microRNA information: hsa-miR-100-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-100-5p | miRbase |
| Accession: | MIMAT0000098 | miRbase |
| Precursor name: | hsa-mir-100 | miRbase |
| Precursor accession: | MI0000102 | miRbase |
| Symbol: | MIR100 | HGNC |
| RefSeq ID: | NR_029515 | GenBank |
| Sequence: | AACCCGUAGAUCCGAACUUGUG |
Reported expression in cancers: hsa-miR-100-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-100-5p | bladder cancer | downregulation | "Prognostic role of microRNA 100 in patients with b ......" | 26662386 | qPCR |
| hsa-miR-100-5p | breast cancer | downregulation | "Moreover miR-100 favors BrCSC differentiation conv ......" | 25537513 | |
| hsa-miR-100-5p | breast cancer | downregulation | "In this study we found that miR-100 expression was ......" | 26537584 | |
| hsa-miR-100-5p | breast cancer | downregulation | "In this study we examined the role of micro RNA 10 ......" | 26744318 | |
| hsa-miR-100-5p | colorectal cancer | downregulation | "Fewer studies have explored the roles of miR-100 o ......" | 24626817 | qPCR |
| hsa-miR-100-5p | colorectal cancer | downregulation | "Downregulation of microRNA 100 correlates with tum ......" | 25216869 | qPCR |
| hsa-miR-100-5p | colorectal cancer | downregulation | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | RNA-Seq |
| hsa-miR-100-5p | esophageal cancer | downregulation | "Recently microRNA-99 family members such as miR-99 ......" | 23292834 | qPCR |
| hsa-miR-100-5p | esophageal cancer | downregulation | "MicroRNA 100 promotes migration and invasion throu ......" | 25109390 | Reverse transcription PCR; qPCR |
| hsa-miR-100-5p | esophageal cancer | downregulation | "Prognostic value of microRNA 100 in esophageal squ ......" | 25218280 | Reverse transcription PCR |
| hsa-miR-100-5p | gastric cancer | downregulation | "Thus the differential expression of a panel of miR ......" | 26171025 | Microarray; qPCR |
| hsa-miR-100-5p | glioblastoma | downregulation | "microRNA 100 targets SMRT/NCOR2 reduces proliferat ......" | 24244722 | |
| hsa-miR-100-5p | glioblastoma | downregulation | "We investigated the regulatory effects of microRNA ......" | 26604796 | qPCR |
| hsa-miR-100-5p | head and neck cancer | deregulation | "Real-time polymerase chain reaction PCR analysis c ......" | 21560177 | qPCR |
| hsa-miR-100-5p | head and neck cancer | deregulation | "The up-regulation of miR-21 miR-155 miR-130b miR-2 ......" | 22425712 | qPCR |
| hsa-miR-100-5p | head and neck cancer | deregulation | "2012;488:686-91 including 7 consistently up-regula ......" | 24422025 | |
| hsa-miR-100-5p | liver cancer | downregulation | "Because understanding the pathogenesis of viral-as ......" | 18307259 | qPCR |
| hsa-miR-100-5p | liver cancer | downregulation | "Downregulation of microRNA 100 correlates with tum ......" | 23842624 | |
| hsa-miR-100-5p | liver cancer | downregulation | "Here we showed that miR-100 downregulation in HCC ......" | 25361001 | |
| hsa-miR-100-5p | lung squamous cell cancer | deregulation | "Locked nucleic acids miRNA microarray expression p ......" | 20508945 | Microarray |
| hsa-miR-100-5p | lung squamous cell cancer | upregulation | "MiRNA microarray and bioinformatics interpretation ......" | 22937028 | Microarray; qPCR |
| hsa-miR-100-5p | lung squamous cell cancer | downregulation | "Taqman real-time quantitative RT-PCR assay was per ......" | 23151088 | qPCR |
| hsa-miR-100-5p | ovarian cancer | downregulation | "Prognostic implications of microRNA 100 and its fu ......" | 22246341 | qPCR |
| hsa-miR-100-5p | ovarian cancer | downregulation | "The role and expression of miR 100 and miR 203 pro ......" | 27347348 | qPCR |
| hsa-miR-100-5p | prostate cancer | downregulation | "Previous studies have showed that miR-100 is downr ......" | 24805183 | |
| hsa-miR-100-5p | sarcoma | upregulation | "In this study we obtained evidence that miR-100 ac ......" | 24568519 |
Reported cancer pathway affected by hsa-miR-100-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-100-5p | acute myeloid leukemia | cell cycle pathway | "MiR 100 regulates cell differentiation and surviva ......" | 21643017 | |
| hsa-miR-100-5p | breast cancer | mTOR signaling pathway | "miR 100 suppresses IGF2 and inhibits breast tumori ......" | 22926517 | |
| hsa-miR-100-5p | breast cancer | Apoptosis pathway; cell cycle pathway | "The role of miR 100 in regulating apoptosis of bre ......" | 26130569 | |
