microRNA information: hsa-miR-101-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-101-5p | miRbase |
| Accession: | MIMAT0004513 | miRbase |
| Precursor name: | hsa-mir-101-1 | miRbase |
| Precursor accession: | MI0000103 | miRbase |
| Symbol: | MIR101-1 | HGNC |
| RefSeq ID: | NR_029516 | GenBank |
| Sequence: | CAGUUAUCACAGUGCUGAUGCU |
Reported expression in cancers: hsa-miR-101-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-101-5p | bladder cancer | downregulation | "Here we report that the expression of microRNA-101 ......" | 23618864 | |
| hsa-miR-101-5p | bladder cancer | downregulation | "The microRNA miR-101 is downregulated in several c ......" | 25658842 | |
| hsa-miR-101-5p | breast cancer | downregulation | "microRNA-101 miR-101 is down-regulated in several ......" | 25059472 | qPCR |
| hsa-miR-101-5p | cervical and endocervical cancer | downregulation | "The profiles of miRNA in cervical cancer and chron ......" | 24528073 | Microarray; qPCR; in situ hybridization |
| hsa-miR-101-5p | cervical and endocervical cancer | downregulation | "Previously we found that miR-101 is significantly ......" | 26617722 | |
| hsa-miR-101-5p | chronic myeloid leukemia | deregulation | "Some onco-miRNAs were found to be downregulated mi ......" | 25833191 | |
| hsa-miR-101-5p | colon cancer | upregulation | "Here we show that miR-101 expression is differenti ......" | 22930392 | |
| hsa-miR-101-5p | colorectal cancer | downregulation | "Among the inferred candidates three miRNAs miR-101 ......" | 25286864 | |
| hsa-miR-101-5p | colorectal cancer | downregulation | "miR-455 miR-484 and miR-101 were significantly dow ......" | 25355599 | |
| hsa-miR-101-5p | esophageal cancer | downregulation | "To investigate the role of miR-101 in the regulati ......" | 25400732 | |
| hsa-miR-101-5p | gastric cancer | downregulation | "MicroRNA microarray expression profiling and array ......" | 22450781 | Microarray; qPCR |
| hsa-miR-101-5p | gastric cancer | downregulation | "In this study we reported that miR-101 is signific ......" | 25561270 | |
| hsa-miR-101-5p | glioblastoma | upregulation | "Quantitative real-time PCR showed that miR-101 exp ......" | 25230316 | qPCR |
| hsa-miR-101-5p | head and neck cancer | deregulation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | qPCR; Microarray |
| hsa-miR-101-5p | liver cancer | downregulation | "miR-101 a significantly down-regulated miRNA was f ......" | 19155302 | |
| hsa-miR-101-5p | liver cancer | downregulation | "Moreover the down-regulation of miR-101 in clinica ......" | 23178713 | |
| hsa-miR-101-5p | liver cancer | downregulation | "Based on our prior observations that miRNA-101 miR ......" | 24260081 | qPCR |
| hsa-miR-101-5p | liver cancer | downregulation | "Here we examine how HBV affects the production of ......" | 24788845 | |
| hsa-miR-101-5p | lung cancer | downregulation | "miR 101 DNA copy loss is a prominent subtype speci ......" | 21849855 | |
| hsa-miR-101-5p | lung cancer | downregulation | "At the same time microRNA-101 mir-101 was found to ......" | 25428391 | |
| hsa-miR-101-5p | lung cancer | downregulation | "The deregulation of miR-101 has been implicated in ......" | 26628987 | |
| hsa-miR-101-5p | lung squamous cell cancer | downregulation | "MiR-101 has been reported down-regulated in variou ......" | 21993632 | |
| hsa-miR-101-5p | lymphoma | downregulation | "Histone deacetylase inhibitor prevents cell growth ......" | 24577510 | Microarray |
| hsa-miR-101-5p | melanoma | downregulation | "The microRNA miR-101 has been reported to be a tum ......" | 23962556 | |
| hsa-miR-101-5p | pancreatic cancer | upregulation | "miR-101 is an outstanding tumor suppressor in vari ......" | 25968875 | |
| hsa-miR-101-5p | prostate cancer | downregulation | "Candidate serum miRNAs were detected by using PCR ......" | 24477576 | Microarray; qPCR |
| hsa-miR-101-5p | retinoblastoma | downregulation | "miR-101 has been identified as a tumor suppressor ......" | 24807198 | |
| hsa-miR-101-5p | sarcoma | downregulation | "miR-101 is downregulated in various types of cance ......" | 25190211 | |
| hsa-miR-101-5p | thyroid cancer | downregulation | "The results showed that miR-101 was significantly ......" | 24649082 | |
