7g-5p
COL4A1
14 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.458; TCGA CESC -0.522; TCGA COAD -0.481; TCGA HNSC -0.25; TCGA KIRC -0.464; TCGA KIRP -0.208; TCGA LUAD -0.245; TCGA LUSC -0.381; TCGA PAAD -0.598; TCGA PRAD -0.462; TCGA SARC -0.385; TCGA THCA -0.19; TCGA STAD -0.298; TCGA UCEC -0.211
hsa-let-7g-5p
ADAMTS5
12 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.548; TCGA CESC -0.795; TCGA COAD -0.539; TCGA KIRC -0.205; TCGA KIRP -0.806; TCGA LGG -0.476; TCGA LUAD -0.269; TCGA LUSC -0.735; TCGA PAAD -0.533; TCGA PRAD -1.02; TCGA STAD -0.387; TCGA UCEC -0.532
hsa-let-7g-5p
PCYT1B
9 cancers: BLCA; CESC; COAD; ESCA; LGG; OV; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.851; TCGA CESC -0.863; TCGA COAD -1.536; TCGA ESCA -1.131; TCGA LGG -0.117; TCGA OV -0.425; TCGA PRAD -1.117; TCGA SARC -1.119; TCGA STAD -1.391
hsa-let-7g-5p
DUSP1
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.798; TCGA BRCA -0.246; TCGA COAD -0.426; TCGA ESCA -0.308; TCGA KIRC -0.221; TCGA PAAD -0.24; TCGA PRAD -0.44; TCGA STAD -0.553; TCGA UCEC -0.332
hsa-let-7g-5p
IGLON5
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; STAD
miRNATAP
TCGA BLCA -0.641; TCGA COAD -0.846; TCGA ESCA -0.639; TCGA HNSC -0.421; TCGA KIRC -1.311; TCGA LUAD -0.467; TCGA OV -0.817; TCGA PAAD -0.453; TCGA STAD -0.708
hsa-let-7g-5p
TSPAN2
9 cancers: BLCA; CESC; COAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.95; TCGA CESC -0.911; TCGA COAD -1.298; TCGA LUSC -0.565; TCGA PAAD -0.541; TCGA PRAD -0.903; TCGA SARC -1.216; TCGA STAD -1.289; TCGA UCEC -0.987
hsa-let-7g-5p
LSM11
10 cancers: BLCA; CESC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.413; TCGA CESC -0.126; TCGA KIRC -0.094; TCGA KIRP -0.128; TCGA LIHC -0.129; TCGA PAAD -0.215; TCGA PRAD -0.397; TCGA SARC -0.457; TCGA STAD -0.296; TCGA UCEC -0.188
hsa-let-7g-5p
MAP3K2
9 cancers: BLCA; COAD; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.284; TCGA COAD -0.125; TCGA KIRP -0.21; TCGA LUSC -0.254; TCGA PAAD -0.356; TCGA PRAD -0.482; TCGA SARC -0.213; TCGA STAD -0.091; TCGA UCEC -0.139
hsa-let-7g-5p
GNAL
9 cancers: BLCA; COAD; ESCA; LGG; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.241; TCGA COAD -0.979; TCGA ESCA -0.332; TCGA LGG -0.201; TCGA LUSC -0.586; TCGA PRAD -1.22; TCGA SARC -1.051; TCGA STAD -1.255; TCGA UCEC -0.482
hsa-let-7g-5p
SYT1
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; OV; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.326; TCGA BRCA -0.279; TCGA COAD -0.623; TCGA HNSC -0.436; TCGA KIRP -0.694; TCGA LIHC -0.75; TCGA OV -0.248; TCGA PRAD -0.388; TCGA THCA -0.483; TCGA STAD -1.008; TCGA UCEC -0.61
hsa-let-7g-5p
COL1A1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA
miRNATAP
TCGA BLCA -1.094; TCGA BRCA -0.502; TCGA CESC -0.781; TCGA COAD -1.088; TCGA ESCA -0.34; TCGA HNSC -0.487; TCGA KIRC -0.642; TCGA KIRP -0.337; TCGA LUAD -0.57; TCGA LUSC -0.803; TCGA PAAD -0.936; TCGA THCA -0.579
hsa-let-7g-5p
NAB1
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.231; TCGA ESCA -0.146; TCGA HNSC -0.181; TCGA KIRC -0.083; TCGA KIRP -0.287; TCGA LGG -0.099; TCGA LUSC -0.149; TCGA PRAD -0.195; TCGA SARC -0.23; TCGA UCEC -0.269
hsa-let-7g-5p