| hsa-miR-100-5p | breast cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 100 sensitizes luminal A breast cancer ce ......" | 26744318 | |
| hsa-miR-100-5p | cervical and endocervical cancer | Apoptosis pathway | "Reduced miR 100 expression in cervical cancer and ......" | 21636267 | Flow cytometry |
| hsa-miR-100-5p | colorectal cancer | Apoptosis pathway | "MicroRNA 100 regulates SW620 colorectal cancer cel ......" | 24626817 | |
| hsa-miR-100-5p | colorectal cancer | Apoptosis pathway | "Role of miR 100 in the radioresistance of colorect ......" | 25973296 | |
| hsa-miR-100-5p | colorectal cancer | Apoptosis pathway | "Expression of microRNA 100 and its relation with p ......" | 26714601 | |
| hsa-miR-100-5p | esophageal cancer | Apoptosis pathway; mTOR signaling pathway | "Recently microRNA-99 family members such as miR-99 ......" | 23292834 | Western blot; Luciferase |
| hsa-miR-100-5p | esophageal cancer | Apoptosis pathway | "MicroRNA 100 promotes migration and invasion throu ......" | 25109390 | |
| hsa-miR-100-5p | gastric cancer | Apoptosis pathway | "The role of miR 100 mediated Notch pathway in apop ......" | 25703026 | |
| hsa-miR-100-5p | head and neck cancer | Apoptosis pathway | "The up-regulation of miR-21 miR-155 miR-130b miR-2 ......" | 22425712 | |
| hsa-miR-100-5p | liver cancer | Apoptosis pathway | "Downregulation of microRNA 100 correlates with tum ......" | 23842624 | |
| hsa-miR-100-5p | lung cancer | Apoptosis pathway | "MiR 100 resensitizes docetaxel resistant human lun ......" | 22120675 | |
| hsa-miR-100-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 100 is a potential molecular marker of no ......" | 23151088 | Luciferase |
| hsa-miR-100-5p | ovarian cancer | mTOR signaling pathway | "A link between mir 100 and FRAP1/mTOR in clear cel ......" | 20081105 | |
| hsa-miR-100-5p | ovarian cancer | Apoptosis pathway; cell cycle pathway | "miR 100 resensitizes resistant epithelial ovarian ......" | 27748936 | |
| hsa-miR-100-5p | prostate cancer | Epithelial mesenchymal transition pathway | "Loss of miR 100 enhances migration invasion epithe ......" | 24805183 | Colony formation; Luciferase |
| hsa-miR-100-5p | sarcoma | Apoptosis pathway | "MiR 100 Inhibits Osteosarcoma Cell Proliferation M ......" | 26306402 |
Reported cancer prognosis affected by hsa-miR-100-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-100-5p | acute myeloid leukemia | poor survival; differentiation; staging | "MiR 100 regulates cell differentiation and surviva ......" | 21643017 | |
| hsa-miR-100-5p | bladder cancer | worse prognosis; staging; progression; recurrence | "Reduced expression of microRNA 100 confers unfavor ......" | 23173870 | Colony formation |
| hsa-miR-100-5p | bladder cancer | poor survival | "Hypoxia regulates FGFR3 expression via HIF 1α and ......" | 23778527 | Western blot |
| hsa-miR-100-5p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
| hsa-miR-100-5p | bladder cancer | staging; worse prognosis | "Prognostic role of microRNA 100 in patients with b ......" | 26662386 | |
| hsa-miR-100-5p | bladder cancer | worse prognosis | "Circulating microRNAs miR 92a miR 100 and miR 143 ......" | 26916216 | |
| hsa-miR-100-5p | bladder cancer | drug resistance | "Focusing on the major obstacle regarding MIBC pati ......" | 27586262 | |
| hsa-miR-100-5p | breast cancer | tumorigenesis; poor survival | "miR 100 suppresses IGF2 and inhibits breast tumori ......" | 22926517 | |
| hsa-miR-100-5p | breast cancer | drug resistance | "In present study miRNA expression profiles of MCF- ......" | 23994196 | |
| hsa-miR-100-5p | breast cancer | differentiation; metastasis; poor survival | "Here we report evidence implicating the miR100 in ......" | 25217527 | |
| hsa-miR-100-5p | breast cancer | differentiation; poor survival | "By promoting cell differentiation miR 100 sensitiz ......" | 25537513 | |
| hsa-miR-100-5p | breast cancer | tumorigenesis; poor survival | "MicroRNA 100 sensitizes luminal A breast cancer ce ......" | 26744318 | |
| hsa-miR-100-5p | cervical and endocervical cancer | tumorigenesis | "Reduced miR 100 expression in cervical cancer and ......" | 21636267 | Flow cytometry |
| hsa-miR-100-5p | colon cancer | metastasis | "Differential expression of microRNAs in twenty pai ......" | 25421775 | |