| hsa-miR-101-5p | thyroid cancer | downregulation | "This study revealed that miR-101 is significantly ......" | 25202416 |
Reported cancer pathway affected by hsa-miR-101-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-101-5p | bladder cancer | Apoptosis pathway | "Methyl jasmonate sensitizes human bladder cancer c ......" | 24490857 | Flow cytometry |
| hsa-miR-101-5p | bladder cancer | Apoptosis pathway | "Enforced expression of miR 101 enhances cisplatin ......" | 25109742 | Western blot; MTT assay; Luciferase |
| hsa-miR-101-5p | breast cancer | Apoptosis pathway | "miR 101 promotes breast cancer cell apoptosis by t ......" | 25059472 | MTT assay; Flow cytometry; Western blot |
| hsa-miR-101-5p | breast cancer | Apoptosis pathway | "The aim of our study was to investigate the functi ......" | 26036638 | Luciferase |
| hsa-miR-101-5p | cervical and endocervical cancer | Apoptosis pathway | "Although aberrant miRNA expression has been docume ......" | 24289600 | Flow cytometry; Wound Healing Assay |
| hsa-miR-101-5p | cervical and endocervical cancer | cell cycle pathway | "miR 101 inhibits the G1 to S phase transition of c ......" | 24987920 | Western blot; Luciferase; Flow cytometry |
| hsa-miR-101-5p | cervical and endocervical cancer | Apoptosis pathway | "Previously we found that miR-101 is significantly ......" | 26617722 | MTT assay; Flow cytometry |
| hsa-miR-101-5p | colon cancer | Epithelial mesenchymal transition pathway | "Loss of miR 101 expression promotes Wnt/β catenin ......" | 22930392 | |
| hsa-miR-101-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "Effect of miR 101 on biological characteristics of ......" | 27435782 | Colony formation; Flow cytometry |
| hsa-miR-101-5p | esophageal cancer | Apoptosis pathway | "miR 101 suppresses tumor proliferation and migrati ......" | 25400732 | Flow cytometry; Wound Healing Assay |
| hsa-miR-101-5p | gastric cancer | Apoptosis pathway | "Downregulation of miR 101 in gastric cancer correl ......" | 23013439 | |
| hsa-miR-101-5p | gastric cancer | cell cycle pathway | "MiR 101 inhibits cell growth and tumorigenesis of ......" | 25561270 | Colony formation |
| hsa-miR-101-5p | glioblastoma | Apoptosis pathway | "miR 101 acts as a tumor suppressor by targeting Kr ......" | 25230316 | Luciferase |
| hsa-miR-101-5p | liver cancer | Apoptosis pathway | "miR-101 a significantly down-regulated miRNA was f ......" | 19155302 | Luciferase |
| hsa-miR-101-5p | liver cancer | Apoptosis pathway | "miR 101 inhibits autophagy and enhances cisplatin ......" | 23483142 | |
| hsa-miR-101-5p | liver cancer | cell cycle pathway | "Further expression analyses using a large panel of ......" | 23544130 | |
| hsa-miR-101-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "Oncogene polycomb group protein enhancer of zeste ......" | 24211739 | Luciferase; Colony formation |
| hsa-miR-101-5p | liver cancer | Epithelial mesenchymal transition pathway | "However the efficacy of miR-101 replacement therap ......" | 25693145 | |
| hsa-miR-101-5p | lung cancer | Apoptosis pathway | "miR 101 represses lung cancer by inhibiting intera ......" | 26349988 | |
| hsa-miR-101-5p | lung squamous cell cancer | Apoptosis pathway | "In this study we investigate whether miRNA miR-101 ......" | 21270667 | Luciferase |
| hsa-miR-101-5p | lymphoma | cell cycle pathway; Apoptosis pathway | "MicroRNA profiles were correlated with correspondi ......" | 21960592 | |
| hsa-miR-101-5p | ovarian cancer | Apoptosis pathway | "MicroRNA-101 miR-101 expression is negatively asso ......" | 21818714 | Wound Healing Assay |
| hsa-miR-101-5p | prostate cancer | Apoptosis pathway; PI3K/Akt signaling pathway | "RLIP76 dependent suppression of PI3K/AKT/Bcl 2 pat ......" | 26067553 | Flow cytometry; MTT assay |
| hsa-miR-101-5p | retinoblastoma | cell cycle pathway; Apoptosis pathway | "MiR 101 downregulated in retinoblastoma functions ......" | 24807198 | |
| hsa-miR-101-5p | sarcoma | Apoptosis pathway | "Studies have proved that microRNA-101 miR-101 func ......" | 25480586 |
Reported cancer prognosis affected by hsa-miR-101-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-101-5p | bladder cancer | cell migration | "Here we report that the expression of microRNA-101 ......" | 23618864 | |