ATXN1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.678; TCGA BRCA -0.101; TCGA COAD -0.281; TCGA ESCA -0.152; TCGA KIRC -0.142; TCGA KIRP -0.114; TCGA LUSC -0.178; TCGA PAAD -0.434; TCGA PRAD -0.469; TCGA STAD -0.379; TCGA UCEC -0.104
hsa-let-7g-5p
DZIP1
12 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.772; TCGA CESC -0.371; TCGA COAD -1.074; TCGA ESCA -0.596; TCGA LUAD -0.186; TCGA LUSC -0.183; TCGA OV -0.24; TCGA PAAD -0.335; TCGA PRAD -0.608; TCGA THCA -0.237; TCGA STAD -1.008; TCGA UCEC -0.423
hsa-let-7g-5p
CAP1
9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.166; TCGA CESC -0.132; TCGA ESCA -0.127; TCGA HNSC -0.173; TCGA LUSC -0.239; TCGA PAAD -0.184; TCGA PRAD -0.179; TCGA THCA -0.053; TCGA UCEC -0.153
hsa-let-7g-5p
USP47
10 cancers: BLCA; CESC; HNSC; KIRP; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.063; TCGA CESC -0.131; TCGA HNSC -0.127; TCGA KIRP -0.091; TCGA OV -0.066; TCGA PAAD -0.068; TCGA PRAD -0.151; TCGA SARC -0.101; TCGA STAD -0.196; TCGA UCEC -0.119
hsa-let-7g-5p
NUMBL
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.3; TCGA COAD -0.332; TCGA ESCA -0.295; TCGA HNSC -0.234; TCGA KIRC -0.221; TCGA LIHC -0.129; TCGA LUAD -0.225; TCGA THCA -0.117; TCGA STAD -0.517; TCGA UCEC -0.087
hsa-let-7g-5p
ZPLD1
10 cancers: BLCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA BLCA -0.741; TCGA ESCA -0.329; TCGA HNSC -0.605; TCGA KIRP -1.273; TCGA LIHC -0.4; TCGA LUAD -0.342; TCGA LUSC -0.515; TCGA PAAD -0.786; TCGA SARC -0.965; TCGA STAD -0.569
hsa-let-7g-5p
CHSY3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.943; TCGA BRCA -0.231; TCGA CESC -0.55; TCGA COAD -0.706; TCGA ESCA -0.255; TCGA HNSC -0.19; TCGA KIRC -0.432; TCGA LUSC -0.312; TCGA PAAD -0.745; TCGA PRAD -0.228; TCGA THCA -0.102; TCGA STAD -0.242; TCGA UCEC -0.395
hsa-let-7g-5p
SPEG
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.762; TCGA BRCA -0.185; TCGA CESC -0.863; TCGA COAD -1.956; TCGA ESCA -0.677; TCGA HNSC -0.541; TCGA KIRP -0.735; TCGA LUAD -0.329; TCGA PRAD -0.725; TCGA SARC -1.11; TCGA THCA -0.151; TCGA STAD -2.093; TCGA UCEC -1.101
hsa-let-7g-5p
HECTD2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.445; TCGA BRCA -0.103; TCGA CESC -0.308; TCGA COAD -0.518; TCGA ESCA -0.164; TCGA KIRP -0.359; TCGA LGG -0.132; TCGA PAAD -0.253; TCGA PRAD -0.573; TCGA SARC -0.19; TCGA STAD -0.795; TCGA UCEC -0.217
hsa-let-7g-5p
LRRC17
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUSC; OV; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.859; TCGA BRCA -0.568; TCGA COAD -0.831; TCGA ESCA -0.568; TCGA HNSC -0.33; TCGA KIRC -0.416; TCGA LGG -0.232; TCGA LUSC -0.615; TCGA OV -0.23; TCGA PAAD -0.642; TCGA PRAD -0.271; TCGA THCA -0.165; TCGA STAD -0.767
hsa-let-7g-5p
LOXL3
9 cancers: BLCA; COAD; KIRC; LUAD; OV; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.588; TCGA COAD -0.509; TCGA KIRC -0.401; TCGA LUAD -0.188; TCGA OV -0.159; TCGA PAAD -0.457; TCGA PRAD -0.175; TCGA THCA -0.212; TCGA UCEC -0.187
hsa-let-7g-5p
FBXO32
10 cancers: BLCA; CESC; COAD; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.811; TCGA CESC -0.249; TCGA COAD -0.688; TCGA ESCA -0.346; TCGA LUSC -0.359; TCGA PAAD -0.385; TCGA PRAD -0.487; TCGA SARC -0.776; TCGA STAD -1.327; TCGA UCEC -0.516