| hsa-miR-100-5p | colorectal cancer | progression; worse prognosis; tumorigenesis; staging; metastasis; tumor size; poor survival | "Downregulation of microRNA 100 correlates with tum ......" | 25216869 | |
| hsa-miR-100-5p | colorectal cancer | drug resistance | "Role of miR 100 in the radioresistance of colorect ......" | 25973296 | |
| hsa-miR-100-5p | colorectal cancer | worse prognosis; metastasis; staging; differentiation; poor survival | "Expression of microRNA 100 and its relation with p ......" | 26714601 | |
| hsa-miR-100-5p | colorectal cancer | worse prognosis | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | |
| hsa-miR-100-5p | endometrial cancer | drug resistance | "Expression levels of ERα and PR and their respons ......" | 21472251 | |
| hsa-miR-100-5p | endometrial cancer | poor survival | "Deregulation of miR 100 miR 99a and miR 199b in ti ......" | 22920721 | |
| hsa-miR-100-5p | esophageal cancer | malignant trasformation | "Recently microRNA-99 family members such as miR-99 ......" | 23292834 | Western blot; Luciferase |
| hsa-miR-100-5p | esophageal cancer | metastasis; differentiation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
| hsa-miR-100-5p | esophageal cancer | staging | "Five polymorphisms miR-146a rs2910164 miR-196a2 rs ......" | 24288122 | |
| hsa-miR-100-5p | esophageal cancer | metastasis; poor survival | "Markedly upregulated miRNAs in ESCC and some miRNA ......" | 24651474 | |
| hsa-miR-100-5p | esophageal cancer | metastasis; cell migration | "MicroRNA 100 promotes migration and invasion throu ......" | 25109390 | |
| hsa-miR-100-5p | esophageal cancer | progression; tumorigenesis; poor survival; staging; metastasis; worse prognosis | "Prognostic value of microRNA 100 in esophageal squ ......" | 25218280 | |
| hsa-miR-100-5p | gastric cancer | progression | "353 gastric samples from two independent subsets o ......" | 20022810 | |
| hsa-miR-100-5p | gastric cancer | metastasis; progression | "Expression of microRNA 100 in human gastric cancer ......" | 23611267 | |
| hsa-miR-100-5p | gastric cancer | staging; differentiation; tumor size | "In this study we selected three novel miRNAs i.e m ......" | 25367852 | |
| hsa-miR-100-5p | gastric cancer | drug resistance | "The role of miR 100 mediated Notch pathway in apop ......" | 25703026 | |
| hsa-miR-100-5p | gastric cancer | staging; metastasis; differentiation | "Thus the differential expression of a panel of miR ......" | 26171025 | |
| hsa-miR-100-5p | gastric cancer | metastasis | "C/EBPα induced miR 100 expression suppresses tumo ......" | 26404754 | |
| hsa-miR-100-5p | glioblastoma | poor survival | "microRNA 100 targets SMRT/NCOR2 reduces proliferat ......" | 24244722 | |
| hsa-miR-100-5p | kidney renal cell cancer | worse prognosis; progression; tumorigenesis; staging; metastasis; poor survival | "Overexpression of microRNA 100 predicts an unfavor ......" | 23378187 | |
| hsa-miR-100-5p | kidney renal cell cancer | worse prognosis | "We found that elevated expression of miR-21 miR-12 ......" | 26416448 | |
| hsa-miR-100-5p | liver cancer | malignant trasformation; worse prognosis | "Because understanding the pathogenesis of viral-as ......" | 18307259 | |
| hsa-miR-100-5p | liver cancer | progression; worse prognosis | "Downregulation of microRNA 100 correlates with tum ......" | 23842624 | |
| hsa-miR-100-5p | liver cancer | metastasis; staging; poor survival; differentiation; recurrence | "Downregulation of microRNA 100 enhances the ICMT R ......" | 25361001 | |
| hsa-miR-100-5p | liver cancer | metastasis | "MicroRNAs miR 125b and miR 100 suppress metastasis ......" | 27577856 | |
| hsa-miR-100-5p | lung cancer | drug resistance | "MiR 100 resensitizes docetaxel resistant human lun ......" | 22120675 | |
| hsa-miR-100-5p | lung cancer | drug resistance | "This resistance is associated with the increase in ......" | 26080425 | |
| hsa-miR-100-5p | lung squamous cell cancer | worse prognosis; poor survival; malignant trasformation | "MiRNA microarray and bioinformatics interpretation ......" | 22937028 | |
| hsa-miR-100-5p | lung squamous cell cancer | worse prognosis; staging; metastasis; poor survival | "MicroRNA 100 is a potential molecular marker of no ......" | 23151088 | Luciferase |
| hsa-miR-100-5p | lung squamous cell cancer | poor survival; drug resistance | "Downregulation of HOXA1 gene affects small cell lu ......" | 24559685 | Luciferase |