| hsa-miR-101-5p | bladder cancer | cell migration | "miR 101 suppresses vascular endothelial growth fac ......" | 25658842 | Transwell assay; Western blot; Luciferase; Cell Proliferation Assay |
| hsa-miR-101-5p | breast cancer | staging | "The aim of our study was to investigate the functi ......" | 26036638 | Luciferase |
| hsa-miR-101-5p | breast cancer | progression; staging; metastasis; worse prognosis | "Whereas miR-101 is involved in the development and ......" | 26360780 | |
| hsa-miR-101-5p | cervical and endocervical cancer | tumorigenesis; cell migration | "Although aberrant miRNA expression has been docume ......" | 24289600 | Flow cytometry; Wound Healing Assay |
| hsa-miR-101-5p | cervical and endocervical cancer | tumorigenesis; motility | "Previously we found that miR-101 is significantly ......" | 26617722 | MTT assay; Flow cytometry |
| hsa-miR-101-5p | colon cancer | motility | "MicroRNA 101 miR 101 post transcriptionally regula ......" | 22353936 | Luciferase |
| hsa-miR-101-5p | colon cancer | poor survival; malignant trasformation; worse prognosis | "Loss of miR 101 expression promotes Wnt/β catenin ......" | 22930392 | |
| hsa-miR-101-5p | colorectal cancer | progression | "Downloading from GEO Gene Expression Omnibus datab ......" | 25755742 | |
| hsa-miR-101-5p | esophageal cancer | metastasis | "miR 101 suppresses tumor proliferation and migrati ......" | 25400732 | Flow cytometry; Wound Healing Assay |
| hsa-miR-101-5p | esophageal cancer | progression; metastasis | "Cyclooxygenase 2 a Potential Therapeutic Target Is ......" | 26556718 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-101-5p | gastric cancer | metastasis | "Downregulation of miR 101 in gastric cancer correl ......" | 23013439 | |
| hsa-miR-101-5p | gastric cancer | progression; tumorigenesis | "Expressions of COX 2 PKC α and miR 101 in gastric ......" | 23644120 | Western blot |
| hsa-miR-101-5p | gastric cancer | tumorigenesis; progression | "MiR 101 inhibits cell growth and tumorigenesis of ......" | 25561270 | Colony formation |
| hsa-miR-101-5p | gastric cancer | cell migration | "miR 101 2 miR 125b 2 and miR 451a act as potential ......" | 26458815 | Western blot; Colony formation |
| hsa-miR-101-5p | gastric cancer | progression; worse prognosis | "Long non coding RNA XIST regulates gastric cancer ......" | 27620004 | |
| hsa-miR-101-5p | glioblastoma | progression | "miR 101 is down regulated in glioblastoma resultin ......" | 21321380 | |
| hsa-miR-101-5p | glioblastoma | poor survival | "miR 101 acts as a tumor suppressor by targeting Kr ......" | 25230316 | Luciferase |
| hsa-miR-101-5p | head and neck cancer | malignant trasformation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | |
| hsa-miR-101-5p | kidney renal cell cancer | cell migration | "Restoration of miR-101 significantly inhibited cel ......" | 27487138 | |
| hsa-miR-101-5p | liver cancer | tumorigenesis | "miR-101 a significantly down-regulated miRNA was f ......" | 19155302 | Luciferase |
| hsa-miR-101-5p | liver cancer | worse prognosis; progression | "Ectopic expression of miR-101 significantly inhibi ......" | 23178713 | |
| hsa-miR-101-5p | liver cancer | drug resistance | "miR 101 inhibits autophagy and enhances cisplatin ......" | 23483142 | |
| hsa-miR-101-5p | liver cancer | tumorigenesis; malignant trasformation; worse prognosis | "Furthermore miR-101 an important tumor-suppressive ......" | 24002871 | |
| hsa-miR-101-5p | liver cancer | progression | "Oncogene polycomb group protein enhancer of zeste ......" | 24211739 | Luciferase; Colony formation |
| hsa-miR-101-5p | liver cancer | worse prognosis; tumor size; progression | "Based on our prior observations that miRNA-101 miR ......" | 24260081 | |
| hsa-miR-101-5p | liver cancer | metastasis; poor survival; tumorigenesis | "However the efficacy of miR-101 replacement therap ......" | 25693145 | |
| hsa-miR-101-5p | liver cancer | progression | "Single Nucleotide Polymorphisms in miR 149 rs22928 ......" | 26434859 | |
| hsa-miR-101-5p | liver cancer | tumorigenesis | "Reciprocal negative feedback loop between EZH2 and ......" | 26718325 | |
