microRNA information: hsa-miR-103a-3p

SectionIDlink
Mature name: hsa-miR-103a-3pmiRbase
Accession: MIMAT0000101miRbase
Precursor name: hsa-mir-103a-1 miRbase
Precursor accession: MI0000109miRbase
Symbol: MIR103A1HGNC
RefSeq ID: NR_029520GenBank
Sequence: AGCAGCAUUGUACAGGGCUAUGA



Reported expression in cancers: hsa-miR-103a-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-103a-3p

breast cancerupregulation"Among methods for profiling levels of miRNAs next- ......"22387599RNA-Seq; qPCR; Northern blot
hsa-miR-103a-3p

colorectal cancerupregulation"Here we found that high expression of miR-103 and ......"22593189
hsa-miR-103a-3p

colorectal cancerupregulation"High expression of miR-103 is associated with poor ......"24393525
hsa-miR-103a-3p

colorectal cancerupregulation"Circulating miR 103 and miR 720 as novel serum bio ......"26134152Microarray; qPCR
hsa-miR-103a-3p

esophageal cancerderegulation"Differentially-expressed miRNAs were analyzed usin ......"23534712Reverse transcription PCR
hsa-miR-103a-3p

gastric cancerupregulation"The expression levels of miR-20a miR-21 miR-25 miR ......"22996433qPCR
hsa-miR-103a-3p

gastric cancerupregulation"We performed miRNA microarray and quantitative rev ......"23385731Reverse transcription PCR; Microarray; qPCR
hsa-miR-103a-3p

prostate cancerdownregulation"Here we found that miR-103 is down-regulated in pr ......"26771762qPCR
hsa-miR-103a-3p

sarcomadownregulation"Similar analysis in mouse metastatic sarcomas reve ......"26044957



Reported cancer pathway affected by hsa-miR-103a-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-103a-3p

endometrial cancerApoptosis pathway"LncRNA GAS5 induces PTEN expression through inhibi ......"26511107Flow cytometry; Western blot; Luciferase
hsa-miR-103a-3p

liver cancerApoptosis pathway"MiR 103 regulates hepatocellular carcinoma growth ......"26646106Luciferase
hsa-miR-103a-3p

prostate cancercell cycle pathway; Apoptosis pathway"Here we found that miR-103 is down-regulated in pr ......"26771762Luciferase
hsa-miR-103a-3p

prostate cancermTOR signaling pathway"LncRNA GAS5 inhibits proliferation and progression ......"27743383Luciferase; Western blot; MTT assay; Transwell assay; Wound Healing Assay



Reported cancer prognosis affected by hsa-miR-103a-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-103a-3p

bladder cancerpoor survival"Genome-wide miRNA analysis by Miseq sequencing fol ......"27167342
hsa-miR-103a-3p

breast cancerstaging; metastasis"Serum miR 103 as a potential diagnostic biomarker ......"22588912
hsa-miR-103a-3p

breast cancerprogression; drug resistance"Here we find that nucleolin NCL a major nucleolar ......"23610125
hsa-miR-103a-3p

breast cancerpoor survival"We performed genome-wide serum miRNA expression an ......"25547678
hsa-miR-103a-3p

colon cancerstaging"Using miRNA microarrays we analysed 40 paired stag ......"24239208
hsa-miR-103a-3p

colon cancerrecurrence"Groups of five patients with and without disease r ......"24400111
hsa-miR-103a-3p

colon cancerstaging"Six miRNAs previously identified as prognostic mar ......"27247088
hsa-miR-103a-3p

colorectal cancermetastasis; worse prognosis"Here we found that high expression of miR-103 and ......"22593189
hsa-miR-103a-3p

colorectal cancerworse prognosis"PER3 a novel target of miR 103 plays a suppressive ......"24393525
hsa-miR-103a-3p

colorectal cancermetastasis; differentiation"Circulating miR 103 and miR 720 as novel serum bio ......"26134152
hsa-miR-103a-3p

colorectal cancerpoor survival"Previous studies have reported that miRNA-103 miR- ......"27602163
hsa-miR-103a-3p

gastric cancermetastasis"Differential expression of miRNAs was studied usin ......"20726036
hsa-miR-103a-3p

gastric cancermetastasis; poor survival"The expression levels of miR-20a miR-21 miR-25 miR ......"22996433
hsa-miR-103a-3p

gastric cancerstaging"We performed miRNA microarray and quantitative rev ......"23385731
hsa-miR-103a-3p

kidney renal cell cancermetastasis; malignant trasformation"To obtain accurate results in miRNA expression cha ......"21741950
hsa-miR-103a-3p

lung cancerprogression"We succeeded in establishing the MTA1 knockdown NS ......"22576802RNAi
hsa-miR-103a-3p

lung squamous cell cancertumorigenesis; drug resistance"It has been recently reported that epidermal growt ......"24286402
hsa-miR-103a-3p

pancreatic cancermetastasis; drug resistance"We report a case of notably increased plasma level ......"23205084
hsa-miR-103a-3p

prostate cancerstaging; progression"Microarray and Q-RT-PCR analyses identified 43 miR ......"24583788
hsa-miR-103a-3p

prostate cancerprogression"LncRNA GAS5 inhibits proliferation and progression ......"27743383Luciferase; Western blot; MTT assay; Transwell assay; Wound Healing Assay