| hsa-miR-100-5p | ovarian cancer | poor survival; staging | "Prognostic implications of microRNA 100 and its fu ......" | 22246341 | |
| hsa-miR-100-5p | ovarian cancer | drug resistance | "Expression of microRNA 100 and its correlation wit ......" | 26607088 | |
| hsa-miR-100-5p | ovarian cancer | staging; poor survival; progression; worse prognosis | "The role and expression of miR 100 and miR 203 pro ......" | 27347348 | |
| hsa-miR-100-5p | pancreatic cancer | malignant trasformation | "miR-148a/b and miR-375 expression were found decre ......" | 21738581 | |
| hsa-miR-100-5p | pancreatic cancer | metastasis | "MicroRNA 100 regulates IGF1 receptor expression in ......" | 23373509 | Western blot |
| hsa-miR-100-5p | pancreatic cancer | staging | "Based on relevance to cancer a seven-miRNA signatu ......" | 25184537 | |
| hsa-miR-100-5p | pancreatic cancer | staging | "In addition from 10 to 50 weeks of age stage-speci ......" | 26516699 | |
| hsa-miR-100-5p | prostate cancer | metastasis | "Change in expression of miR let7c miR 100 and miR ......" | 19372056 | |
| hsa-miR-100-5p | prostate cancer | recurrence; poor survival; tumorigenesis | "MicroRNA 100 expression is independently related t ......" | 21255804 | |
| hsa-miR-100-5p | prostate cancer | recurrence; progression | "Conversely higher levels of miR-100 are related to ......" | 23778488 | Western blot |
| hsa-miR-100-5p | prostate cancer | metastasis | "Loss of miR 100 enhances migration invasion epithe ......" | 24805183 | Colony formation; Luciferase |
| hsa-miR-100-5p | sarcoma | drug resistance | "MicroRNA 100 resensitizes resistant chondrosarcoma ......" | 24568519 | |
| hsa-miR-100-5p | thyroid cancer | malignant trasformation | "A miRNA array was used to identify differentially ......" | 22006248 |
Reported gene related to hsa-miR-100-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-100-5p | breast cancer | MTOR | "MiR-100 has also been shown to suppress other prot ......" | 22926517 |
| hsa-miR-100-5p | breast cancer | MTOR | "MicroRNA 100 sensitizes luminal A breast cancer ce ......" | 26744318 |
| hsa-miR-100-5p | esophageal cancer | MTOR | "In conclusion these results indicated that miR-99a ......" | 23292834 |
| hsa-miR-100-5p | esophageal cancer | MTOR | "We further demonstrated that miR-100 directly targ ......" | 25109390 |
| hsa-miR-100-5p | liver cancer | MTOR | "MicroRNA 100 promotes the autophagy of hepatocellu ......" | 25026290 |
| hsa-miR-100-5p | ovarian cancer | MTOR | "Overexpression of mir-100 inhibited mTOR signaling ......" | 20081105 |
| hsa-miR-100-5p | prostate cancer | MTOR | "In PC3 cells mTOR expression was decreased by miR- ......" | 23778488 |
| hsa-miR-100-5p | sarcoma | MTOR | "MicroRNA 100 resensitizes resistant chondrosarcoma ......" | 24568519 |
| hsa-miR-100-5p | breast cancer | PLK1 | "Here we show that miR-100 inhibits maintenance and ......" | 25537513 |
| hsa-miR-100-5p | cervical and endocervical cancer | PLK1 | "Reduced miR 100 expression in cervical cancer and ......" | 21636267 |
| hsa-miR-100-5p | liver cancer | PLK1 | "In HCC tissues miR-100 expression was inversely co ......" | 23842624 |
| hsa-miR-100-5p | lung cancer | PLK1 | "MiR 100 resensitizes docetaxel resistant human lun ......" | 22120675 |
| hsa-miR-100-5p | lung squamous cell cancer | PLK1 | "MicroRNA 100 is a potential molecular marker of no ......" | 23151088 |
| hsa-miR-100-5p | ovarian cancer | PLK1 | "Together these results suggest that low miR-100 ex ......" | 22246341 |
| hsa-miR-100-5p | bladder cancer | FGFR3 | "Hypoxia regulates FGFR3 expression via HIF 1α and ......" | 23778527 |
| hsa-miR-100-5p | glioblastoma | FGFR3 | "Overexpression of miR 100 inhibits cell proliferat ......" | 26604796 |
| hsa-miR-100-5p | pancreatic cancer | FGFR3 | "MicroRNA 100 regulates pancreatic cancer cells gro ......" | 25344675 |
| hsa-miR-100-5p | sarcoma | FGFR3 | "Overexpression of miR 100 inhibits growth of osteo ......" | 26018508 |
| hsa-miR-100-5p | prostate cancer | AGO2 | "Loss of miR 100 enhances migration invasion epithe ......" | 24805183 |
| hsa-miR-100-5p | liver cancer | ANGPT2 | "Taken together our findings imply that miR-125b an ......" | 27577856 |
| hsa-miR-100-5p | liver cancer | ATG7 | "Furthermore miR-100 overexpression caused massive ......" | 25026290 |
| hsa-miR-100-5p | gastric cancer | CEBPA | "Our results also showed that the transcription fac ......" | 26404754 |