| hsa-miR-101-5p | liver cancer | metastasis; cell migration | "miRNA miR-101 has been suggested to be associated ......" | 26870229 | |
| hsa-miR-101-5p | lung cancer | tumorigenesis | "miR 101 DNA copy loss is a prominent subtype speci ......" | 21849855 | |
| hsa-miR-101-5p | lung cancer | tumorigenesis; metastasis | "Restoration of miR 101 suppresses lung tumorigenes ......" | 25210796 | Luciferase |
| hsa-miR-101-5p | lung cancer | progression | "At the same time microRNA-101 mir-101 was found to ......" | 25428391 | |
| hsa-miR-101-5p | lung cancer | metastasis | "miR 101 represses lung cancer by inhibiting intera ......" | 26349988 | |
| hsa-miR-101-5p | lung cancer | progression | "The deregulation of miR-101 has been implicated in ......" | 26628987 | Luciferase |
| hsa-miR-101-5p | lung squamous cell cancer | drug resistance | "In this study we investigate whether miRNA miR-101 ......" | 21270667 | Luciferase |
| hsa-miR-101-5p | lung squamous cell cancer | staging; worse prognosis; poor survival; progression | "MiR 101 and Mcl 1 in non small cell lung cancer: e ......" | 21993632 | Western blot |
| hsa-miR-101-5p | lung squamous cell cancer | drug resistance; malignant trasformation | "Radiosensitizing effects of ectopic miR 101 on non ......" | 22014955 | Western blot |
| hsa-miR-101-5p | lymphoma | differentiation | "MicroRNA profiles were correlated with correspondi ......" | 21960592 | |
| hsa-miR-101-5p | melanoma | staging; poor survival | "MiR 101 inhibits melanoma cell invasion and prolif ......" | 23962556 | |
| hsa-miR-101-5p | ovarian cancer | motility | "MicroRNA-101 miR-101 expression is negatively asso ......" | 21818714 | Wound Healing Assay |
| hsa-miR-101-5p | ovarian cancer | cell migration | "MiR 101 suppresses the epithelial to mesenchymal t ......" | 24677166 | |
| hsa-miR-101-5p | ovarian cancer | progression; drug resistance; malignant trasformation; tumorigenesis; staging; differentiation | "miR 101 regulates expression of EZH2 and contribut ......" | 25260883 | |
| hsa-miR-101-5p | pancreatic cancer | tumorigenesis | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-miR-101-5p | pancreatic cancer | staging; metastasis; poor survival | "miR-101 is an outstanding tumor suppressor in vari ......" | 25968875 | Western blot; Luciferase |
| hsa-miR-101-5p | prostate cancer | malignant trasformation | "The expression of nine selected miRNAs hsa-miR-101 ......" | 24517338 | Luciferase |
| hsa-miR-101-5p | prostate cancer | progression; tumorigenesis | "RLIP76 dependent suppression of PI3K/AKT/Bcl 2 pat ......" | 26067553 | Flow cytometry; MTT assay |
| hsa-miR-101-5p | prostate cancer | metastasis; progression | "Some of the genes that are negatively regulated by ......" | 27270442 | |
| hsa-miR-101-5p | retinoblastoma | progression | "MiR 101 downregulated in retinoblastoma functions ......" | 24807198 | |
| hsa-miR-101-5p | sarcoma | cell migration | "miR-101 is downregulated in various types of cance ......" | 25190211 | |
| hsa-miR-101-5p | thyroid cancer | metastasis; cell migration | "In previous studies the role of miRNA-101 miR-101 ......" | 25202416 | Luciferase |
Reported gene related to hsa-miR-101-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-101-5p | bladder cancer | EZH2 | "Methyl jasmonate sensitizes human bladder cancer c ......" | 24490857 |
| hsa-miR-101-5p | breast cancer | EZH2 | "Main objective of the present study is to investig ......" | 22094936 |
| hsa-miR-101-5p | esophageal cancer | EZH2 | "miR 101 suppresses tumor proliferation and migrati ......" | 25400732 |
| hsa-miR-101-5p | gastric cancer | EZH2 | "Long non coding RNA XIST regulates gastric cancer ......" | 27620004 |
| hsa-miR-101-5p | gastric cancer | EZH2 | "Moreover around 40% of cases showing miR-101 down- ......" | 22450781 |
| hsa-miR-101-5p | glioblastoma | EZH2 | "miR 101 is down regulated in glioblastoma resultin ......" | 21321380 |
| hsa-miR-101-5p | liver cancer | EZH2 | "miR-101 in turn inhibits the expression of two sub ......" | 24002871 |
| hsa-miR-101-5p | liver cancer | EZH2 | "Reporter gene assays revealed that ectopic express ......" | 26718325 |
| hsa-miR-101-5p | liver cancer | EZH2 | "The aim of our study was to investigate the functi ......" | 24211739 |