hsa-let-7g-5p
COL15A1
14 cancers: BLCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.713; TCGA CESC -0.41; TCGA COAD -0.817; TCGA KIRC -0.402; TCGA KIRP -0.378; TCGA LIHC -0.291; TCGA LUAD -0.33; TCGA LUSC -0.558; TCGA PAAD -0.687; TCGA PRAD -0.308; TCGA SARC -0.398; TCGA THCA -0.172; TCGA STAD -0.436; TCGA UCEC -0.267
hsa-let-7g-5p
CHD9
10 cancers: BLCA; CESC; COAD; ESCA; LGG; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.214; TCGA CESC -0.275; TCGA COAD -0.174; TCGA ESCA -0.173; TCGA LGG -0.189; TCGA LUSC -0.139; TCGA PAAD -0.207; TCGA PRAD -0.432; TCGA STAD -0.196; TCGA UCEC -0.16
hsa-let-7g-5p
STYX
9 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUSC; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.202; TCGA CESC -0.129; TCGA ESCA -0.123; TCGA HNSC -0.142; TCGA LGG -0.09; TCGA LUSC -0.15; TCGA SARC -0.113; TCGA STAD -0.118; TCGA UCEC -0.076
hsa-let-7g-5p
GALNT2
9 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; UCEC
miRNATAP
TCGA BLCA -0.135; TCGA ESCA -0.137; TCGA HNSC -0.231; TCGA KIRC -0.161; TCGA LUAD -0.125; TCGA LUSC -0.357; TCGA OV -0.07; TCGA PRAD -0.074; TCGA UCEC -0.064
hsa-let-7g-5p
LRRFIP1
9 cancers: BLCA; CESC; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.167; TCGA CESC -0.158; TCGA HNSC -0.157; TCGA KIRP -0.181; TCGA LUSC -0.257; TCGA PAAD -0.176; TCGA PRAD -0.303; TCGA SARC -0.177; TCGA STAD -0.121
hsa-let-7g-5p
ELOVL4
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; OV; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.928; TCGA CESC -0.895; TCGA COAD -1.023; TCGA ESCA -1.002; TCGA HNSC -0.36; TCGA KIRP -0.435; TCGA LIHC -0.378; TCGA LUAD -0.42; TCGA OV -0.484; TCGA PAAD -0.388; TCGA THCA -0.283; TCGA STAD -1.203; TCGA UCEC -0.793
hsa-let-7g-5p
GRIK2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; OV; PRAD; STAD
miRNATAP
TCGA BLCA -0.441; TCGA BRCA -0.288; TCGA CESC -0.767; TCGA COAD -0.641; TCGA ESCA -0.516; TCGA KIRP -0.902; TCGA LGG -0.489; TCGA LIHC -0.63; TCGA OV -0.267; TCGA PRAD -0.383; TCGA STAD -1.2
hsa-let-7g-5p
COL4A2
14 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.557; TCGA CESC -0.49; TCGA COAD -0.576; TCGA HNSC -0.233; TCGA KIRC -0.421; TCGA KIRP -0.184; TCGA LUAD -0.28; TCGA LUSC -0.323; TCGA PAAD -0.457; TCGA PRAD -0.47; TCGA SARC -0.395; TCGA THCA -0.146; TCGA STAD -0.489; TCGA UCEC -0.243
hsa-let-7g-5p
ANGPTL2
14 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.054; TCGA BRCA -0.274; TCGA CESC -0.464; TCGA COAD -1.119; TCGA KIRC -0.317; TCGA LGG -0.523; TCGA LUAD -0.261; TCGA LUSC -0.481; TCGA OV -0.142; TCGA PAAD -0.448; TCGA PRAD -0.467; TCGA THCA -0.245; TCGA STAD -0.797; TCGA UCEC -0.36
hsa-let-7g-5p
COL4A5
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; OV; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.307; TCGA BRCA -0.443; TCGA CESC -0.894; TCGA ESCA -0.799; TCGA HNSC -0.343; TCGA KIRP -0.775; TCGA LIHC -0.552; TCGA OV -0.152; TCGA PAAD -0.656; TCGA PRAD -0.166; TCGA SARC -1.317; TCGA STAD -1.294
hsa-let-7g-5p
PDGFB
10 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; PAAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.229; TCGA BRCA -0.148; TCGA CESC -0.403; TCGA COAD -0.481; TCGA KIRC -0.206; TCGA LUAD -0.145; TCGA LUSC -0.391; TCGA PAAD -0.258; TCGA THCA -0.141; TCGA UCEC -0.259