| hsa-miR-100-5p | acute myeloid leukemia | CTDSPL | "MiR 100 regulates cell differentiation and surviva ......" | 21643017 |
| hsa-miR-100-5p | sarcoma | CYR61 | "MicroRNA 100 inhibits osteosarcoma cell proliferat ......" | 24317814 |
| hsa-miR-100-5p | endometrial cancer | ESR1 | "Hsa-miR-100 was significantly down-regulated in th ......" | 21472251 |
| hsa-miR-100-5p | sarcoma | HELLS | "Moreover our results further revealed that express ......" | 24317814 |
| hsa-miR-100-5p | lung squamous cell cancer | HOXA1 | "Downregulation of HOXA1 gene affects small cell lu ......" | 24559685 |
| hsa-miR-100-5p | gastric cancer | HS3ST2 | "The results presented that antagonism of miR-100 i ......" | 25703026 |
| hsa-miR-100-5p | liver cancer | ICMT | "Downregulation of microRNA 100 enhances the ICMT R ......" | 25361001 |
| hsa-miR-100-5p | pancreatic cancer | IGF1 | "MicroRNA 100 regulates IGF1 receptor expression in ......" | 23373509 |
| hsa-miR-100-5p | sarcoma | IGF1R | "MiR 100 Inhibits Osteosarcoma Cell Proliferation M ......" | 26306402 |
| hsa-miR-100-5p | breast cancer | IGF2 | "miR 100 suppresses IGF2 and inhibits breast tumori ......" | 22926517 |
| hsa-miR-100-5p | prostate cancer | KLF4 | "Here we report that miR-100 negatively regulated m ......" | 24805183 |
| hsa-miR-100-5p | colon cancer | LGR5 | "MicroRNA 100 functions as a tumor suppressor by in ......" | 25483280 |
| hsa-miR-100-5p | pancreatic cancer | MIA | "Lentivirual vector containing miR-100 mimics lv-mi ......" | 25344675 |
| hsa-miR-100-5p | breast cancer | MTMR3 | "Antagonism of miR-100 in SK-BR-3 cells increased t ......" | 26130569 |
| hsa-miR-100-5p | ovarian cancer | MUC16 | "Low miR-100 expression was found to be closely cor ......" | 22246341 |
| hsa-miR-100-5p | prostate cancer | MYC | "Here we report that miR-100 negatively regulated m ......" | 24805183 |
| hsa-miR-100-5p | prostate cancer | NR3C1 | "Strikingly treatment of prostate cells with the gl ......" | 27340920 |
| hsa-miR-100-5p | cervical and endocervical cancer | PDXP | "The expression of miR-100 was examined by quantita ......" | 21636267 |
| hsa-miR-100-5p | bladder cancer | PTCRA | "miR-100 was under expressed in 100% of low grade p ......" | 22999546 |
| hsa-miR-100-5p | liver cancer | RAC1 | "Downregulation of microRNA 100 enhances the ICMT R ......" | 25361001 |
| hsa-miR-100-5p | colorectal cancer | RAP1B | "MicroRNA 100 regulates SW620 colorectal cancer cel ......" | 24626817 |
| hsa-miR-100-5p | lung squamous cell cancer | SCLC1 | "The expression of HOXA1 in SCLC tissues correlated ......" | 24559685 |
| hsa-miR-100-5p | acute myeloid leukemia | TP53 | "Profiling microRNA miRNA expression delineated TP5 ......" | 22810507 |
| hsa-miR-100-5p | gastric cancer | ZBTB7A | "C/EBPα induced miR 100 expression suppresses tumo ......" | 26404754 |
| hsa-miR-100-5p | prostate cancer | ZNF135 | "Expression analysis of 14 miRNAs was carried out u ......" | 19372056 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-100-5p | ANAPC11 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.05; TCGA BRCA -0.3; TCGA CESC -0.07; TCGA COAD -0.085; TCGA ESCA -0.067; TCGA HNSC -0.104; TCGA LIHC -0.118; TCGA LUAD -0.066; TCGA LUSC -0.24; TCGA OV -0.129; TCGA PAAD -0.293; TCGA PRAD -0.277; TCGA THCA -0.107; TCGA UCEC -0.136 |
hsa-miR-100-5p | CBX3 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.081; TCGA BRCA -0.234; TCGA COAD -0.066; TCGA ESCA -0.128; TCGA HNSC -0.125; TCGA KIRP -0.082; TCGA LGG -0.053; TCGA LIHC -0.149; TCGA LUSC -0.251; TCGA PRAD -0.234; TCGA STAD -0.198 |
hsa-miR-100-5p | COX5A | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.1; TCGA BRCA -0.202; TCGA CESC -0.063; TCGA COAD -0.21; TCGA ESCA -0.118; TCGA LUAD -0.059; TCGA LUSC -0.246; TCGA OV -0.082; TCGA PAAD -0.13; TCGA PRAD -0.267; TCGA SARC -0.084; TCGA THCA -0.101; TCGA STAD -0.211; TCGA UCEC -0.155 |
hsa-miR-100-5p | EWSR1 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.064; TCGA BRCA -0.08; TCGA COAD -0.091; TCGA HNSC -0.076; TCGA KIRP -0.068; TCGA LIHC -0.084; TCGA LUSC -0.123; TCGA PAAD -0.096; TCGA PRAD -0.089; TCGA STAD -0.107 |
hsa-miR-100-5p | FGFR3 | 9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUSC; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.392; TCGA BRCA -0.235; TCGA COAD -0.162; TCGA HNSC -0.178; TCGA KIRC -0.314; TCGA LIHC -0.27; TCGA LUSC -0.326; TCGA STAD -0.244; TCGA UCEC -0.149 |