| hsa-miR-101-5p | lung cancer | EZH2 | "The results showed that mir-101 was down-regulated ......" | 25428391 |
| hsa-miR-101-5p | lung cancer | EZH2 | "Therefore we aimed to ascertain whether or not the ......" | 22977606 |
| hsa-miR-101-5p | lung squamous cell cancer | EZH2 | "In this study we investigate whether miRNA miR-101 ......" | 21270667 |
| hsa-miR-101-5p | melanoma | EZH2 | "MiR 101 inhibits melanoma cell invasion and prolif ......" | 23962556 |
| hsa-miR-101-5p | ovarian cancer | EZH2 | "We explore the role of miR-101 and its interaction ......" | 21818714 |
| hsa-miR-101-5p | ovarian cancer | EZH2 | "miR 101 regulates expression of EZH2 and contribut ......" | 25260883 |
| hsa-miR-101-5p | pancreatic cancer | EZH2 | "Mechanistic investigations revealed that reexpress ......" | 22108826 |
| hsa-miR-101-5p | retinoblastoma | EZH2 | "MiR 101 downregulated in retinoblastoma functions ......" | 24807198 |
| hsa-miR-101-5p | sarcoma | EZH2 | "MiR-101 is a microRNA involved in a negative feedb ......" | 26251675 |
| hsa-miR-101-5p | sarcoma | EZH2 | "In the present study we reported that ectopic over ......" | 25190211 |
| hsa-miR-101-5p | bladder cancer | PTGS2 | "Enforced expression of miR 101 enhances cisplatin ......" | 25109742 |
| hsa-miR-101-5p | cervical and endocervical cancer | PTGS2 | "The expression of COX-2 in Hela cell was also exam ......" | 24289600 |
| hsa-miR-101-5p | cervical and endocervical cancer | PTGS2 | "Immunohistochemistry was performed to assess prote ......" | 26617722 |
| hsa-miR-101-5p | cervical and endocervical cancer | PTGS2 | "Roles of MiR 101 and its target gene Cox 2 in earl ......" | 24528073 |
| hsa-miR-101-5p | colon cancer | PTGS2 | "MiR 101 downregulation is involved in cyclooxygena ......" | 19133256 |
| hsa-miR-101-5p | esophageal cancer | PTGS2 | "Cyclooxygenase 2 a Potential Therapeutic Target Is ......" | 26556718 |
| hsa-miR-101-5p | gastric cancer | PTGS2 | "Expressions of COX 2 PKC α and miR 101 in gastric ......" | 23644120 |
| hsa-miR-101-5p | gastric cancer | PTGS2 | "Downregulation of miR 101 in gastric cancer correl ......" | 23013439 |
| hsa-miR-101-5p | liver cancer | PTGS2 | "MiR-16 and miR-101 levels do not correlate with CO ......" | 24759835 |
| hsa-miR-101-5p | lung cancer | PTGS2 | "Interestingly cyclooxygenase-2 inhibition by aspir ......" | 24958470 |
| hsa-miR-101-5p | prostate cancer | PTGS2 | "Enforced expression of miR 101 inhibits prostate c ......" | 21430074 |
| hsa-miR-101-5p | breast cancer | CDH1 | "The overexpression of miR-101 resulted in downregu ......" | 26927545 |
| hsa-miR-101-5p | gastric cancer | CDH1 | "Moreover around 40% of cases showing miR-101 down- ......" | 22450781 |
| hsa-miR-101-5p | lung cancer | CDH1 | "A reduction in the trimethyl H3K27 histone mark wa ......" | 22977606 |
| hsa-miR-101-5p | ovarian cancer | CDH1 | "Our findings showed that miR-101 represents a redu ......" | 24677166 |
| hsa-miR-101-5p | breast cancer | MCL1 | "The aim of our study was to investigate the functi ......" | 26036638 |
| hsa-miR-101-5p | liver cancer | MCL1 | "Moreover silencing of Mcl-1 phenocopied the effect ......" | 19155302 |
| hsa-miR-101-5p | lung squamous cell cancer | MCL1 | "MiR 101 and Mcl 1 in non small cell lung cancer: e ......" | 21993632 |
| hsa-miR-101-5p | colorectal cancer | RAC1 | "Mir-101 inhibitors significantly increased the luc ......" | 25057058 |
| hsa-miR-101-5p | thyroid cancer | RAC1 | "In previous studies the role of miRNA-101 miR-101 ......" | 25202416 |
| hsa-miR-101-5p | thyroid cancer | RAC1 | "miR 101 inhibits cell proliferation by targeting R ......" | 24649082 |
| hsa-miR-101-5p | liver cancer | CXCL12 | "Vascular mimicry formation is promoted by paracrin ......" | 27693460 |
| hsa-miR-101-5p | lung cancer | CXCL12 | "miR 101 represses lung cancer by inhibiting intera ......" | 26349988 |
| hsa-miR-101-5p | breast cancer | DNMT3A | "The expressions of miR-101 and DNA methyltransfera ......" | 26927545 |
| hsa-miR-101-5p | lung cancer | DNMT3A | "Restoration of miR 101 suppresses lung tumorigenes ......" | 25210796 |
| hsa-miR-101-5p | lymphoma | MTOR | "Furthermore inhibition of mTOR which is targeted b ......" | 20805506 |