hsa-let-7g-5p
P4HA2
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA
miRNATAP
TCGA BLCA -0.445; TCGA BRCA -0.114; TCGA ESCA -0.317; TCGA HNSC -0.48; TCGA KIRC -0.377; TCGA KIRP -0.162; TCGA LIHC -0.207; TCGA LUSC -0.377; TCGA PAAD -0.227; TCGA PRAD -0.242; TCGA THCA -0.267
hsa-let-7g-5p
CALD1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.322; TCGA CESC -0.507; TCGA COAD -1.199; TCGA ESCA -0.302; TCGA HNSC -0.291; TCGA LUAD -0.133; TCGA LUSC -0.466; TCGA PAAD -0.715; TCGA PRAD -0.816; TCGA SARC -0.766; TCGA STAD -1.349; TCGA UCEC -0.468
hsa-let-7g-5p
MMP11
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; THCA
miRNATAP
TCGA BLCA -0.821; TCGA BRCA -0.495; TCGA CESC -0.527; TCGA COAD -0.884; TCGA ESCA -0.375; TCGA HNSC -0.499; TCGA KIRC -0.47; TCGA LIHC -0.53; TCGA LUAD -0.471; TCGA PAAD -0.652; TCGA THCA -0.573
hsa-let-7g-5p
C15orf41
10 cancers: BLCA; CESC; ESCA; LGG; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.134; TCGA CESC -0.215; TCGA ESCA -0.096; TCGA LGG -0.055; TCGA OV -0.097; TCGA PAAD -0.135; TCGA PRAD -0.552; TCGA SARC -0.487; TCGA STAD -0.258; TCGA UCEC -0.122
hsa-let-7g-5p
DKK3
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.644; TCGA BRCA -0.344; TCGA CESC -0.711; TCGA COAD -0.852; TCGA HNSC -0.393; TCGA KIRP -0.41; TCGA LUSC -0.229; TCGA OV -0.176; TCGA PAAD -0.534; TCGA PRAD -0.564; TCGA THCA -0.11; TCGA STAD -0.621; TCGA UCEC -0.448
hsa-let-7g-5p
CYTH3
9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.462; TCGA CESC -0.282; TCGA COAD -0.313; TCGA HNSC -0.201; TCGA KIRP -0.149; TCGA LUSC -0.193; TCGA PAAD -0.405; TCGA STAD -0.386; TCGA UCEC -0.228
hsa-let-7g-5p
HAND2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.69; TCGA BRCA -0.193; TCGA CESC -0.72; TCGA COAD -2.377; TCGA ESCA -1.088; TCGA OV -0.267; TCGA PAAD -0.784; TCGA PRAD -0.802; TCGA SARC -1.088; TCGA STAD -2.207; TCGA UCEC -0.53
hsa-let-7g-5p
DST
13 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.411; TCGA CESC -0.468; TCGA COAD -0.485; TCGA ESCA -0.52; TCGA KIRP -0.181; TCGA LUAD -0.173; TCGA LUSC -0.327; TCGA PAAD -0.379; TCGA PRAD -0.499; TCGA SARC -0.405; TCGA THCA -0.235; TCGA STAD -0.819; TCGA UCEC -0.203
hsa-let-7g-5p
PBX1
10 cancers: BRCA; COAD; KIRP; LGG; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.173; TCGA COAD -0.355; TCGA KIRP -0.203; TCGA LGG -0.067; TCGA OV -0.116; TCGA PAAD -0.178; TCGA PRAD -0.625; TCGA SARC -0.872; TCGA STAD -0.837; TCGA UCEC -0.311
hsa-let-7g-5p
TBKBP1
9 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; OV; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.156; TCGA COAD -0.416; TCGA ESCA -0.147; TCGA LGG -0.094; TCGA LIHC -0.188; TCGA LUAD -0.172; TCGA OV -0.183; TCGA STAD -0.593; TCGA UCEC -0.187
hsa-let-7g-5p
KLF8
10 cancers: BRCA; COAD; ESCA; KIRC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.174; TCGA COAD -0.624; TCGA ESCA -0.615; TCGA KIRC -0.359; TCGA PAAD -0.382; TCGA PRAD -0.553; TCGA SARC -0.667; TCGA THCA -0.184; TCGA STAD -0.869; TCGA UCEC -0.46
hsa-let-7g-5p
TEAD3