hsa-miR-100-5p | H2AFY | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.069; TCGA BRCA -0.273; TCGA CESC -0.058; TCGA COAD -0.114; TCGA ESCA -0.075; TCGA HNSC -0.067; TCGA LIHC -0.172; TCGA LUAD -0.065; TCGA LUSC -0.063; TCGA OV -0.098; TCGA PAAD -0.077; TCGA PRAD -0.14; TCGA SARC -0.087; TCGA THCA -0.153; TCGA STAD -0.146; TCGA UCEC -0.085 |
hsa-miR-100-5p | H3F3A | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.138; TCGA BRCA -0.248; TCGA COAD -0.064; TCGA ESCA -0.09; TCGA KIRP -0.113; TCGA LGG -0.081; TCGA LIHC -0.111; TCGA LUAD -0.125; TCGA LUSC -0.163; TCGA PRAD -0.278; TCGA UCEC -0.11 |
hsa-miR-100-5p | HMGN1 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUSC; OV; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.075; TCGA BRCA -0.203; TCGA COAD -0.134; TCGA HNSC -0.1; TCGA KIRP -0.131; TCGA LIHC -0.163; TCGA LUSC -0.11; TCGA OV -0.051; TCGA PRAD -0.149; TCGA STAD -0.197; TCGA UCEC -0.065 |
hsa-miR-100-5p | HSPA14 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.063; TCGA BRCA -0.165; TCGA CESC -0.052; TCGA COAD -0.096; TCGA ESCA -0.152; TCGA LGG -0.093; TCGA LIHC -0.09; TCGA LUAD -0.072; TCGA LUSC -0.157; TCGA OV -0.056; TCGA PRAD -0.083; TCGA SARC -0.05; TCGA STAD -0.19; TCGA UCEC -0.065 |
hsa-miR-100-5p | MAPK6 | 11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.118; TCGA COAD -0.115; TCGA ESCA -0.109; TCGA HNSC -0.125; TCGA LUAD -0.081; TCGA LUSC -0.279; TCGA OV -0.061; TCGA PRAD -0.148; TCGA SARC -0.111; TCGA STAD -0.208; TCGA UCEC -0.053 |
hsa-miR-100-5p | MRPS33 | 10 cancers: BLCA; BRCA; COAD; HNSC; LUSC; OV; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.065; TCGA BRCA -0.193; TCGA COAD -0.123; TCGA HNSC -0.057; TCGA LUSC -0.262; TCGA OV -0.078; TCGA PAAD -0.179; TCGA PRAD -0.291; TCGA THCA -0.051; TCGA STAD -0.118 |
hsa-miR-100-5p | NDUFA2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.082; TCGA BRCA -0.258; TCGA CESC -0.061; TCGA COAD -0.149; TCGA ESCA -0.069; TCGA LUSC -0.068; TCGA OV -0.114; TCGA PAAD -0.243; TCGA PRAD -0.205; TCGA THCA -0.098; TCGA STAD -0.08; TCGA UCEC -0.129 |
hsa-miR-100-5p | NDUFA9 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.054; TCGA BRCA -0.152; TCGA CESC -0.067; TCGA COAD -0.184; TCGA ESCA -0.096; TCGA HNSC -0.055; TCGA LUSC -0.179; TCGA PAAD -0.214; TCGA PRAD -0.149; TCGA THCA -0.141; TCGA STAD -0.193; TCGA UCEC -0.089 |
hsa-miR-100-5p | NDUFC2 | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; THCA | miRNAWalker2 validate | TCGA BLCA -0.085; TCGA BRCA -0.177; TCGA COAD -0.061; TCGA HNSC -0.054; TCGA LUAD -0.056; TCGA LUSC -0.113; TCGA PAAD -0.16; TCGA PRAD -0.179; TCGA THCA -0.093 |
hsa-miR-100-5p | NOP2 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.089; TCGA BRCA -0.2; TCGA COAD -0.144; TCGA ESCA -0.155; TCGA HNSC -0.079; TCGA LGG -0.061; TCGA LIHC -0.116; TCGA LUSC -0.329; TCGA PAAD -0.104; TCGA PRAD -0.238; TCGA STAD -0.23; TCGA UCEC -0.1 |
hsa-miR-100-5p | NSF | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.106; TCGA BRCA -0.186; TCGA CESC -0.082; TCGA COAD -0.071; TCGA ESCA -0.135; TCGA LUAD -0.055; TCGA LUSC -0.119; TCGA OV -0.063; TCGA PRAD -0.202; TCGA THCA -0.102; TCGA STAD -0.171; TCGA UCEC -0.079 |
hsa-miR-100-5p | ORMDL1 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.05; TCGA BRCA -0.08; TCGA COAD -0.063; TCGA ESCA -0.058; TCGA KIRP -0.121; TCGA LIHC -0.055; TCGA LUAD -0.087; TCGA LUSC -0.123; TCGA PAAD -0.075; TCGA PRAD -0.165; TCGA STAD -0.08 |
hsa-miR-100-5p | PANK3 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.092; TCGA BRCA -0.108; TCGA COAD -0.112; TCGA ESCA -0.132; TCGA HNSC -0.055; TCGA LUSC -0.156; TCGA PRAD -0.123; TCGA SARC -0.096; TCGA STAD -0.192; TCGA UCEC -0.061 |
hsa-miR-100-5p | PSMG2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.07; TCGA BRCA -0.085; TCGA COAD -0.138; TCGA ESCA -0.066; TCGA HNSC -0.089; TCGA LGG -0.052; TCGA LUAD -0.05; TCGA LUSC -0.109; TCGA OV -0.088; TCGA PRAD -0.099; TCGA STAD -0.057 |
hsa-miR-100-5p | RPL19 | 10 cancers: BLCA; BRCA; COAD; LGG; LIHC; LUSC; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.087; TCGA BRCA -0.115; TCGA COAD -0.084; TCGA LGG -0.118; TCGA LIHC -0.13; TCGA LUSC -0.132; TCGA PAAD -0.166; TCGA PRAD -0.243; TCGA THCA -0.055; TCGA STAD -0.081 |
hsa-miR-100-5p | RPS15 | 12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.062; TCGA BRCA -0.09; TCGA COAD -0.111; TCGA HNSC -0.064; TCGA LGG -0.136; TCGA LIHC -0.151; TCGA LUSC -0.14; TCGA PAAD -0.333; TCGA PRAD -0.244; TCGA THCA -0.069; TCGA STAD -0.096; TCGA UCEC -0.074 |