| hsa-miR-101-5p | sarcoma | MTOR | "Meanwhile bioinformatic analysis demonstrated that ......" | 25480586 |
| hsa-miR-101-5p | liver cancer | MYC | "In addition co-overexpression of c-Myc and EZH2 in ......" | 24002871 |
| hsa-miR-101-5p | liver cancer | MYC | "Furthermore miR-101 significantly suppressed both ......" | 25762642 |
| hsa-miR-101-5p | gastric cancer | SOCS2 | "MiR 101 inhibits cell growth and tumorigenesis of ......" | 25561270 |
| hsa-miR-101-5p | ovarian cancer | SOCS2 | "Real time polymerase chain reaction RT-PCR was emp ......" | 26884939 |
| hsa-miR-101-5p | bladder cancer | VEGFC | "miR-101 and VEGF-C interference independently enha ......" | 25658842 |
| hsa-miR-101-5p | liver cancer | VEGFC | "Vascular endothelial growth factor VEGF-C was furt ......" | 26870229 |
| hsa-miR-101-5p | breast cancer | ACKR3 | "CX chemokine receptor 7 CXCR7 is a direct target o ......" | 26360780 |
| hsa-miR-101-5p | prostate cancer | AR | "Since miR-101 is an inhibitor of autophagy and its ......" | 26473737 |
| hsa-miR-101-5p | lung squamous cell cancer | ATM | "Although ectopic miR-101 efficiently decreased the ......" | 22014955 |
| hsa-miR-101-5p | head and neck cancer | BRIP1 | "Further functional analyses showed that SNP rs7213 ......" | 26711789 |
| hsa-miR-101-5p | lung cancer | CDKN2A | "Finally miR-101 deletions on 9p were exclusive of ......" | 21849855 |
| hsa-miR-101-5p | liver cancer | EED | "miR-101 in turn inhibits the expression of two sub ......" | 24002871 |
| hsa-miR-101-5p | pancreatic cancer | EPCAM | "Mechanistic investigations revealed that reexpress ......" | 22108826 |
| hsa-miR-101-5p | cervical and endocervical cancer | FOS | "miR 101 inhibits the G1 to S phase transition of c ......" | 24987920 |
| hsa-miR-101-5p | pancreatic cancer | HMGA2 | "We identified high-mobility group AT-hook 2 HMGA2 ......" | 25968875 |
| hsa-miR-101-5p | liver cancer | IKBKG | "MiR 101 functions as a tumor suppressor by directl ......" | 24189458 |
| hsa-miR-101-5p | breast cancer | JAK2 | "miR 101 promotes breast cancer cell apoptosis by t ......" | 25059472 |
| hsa-miR-101-5p | glioblastoma | KLF6 | "One direct target of miR-101 the transcription fac ......" | 25230316 |
| hsa-miR-101-5p | thyroid cancer | KRT1 | "Restoration of miR-101 expression significantly in ......" | 24649082 |
| hsa-miR-101-5p | lung cancer | LIN28B | "Lin28B was identified as critical effector target ......" | 24958470 |
| hsa-miR-101-5p | esophageal cancer | MALAT1 | "Silencing of long noncoding RNA MALAT1 by miR 101 ......" | 25538231 |
| hsa-miR-101-5p | lung cancer | MARK1 | "A reduction in the trimethyl H3K27 histone mark wa ......" | 22977606 |
| hsa-miR-101-5p | bladder cancer | MET | "We found that miR-101 directly targets c-Met via i ......" | 23618864 |
| hsa-miR-101-5p | pancreatic cancer | MIA | "MIA PaCa-2 and PANC-1 cells transfected with miR-1 ......" | 25841339 |
| hsa-miR-101-5p | melanoma | MITF | "MiR 101 inhibits melanoma cell invasion and prolif ......" | 23962556 |
| hsa-miR-101-5p | lung cancer | MMP2 | "Moreover the expression of CDH1 and MMP-2 was reve ......" | 22977606 |
| hsa-miR-101-5p | liver cancer | NLK | "MiR 101 functions as a tumor suppressor by directl ......" | 24189458 |
| hsa-miR-101-5p | pancreatic cancer | PKM | "miR-101 or miR-24-2 over-expressing cells when tre ......" | 25841339 |
| hsa-miR-101-5p | lung squamous cell cancer | PRKDC | "Although ectopic miR-101 efficiently decreased the ......" | 22014955 |
| hsa-miR-101-5p | colon cancer | PTGER4 | "MicroRNA 101 miR 101 post transcriptionally regula ......" | 22353936 |
| hsa-miR-101-5p | liver cancer | RAB5A | "Downregulation of miR 101 3p by hepatitis B virus ......" | 24788845 |
| hsa-miR-101-5p | prostate cancer | RALA | "To verify the mechanisms we identified a novel miR ......" | 26067553 |
| hsa-miR-101-5p | prostate cancer | RALBP1 | "RLIP76 dependent suppression of PI3K/AKT/Bcl 2 pat ......" | 26067553 |
| hsa-miR-101-5p | liver cancer | RAP1B | "Functional analysis of miR 101 3p and Rap1b involv ......" | 24697700 |
| hsa-miR-101-5p | lung cancer | RUNX1 | "Mechanistically we indicated that miR-101 inversel ......" | 26628987 |
| hsa-miR-101-5p | colorectal cancer | SNORD44 | "MiR-101 was hardly expressed in the tumor samples ......" | 23121918 |