10 cancers: BRCA; CESC; ESCA; HNSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.113; TCGA CESC -0.2; TCGA ESCA -0.204; TCGA HNSC -0.157; TCGA PAAD -0.225; TCGA PRAD -0.192; TCGA SARC -0.617; TCGA THCA -0.099; TCGA STAD -0.54; TCGA UCEC -0.178
hsa-let-7g-5p
ETNK2
9 cancers: BRCA; CESC; COAD; ESCA; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.333; TCGA CESC -0.406; TCGA COAD -0.601; TCGA ESCA -0.804; TCGA OV -0.175; TCGA PRAD -0.47; TCGA SARC -0.779; TCGA STAD -0.904; TCGA UCEC -0.243
hsa-let-7g-5p
TMC7
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.126; TCGA CESC -0.407; TCGA HNSC -0.546; TCGA KIRC -0.189; TCGA KIRP -0.244; TCGA LIHC -0.291; TCGA LUSC -0.443; TCGA PAAD -0.335; TCGA PRAD -0.174; TCGA THCA -0.249; TCGA UCEC -0.131
hsa-let-7g-5p
MDFI
14 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA CESC -0.47; TCGA COAD -0.383; TCGA ESCA -0.247; TCGA HNSC -0.722; TCGA KIRC -0.295; TCGA KIRP -0.738; TCGA LGG -0.376; TCGA LIHC -0.407; TCGA LUAD -0.314; TCGA LUSC -0.468; TCGA OV -0.288; TCGA PRAD -0.543; TCGA THCA -0.457; TCGA UCEC -0.402
hsa-let-7g-5p
DLGAP4
9 cancers: CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA CESC -0.13; TCGA ESCA -0.104; TCGA HNSC -0.269; TCGA KIRC -0.169; TCGA LIHC -0.142; TCGA LUAD -0.129; TCGA LUSC -0.183; TCGA THCA -0.115; TCGA STAD -0.188
hsa-let-7g-5p
EXOC6B
10 cancers: CESC; COAD; ESCA; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA CESC -0.366; TCGA COAD -0.284; TCGA ESCA -0.397; TCGA KIRP -0.374; TCGA LUSC -0.227; TCGA PAAD -0.309; TCGA PRAD -0.781; TCGA SARC -0.579; TCGA STAD -0.253; TCGA UCEC -0.167
hsa-let-7g-5p
RBMS1
11 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA CESC -0.252; TCGA COAD -0.79; TCGA ESCA -0.329; TCGA HNSC -0.219; TCGA KIRP -0.099; TCGA LUSC -0.197; TCGA OV -0.098; TCGA PAAD -0.364; TCGA PRAD -0.554; TCGA STAD -0.532; TCGA UCEC -0.463
hsa-let-7g-5p
EPHA4
10 cancers: CESC; COAD; ESCA; HNSC; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA CESC -0.409; TCGA COAD -0.548; TCGA ESCA -0.64; TCGA HNSC -0.264; TCGA LUSC -0.262; TCGA OV -0.204; TCGA PRAD -0.488; TCGA SARC -0.616; TCGA STAD -0.818; TCGA UCEC -0.672
hsa-let-7g-5p
NKIRAS2
10 cancers: CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; OV; SARC; STAD
miRNATAP
TCGA CESC -0.106; TCGA ESCA -0.12; TCGA HNSC -0.097; TCGA KIRC -0.069; TCGA LGG -0.176; TCGA LIHC -0.135; TCGA LUAD -0.145; TCGA OV -0.075; TCGA SARC -0.096; TCGA STAD -0.127
hsa-let-7g-5p
KDM3A
9 cancers: CESC; ESCA; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA CESC -0.164; TCGA ESCA -0.114; TCGA KIRC -0.201; TCGA KIRP -0.148; TCGA LGG -0.135; TCGA PRAD -0.122; TCGA SARC -0.174; TCGA STAD -0.129; TCGA UCEC -0.101
hsa-let-7g-5p
FIGN
10 cancers: COAD; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA COAD -1.271; TCGA LGG -0.161; TCGA LUAD -0.198; TCGA LUSC -0.722; TCGA OV -0.302; TCGA PAAD -0.402; TCGA PRAD -0.434; TCGA SARC -0.727; TCGA STAD -0.811; TCGA UCEC -0.392
hsa-let-7g-5p
VASH2
9 cancers: COAD; LGG; LIHC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA COAD -0.314; TCGA LGG -0.397; TCGA LIHC -0.298; TCGA OV -0.235; TCGA PAAD -0.458; TCGA PRAD -0.266; TCGA THCA -0.199; TCGA STAD -0.249; TCGA UCEC -0.149





Enriched cancer pathways of putative targets