hsa-miR-100-5p | RRM2 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.125; TCGA BRCA -0.695; TCGA CESC -0.203; TCGA COAD -0.25; TCGA ESCA -0.259; TCGA HNSC -0.201; TCGA LGG -0.245; TCGA LIHC -0.47; TCGA LUAD -0.164; TCGA LUSC -0.604; TCGA OV -0.187; TCGA PRAD -0.738; TCGA SARC -0.123; TCGA THCA -0.353; TCGA STAD -0.534; TCGA UCEC -0.399 |
hsa-miR-100-5p | SRD5A3 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; OV; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.142; TCGA BRCA -0.242; TCGA COAD -0.122; TCGA ESCA -0.14; TCGA HNSC -0.067; TCGA OV -0.17; TCGA PRAD -0.133; TCGA THCA -0.135; TCGA STAD -0.225; TCGA UCEC -0.18 |
hsa-miR-100-5p | TEX264 | 10 cancers: BLCA; BRCA; COAD; ESCA; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.056; TCGA BRCA -0.182; TCGA COAD -0.106; TCGA ESCA -0.095; TCGA OV -0.114; TCGA PAAD -0.189; TCGA PRAD -0.171; TCGA THCA -0.078; TCGA STAD -0.143; TCGA UCEC -0.062 |
hsa-miR-100-5p | UBA2 | 10 cancers: BLCA; ESCA; HNSC; LIHC; LUSC; OV; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.058; TCGA ESCA -0.077; TCGA HNSC -0.063; TCGA LIHC -0.113; TCGA LUSC -0.242; TCGA OV -0.06; TCGA PRAD -0.132; TCGA SARC -0.122; TCGA THCA -0.063; TCGA STAD -0.065 |
hsa-miR-100-5p | VPS45 | 9 cancers: BLCA; BRCA; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.071; TCGA BRCA -0.15; TCGA LIHC -0.106; TCGA LUAD -0.058; TCGA LUSC -0.136; TCGA OV -0.064; TCGA PRAD -0.051; TCGA SARC -0.117; TCGA UCEC -0.067 |
hsa-miR-100-5p | YWHAE | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.088; TCGA BRCA -0.094; TCGA COAD -0.121; TCGA HNSC -0.051; TCGA KIRP -0.086; TCGA LUSC -0.102; TCGA PAAD -0.101; TCGA PRAD -0.165; TCGA THCA -0.086; TCGA STAD -0.165 |
hsa-miR-100-5p | ALG3 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.283; TCGA CESC -0.129; TCGA COAD -0.119; TCGA ESCA -0.124; TCGA HNSC -0.149; TCGA LIHC -0.096; TCGA LUAD -0.08; TCGA LUSC -0.423; TCGA OV -0.102; TCGA PAAD -0.126; TCGA PRAD -0.207; TCGA THCA -0.082; TCGA STAD -0.202; TCGA UCEC -0.144 |
hsa-miR-100-5p | ATP1B3 | 10 cancers: BRCA; COAD; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.068; TCGA COAD -0.112; TCGA HNSC -0.224; TCGA LIHC -0.267; TCGA LUSC -0.394; TCGA PRAD -0.06; TCGA SARC -0.081; TCGA THCA -0.101; TCGA STAD -0.103; TCGA UCEC -0.084 |
hsa-miR-100-5p | ATP5A1 | 9 cancers: BRCA; COAD; LGG; LUSC; OV; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.068; TCGA COAD -0.162; TCGA LGG -0.058; TCGA LUSC -0.064; TCGA OV -0.075; TCGA PAAD -0.1; TCGA PRAD -0.081; TCGA THCA -0.093; TCGA STAD -0.149 |
hsa-miR-100-5p | DNMT1 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.18; TCGA CESC -0.082; TCGA COAD -0.099; TCGA ESCA -0.085; TCGA HNSC -0.097; TCGA LGG -0.102; TCGA LIHC -0.201; TCGA LUAD -0.079; TCGA LUSC -0.207; TCGA PRAD -0.082; TCGA SARC -0.109; TCGA THCA -0.051; TCGA STAD -0.186; TCGA UCEC -0.096 |
hsa-miR-100-5p | EIF5A | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.168; TCGA CESC -0.055; TCGA COAD -0.189; TCGA ESCA -0.081; TCGA HNSC -0.113; TCGA LGG -0.051; TCGA LIHC -0.083; TCGA LUSC -0.177; TCGA PAAD -0.129; TCGA PRAD -0.217; TCGA THCA -0.089; TCGA STAD -0.193; TCGA UCEC -0.116 |
hsa-miR-100-5p | EIF5AL1 | 10 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUSC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.145; TCGA CESC -0.063; TCGA COAD -0.17; TCGA HNSC -0.093; TCGA LIHC -0.06; TCGA LUSC -0.182; TCGA PRAD -0.199; TCGA THCA -0.084; TCGA STAD -0.308; TCGA UCEC -0.124 |
hsa-miR-100-5p | FARSB | 10 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.137; TCGA COAD -0.135; TCGA ESCA -0.145; TCGA LGG -0.068; TCGA LIHC -0.132; TCGA LUAD -0.054; TCGA LUSC -0.21; TCGA PRAD -0.225; TCGA THCA -0.074; TCGA STAD -0.176 |
hsa-miR-100-5p | GNG5 | 11 cancers: BRCA; COAD; ESCA; HNSC; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.171; TCGA COAD -0.11; TCGA ESCA -0.09; TCGA HNSC -0.062; TCGA LIHC -0.112; TCGA OV -0.089; TCGA PRAD -0.1; TCGA SARC -0.113; TCGA THCA -0.084; TCGA STAD -0.118; TCGA UCEC -0.05 |
hsa-miR-100-5p | KPNA2 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.41; TCGA CESC -0.133; TCGA COAD -0.171; TCGA ESCA -0.172; TCGA HNSC -0.184; TCGA LIHC -0.295; TCGA LUAD -0.128; TCGA LUSC -0.439; TCGA OV -0.159; TCGA PRAD -0.444; TCGA SARC -0.135; TCGA THCA -0.157; TCGA STAD -0.337; TCGA UCEC -0.205 |