| hsa-miR-101-5p | liver cancer | SOX9 | "Ectopic expression of miR-101 significantly inhibi ......" | 23178713 |
| hsa-miR-101-5p | colorectal cancer | SPHK1 | "In the current study we demonstrate that microRNA- ......" | 26071354 |
| hsa-miR-101-5p | breast cancer | STAT3 | "STAT3 signaling downstream of CXCR7 is involved in ......" | 26360780 |
| hsa-miR-101-5p | prostate cancer | SUB1 | "Thus our study suggests that miR-101 loss results ......" | 27270442 |
| hsa-miR-101-5p | prostate cancer | TNMD | "We first demonstrated that miR-101 treatment promo ......" | 26067553 |
| hsa-miR-101-5p | gastric cancer | XIST | "Long non coding RNA XIST regulates gastric cancer ......" | 27620004 |
| hsa-miR-101-5p | ovarian cancer | ZEB1 | "MiR 101 suppresses the epithelial to mesenchymal t ......" | 24677166 |
| hsa-miR-101-5p | ovarian cancer | ZEB2 | "MiR 101 suppresses the epithelial to mesenchymal t ......" | 24677166 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-101-5p | PRKDC | 12 cancers: BLCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.099; TCGA CESC -0.127; TCGA ESCA -0.205; TCGA HNSC -0.106; TCGA LGG -0.087; TCGA LIHC -0.212; TCGA LUAD -0.243; TCGA LUSC -0.317; TCGA PAAD -0.184; TCGA PRAD -0.117; TCGA SARC -0.215; TCGA STAD -0.256 |
hsa-miR-101-5p | CD109 | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.211; TCGA COAD -0.47; TCGA ESCA -0.443; TCGA HNSC -0.197; TCGA KIRC -0.21; TCGA LIHC -0.427; TCGA LUSC -0.416; TCGA PAAD -0.435; TCGA PRAD -0.103; TCGA SARC -0.216; TCGA STAD -0.224 |
hsa-miR-101-5p | UBR5 | 10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.063; TCGA CESC -0.066; TCGA ESCA -0.16; TCGA HNSC -0.098; TCGA LIHC -0.164; TCGA LUAD -0.14; TCGA LUSC -0.135; TCGA PRAD -0.073; TCGA SARC -0.093; TCGA STAD -0.132 |
hsa-miR-101-5p | ATAD2 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.132; TCGA CESC -0.107; TCGA ESCA -0.242; TCGA HNSC -0.079; TCGA KIRC -0.259; TCGA KIRP -0.222; TCGA LGG -0.148; TCGA LIHC -0.364; TCGA LUAD -0.376; TCGA LUSC -0.393; TCGA PRAD -0.087; TCGA SARC -0.163; TCGA STAD -0.283; TCGA UCEC -0.083 |
hsa-miR-101-5p | USP14 | 13 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.076; TCGA CESC -0.171; TCGA COAD -0.176; TCGA ESCA -0.183; TCGA LIHC -0.113; TCGA LUAD -0.177; TCGA LUSC -0.141; TCGA PAAD -0.174; TCGA PRAD -0.137; TCGA SARC -0.068; TCGA THCA -0.053; TCGA STAD -0.151; TCGA UCEC -0.068 |
hsa-miR-101-5p | CENPL | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.07; TCGA BRCA -0.183; TCGA CESC -0.072; TCGA COAD -0.071; TCGA ESCA -0.187; TCGA HNSC -0.065; TCGA KIRC -0.2; TCGA LGG -0.22; TCGA LIHC -0.439; TCGA LUAD -0.268; TCGA LUSC -0.325; TCGA PAAD -0.235; TCGA PRAD -0.1; TCGA STAD -0.227; TCGA UCEC -0.158 |
hsa-miR-101-5p | CASK | 12 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.128; TCGA ESCA -0.139; TCGA HNSC -0.087; TCGA KIRC -0.083; TCGA KIRP -0.26; TCGA LGG -0.059; TCGA LUSC -0.197; TCGA PAAD -0.212; TCGA PRAD -0.102; TCGA SARC -0.14; TCGA THCA -0.228; TCGA STAD -0.162 |
hsa-miR-101-5p | PPP2R5E | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.127; TCGA CESC -0.181; TCGA COAD -0.082; TCGA ESCA -0.193; TCGA HNSC -0.122; TCGA LUAD -0.176; TCGA LUSC -0.181; TCGA PAAD -0.158; TCGA PRAD -0.114; TCGA SARC -0.133; TCGA STAD -0.121 |
hsa-miR-101-5p | DCUN1D1 | 10 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.078; TCGA COAD -0.085; TCGA ESCA -0.151; TCGA LUAD -0.154; TCGA LUSC -0.153; TCGA PAAD -0.219; TCGA PRAD -0.207; TCGA SARC -0.081; TCGA THCA -0.078; TCGA STAD -0.21 |
hsa-miR-101-5p | RCOR1 | 9 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.098; TCGA CESC -0.098; TCGA ESCA -0.27; TCGA HNSC -0.137; TCGA LGG -0.052; TCGA LUAD -0.09; TCGA PRAD -0.126; TCGA THCA -0.065; TCGA STAD -0.09 |
hsa-miR-101-5p | LONP2 | 9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD | mirMAP | TCGA BLCA -0.065; TCGA CESC -0.137; TCGA ESCA -0.095; TCGA HNSC -0.064; TCGA LUAD -0.054; TCGA LUSC -0.074; TCGA PAAD -0.117; TCGA PRAD -0.1; TCGA STAD -0.077 |
hsa-miR-101-5p | SEPT7 | 10 cancers: BLCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | mirMAP | TCGA BLCA -0.11; TCGA CESC -0.078; TCGA KIRC -0.078; TCGA KIRP -0.15; TCGA LIHC -0.063; TCGA LUAD -0.12; TCGA LUSC -0.053; TCGA PAAD -0.096; TCGA PRAD -0.051; TCGA STAD -0.082 |