hsa-miR-100-5p | PLK1 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BRCA -0.659; TCGA CESC -0.17; TCGA COAD -0.2; TCGA ESCA -0.228; TCGA HNSC -0.212; TCGA LGG -0.152; TCGA LIHC -0.609; TCGA LUAD -0.151; TCGA LUSC -0.639; TCGA OV -0.143; TCGA PRAD -0.707; TCGA SARC -0.128; TCGA STAD -0.448; TCGA UCEC -0.293 |
hsa-miR-100-5p | PRDX1 | 10 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUSC; OV; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.245; TCGA CESC -0.064; TCGA COAD -0.109; TCGA HNSC -0.07; TCGA LIHC -0.106; TCGA LUSC -0.251; TCGA OV -0.092; TCGA PRAD -0.14; TCGA STAD -0.198; TCGA UCEC -0.131 |
hsa-miR-100-5p | PSMA2 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PRAD; STAD | miRNAWalker2 validate | TCGA BRCA -0.159; TCGA CESC -0.056; TCGA COAD -0.082; TCGA ESCA -0.074; TCGA HNSC -0.111; TCGA LUSC -0.19; TCGA OV -0.081; TCGA PRAD -0.144; TCGA STAD -0.123 |
hsa-miR-100-5p | PSMA5 | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.241; TCGA CESC -0.086; TCGA COAD -0.139; TCGA ESCA -0.107; TCGA HNSC -0.122; TCGA LIHC -0.095; TCGA LUSC -0.099; TCGA OV -0.106; TCGA PRAD -0.177; TCGA SARC -0.076; TCGA THCA -0.129; TCGA STAD -0.187; TCGA UCEC -0.092 |
hsa-miR-100-5p | RAD51C | 12 cancers: BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | miRNAWalker2 validate | TCGA BRCA -0.184; TCGA CESC -0.083; TCGA COAD -0.088; TCGA HNSC -0.057; TCGA KIRP -0.056; TCGA LIHC -0.11; TCGA LUAD -0.083; TCGA LUSC -0.247; TCGA OV -0.068; TCGA PAAD -0.101; TCGA PRAD -0.097; TCGA SARC -0.097 |
hsa-miR-100-5p | RARS | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; STAD | miRNAWalker2 validate | TCGA BRCA -0.124; TCGA CESC -0.053; TCGA COAD -0.109; TCGA ESCA -0.076; TCGA HNSC -0.064; TCGA LIHC -0.068; TCGA LUSC -0.091; TCGA PRAD -0.17; TCGA STAD -0.165 |
hsa-miR-100-5p | SET | 11 cancers: BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUSC; OV; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.131; TCGA COAD -0.104; TCGA ESCA -0.068; TCGA HNSC -0.077; TCGA LGG -0.062; TCGA LIHC -0.113; TCGA LUSC -0.237; TCGA OV -0.052; TCGA PRAD -0.216; TCGA THCA -0.051; TCGA STAD -0.135 |
hsa-miR-100-5p | TCP1 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; STAD | miRNAWalker2 validate | TCGA BRCA -0.121; TCGA CESC -0.061; TCGA COAD -0.137; TCGA ESCA -0.107; TCGA HNSC -0.052; TCGA LGG -0.092; TCGA LIHC -0.126; TCGA LUSC -0.19; TCGA PRAD -0.247; TCGA STAD -0.202 |
hsa-miR-100-5p | WDR4 | 9 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUSC; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.128; TCGA CESC -0.093; TCGA COAD -0.108; TCGA HNSC -0.154; TCGA LIHC -0.234; TCGA LUSC -0.226; TCGA PRAD -0.208; TCGA STAD -0.155; TCGA UCEC -0.098 |
hsa-miR-100-5p | XRCC6 | 9 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUSC; OV; PRAD; STAD | miRNAWalker2 validate | TCGA BRCA -0.062; TCGA CESC -0.063; TCGA COAD -0.064; TCGA HNSC -0.062; TCGA LIHC -0.078; TCGA LUSC -0.121; TCGA OV -0.078; TCGA PRAD -0.086; TCGA STAD -0.079 |
hsa-miR-100-5p | ZNF511 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.114; TCGA CESC -0.053; TCGA COAD -0.171; TCGA ESCA -0.137; TCGA HNSC -0.057; TCGA LUSC -0.14; TCGA PAAD -0.264; TCGA PRAD -0.253; TCGA STAD -0.145; TCGA UCEC -0.062 |
hsa-miR-100-5p | EIF4A3 | 9 cancers: BRCA; CESC; COAD; LGG; LIHC; LUSC; OV; PRAD; STAD | RAID | TCGA BRCA -0.176; TCGA CESC -0.076; TCGA COAD -0.111; TCGA LGG -0.057; TCGA LIHC -0.085; TCGA LUSC -0.218; TCGA OV -0.091; TCGA PRAD -0.161; TCGA STAD -0.143 |
hsa-miR-100-5p | ODC1 | 11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; STAD | miRNAWalker2 validate | TCGA CESC -0.103; TCGA COAD -0.16; TCGA ESCA -0.187; TCGA HNSC -0.321; TCGA KIRC -0.063; TCGA KIRP -0.227; TCGA LGG -0.089; TCGA LIHC -0.181; TCGA LUSC -0.276; TCGA PRAD -0.296; TCGA STAD -0.2 |
hsa-miR-100-5p | RHPN2 | 9 cancers: COAD; ESCA; KIRC; KIRP; LUAD; OV; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA COAD -0.089; TCGA ESCA -0.66; TCGA KIRC -0.081; TCGA KIRP -0.061; TCGA LUAD -0.185; TCGA OV -0.11; TCGA PRAD -0.172; TCGA STAD -0.438; TCGA UCEC -0.231 |
hsa-miR-100-5p | SLC44A1 | 9 cancers: COAD; ESCA; HNSC; LIHC; LUSC; OV; THCA; STAD; UCEC | miRNATAP | TCGA COAD -0.056; TCGA ESCA -0.137; TCGA HNSC -0.109; TCGA LIHC -0.062; TCGA LUSC -0.24; TCGA OV -0.081; TCGA THCA -0.109; TCGA STAD -0.208; TCGA UCEC -0.07 |
Enriched cancer pathways of putative targets