hsa-miR-101-5p | SSR1 | 10 cancers: BLCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.082; TCGA ESCA -0.097; TCGA HNSC -0.1; TCGA LGG -0.082; TCGA LIHC -0.084; TCGA LUAD -0.16; TCGA LUSC -0.153; TCGA PRAD -0.119; TCGA STAD -0.113; TCGA UCEC -0.057 |
hsa-miR-101-5p | FSTL1 | 9 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.126; TCGA COAD -0.282; TCGA HNSC -0.15; TCGA KIRC -0.332; TCGA KIRP -0.501; TCGA LGG -0.176; TCGA PAAD -0.377; TCGA PRAD -0.161; TCGA THCA -0.111 |
hsa-miR-101-5p | MAP3K2 | 9 cancers: BLCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.097; TCGA COAD -0.081; TCGA HNSC -0.101; TCGA LUAD -0.152; TCGA LUSC -0.147; TCGA PAAD -0.174; TCGA PRAD -0.197; TCGA SARC -0.109; TCGA STAD -0.11 |
hsa-miR-101-5p | IPO9 | 13 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.082; TCGA BRCA -0.077; TCGA ESCA -0.158; TCGA HNSC -0.062; TCGA LGG -0.057; TCGA LIHC -0.17; TCGA LUAD -0.127; TCGA LUSC -0.123; TCGA PAAD -0.1; TCGA PRAD -0.064; TCGA SARC -0.118; TCGA STAD -0.124; TCGA UCEC -0.054 |
hsa-miR-101-5p | TMSB10 | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; UCEC | miRNAWalker2 validate | TCGA BRCA -0.274; TCGA CESC -0.134; TCGA ESCA -0.26; TCGA HNSC -0.262; TCGA KIRC -0.458; TCGA KIRP -0.368; TCGA LIHC -0.505; TCGA LUAD -0.098; TCGA LUSC -0.116; TCGA UCEC -0.231 |
hsa-miR-101-5p | PBK | 14 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.449; TCGA CESC -0.15; TCGA COAD -0.15; TCGA ESCA -0.307; TCGA KIRC -0.536; TCGA KIRP -0.362; TCGA LGG -0.741; TCGA LIHC -0.91; TCGA LUAD -0.627; TCGA LUSC -0.699; TCGA PAAD -0.385; TCGA THCA -0.217; TCGA STAD -0.2; TCGA UCEC -0.547 |
hsa-miR-101-5p | CBFB | 12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BRCA -0.072; TCGA CESC -0.074; TCGA ESCA -0.15; TCGA HNSC -0.054; TCGA KIRC -0.188; TCGA KIRP -0.223; TCGA LGG -0.125; TCGA LIHC -0.065; TCGA LUAD -0.102; TCGA LUSC -0.082; TCGA STAD -0.187; TCGA UCEC -0.122 |
hsa-miR-101-5p | TGFBR1 | 10 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; STAD | mirMAP | TCGA BRCA -0.076; TCGA CESC -0.147; TCGA COAD -0.104; TCGA HNSC -0.133; TCGA KIRC -0.104; TCGA LGG -0.171; TCGA LUAD -0.09; TCGA PAAD -0.213; TCGA PRAD -0.059; TCGA STAD -0.16 |
hsa-miR-101-5p | SLC7A11 | 10 cancers: BRCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC | mirMAP | TCGA BRCA -0.111; TCGA HNSC -0.38; TCGA KIRC -0.353; TCGA LIHC -0.615; TCGA LUAD -0.349; TCGA LUSC -0.629; TCGA PAAD -0.348; TCGA SARC -0.336; TCGA THCA -0.382; TCGA UCEC -0.249 |
hsa-miR-101-5p | KIF26B | 11 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.423; TCGA HNSC -0.428; TCGA LGG -0.401; TCGA LIHC -0.496; TCGA LUAD -0.287; TCGA LUSC -0.548; TCGA PAAD -0.388; TCGA SARC -0.686; TCGA THCA -0.214; TCGA STAD -0.231; TCGA UCEC -0.24 |
hsa-miR-101-5p | BRI3BP | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; UCEC | mirMAP | TCGA BRCA -0.182; TCGA CESC -0.174; TCGA COAD -0.093; TCGA ESCA -0.206; TCGA HNSC -0.124; TCGA LIHC -0.25; TCGA LUAD -0.251; TCGA LUSC -0.301; TCGA THCA -0.079; TCGA UCEC -0.297 |
hsa-miR-101-5p | ZNF207 | 12 cancers: CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA CESC -0.062; TCGA COAD -0.059; TCGA ESCA -0.122; TCGA KIRC -0.067; TCGA KIRP -0.083; TCGA LGG -0.08; TCGA LIHC -0.1; TCGA LUAD -0.086; TCGA LUSC -0.085; TCGA PRAD -0.059; TCGA STAD -0.072; TCGA UCEC -0.075 |
hsa-miR-101-5p | INPP4B | 9 cancers: CESC; COAD; HNSC; LIHC; LUAD; PAAD; SARC; THCA; STAD | mirMAP | TCGA CESC -0.229; TCGA COAD -0.15; TCGA HNSC -0.322; TCGA LIHC -0.21; TCGA LUAD -0.245; TCGA PAAD -0.408; TCGA SARC -0.161; TCGA THCA -0.18; TCGA STAD -0.14 |
hsa-miR-101-5p | EXT1 | 11 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA | mirMAP | TCGA COAD -0.092; TCGA ESCA -0.244; TCGA HNSC -0.217; TCGA KIRC -0.08; TCGA KIRP -0.082; TCGA LGG -0.052; TCGA LIHC -0.163; TCGA LUAD -0.11; TCGA LUSC -0.232; TCGA PAAD -0.267; TCGA THCA -0.191 |
hsa-miR-101-5p | LPGAT1 | 10 cancers: KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA KIRC -0.186; TCGA KIRP -0.185; TCGA LIHC -0.191; TCGA LUAD -0.2; TCGA LUSC -0.151; TCGA PRAD -0.14; TCGA SARC -0.071; TCGA THCA -0.076; TCGA STAD -0.193; TCGA UCEC -0.113 |
Enriched cancer pathways of putative targets