Reported gene related to hsa-miR-103a-3p

miRNAcancergenereportingPUBMED
hsa-miR-103a-3p

endometrial cancerGAS5"LncRNA GAS5 induces PTEN expression through inhibi ......"26511107
hsa-miR-103a-3p

prostate cancerGAS5"LncRNA GAS5 inhibits proliferation and progression ......"27743383
hsa-miR-103a-3p

colorectal cancerPTEN"Our data collectively demonstrate that miR-103 is ......"24828205
hsa-miR-103a-3p

endometrial cancerPTEN"LncRNA GAS5 induces PTEN expression through inhibi ......"26511107
hsa-miR-103a-3p

liver cancerAKAP12"MiR 103 regulates hepatocellular carcinoma growth ......"26646106
hsa-miR-103a-3p

breast cancerBRCA1"Identification of fifteen novel germline variants ......"22753153
hsa-miR-103a-3p

colorectal cancerDICER1"Our data collectively demonstrate that miR-103 is ......"24828205
hsa-miR-103a-3p

glioblastomaGAPDH"Here we demonstrate that the reference transcripts ......"24205116
hsa-miR-103a-3p

colorectal cancerLATS2"Furthermore miR-103 repressed large tumor suppress ......"27602163
hsa-miR-103a-3p

gastric cancerMYB"Moreover c-Myb was identified to be a functional d ......"25530421
hsa-miR-103a-3p

prostate cancerPDCD10"Subsequent dual-luciferase reporter assay identifi ......"26771762
hsa-miR-103a-3p

colorectal cancerPER3"PER3 a novel target of miR 103 plays a suppressive ......"24393525
hsa-miR-103a-3p

ovarian cancerSNORD48"miR-103 miR-92a and miR -638 had relatively invari ......"23272653
hsa-miR-103a-3p

endometrial cancerTIMP3"miR-103 inhibitor transfection increased the activ ......"22783422



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-103a-3p
ANKFY1
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; PRAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.069; TCGA BRCA -0.207; TCGA ESCA -0.158; TCGA HNSC -0.098; TCGA KIRC -0.151; TCGA LGG -0.229; TCGA LIHC -0.162; TCGA LUSC -0.098; TCGA PRAD -0.159; TCGA UCEC -0.099
hsa-miR-103a-3p
ASH1L
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.12; TCGA BRCA -0.364; TCGA HNSC -0.247; TCGA KIRC -0.245; TCGA KIRP -0.512; TCGA LGG -0.095; TCGA PRAD -0.269; TCGA SARC -0.368; TCGA UCEC -0.113
hsa-miR-103a-3p
CAPZA2
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.229; TCGA BRCA -0.124; TCGA ESCA -0.207; TCGA HNSC -0.216; TCGA LIHC -0.093; TCGA LUAD -0.268; TCGA LUSC -0.151; TCGA PRAD -0.121; TCGA SARC -0.191; TCGA THCA -0.104
hsa-miR-103a-3p
CAV1
14 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -1.018; TCGA BRCA -0.515; TCGA COAD -0.317; TCGA ESCA -0.826; TCGA LIHC -0.118; TCGA LUAD -0.381; TCGA LUSC -0.636; TCGA OV -0.151; TCGA PAAD -0.372; TCGA PRAD -0.767; TCGA SARC -0.608; TCGA THCA -0.62; TCGA STAD -0.587; TCGA UCEC -0.596
hsa-miR-103a-3p
CD274
9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; PRAD; SARC; THCA
miRNAWalker2 validate
TCGA BLCA -0.546; TCGA BRCA -0.35; TCGA CESC -0.484; TCGA HNSC -0.524; TCGA LIHC -0.521; TCGA LUAD -0.3; TCGA PRAD -0.423; TCGA SARC -0.289; TCGA THCA -0.789
hsa-miR-103a-3p
CDC37L1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; PRAD; SARC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.243; TCGA BRCA -0.12; TCGA CESC -0.177; TCGA ESCA -0.342; TCGA HNSC -0.227; TCGA KIRC -0.178; TCGA LIHC -0.494; TCGA PRAD -0.073; TCGA SARC -0.316
hsa-miR-103a-3p
CDK17
9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; SARC; THCA; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.156; TCGA BRCA -0.172; TCGA ESCA -0.244; TCGA HNSC -0.077; TCGA LIHC -0.101; TCGA LUAD -0.16; TCGA SARC -0.157; TCGA THCA -0.075; TCGA UCEC -0.08
hsa-miR-103a-3p
CLIP1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.288; TCGA BRCA -0.265; TCGA CESC -0.247; TCGA COAD -0.13; TCGA ESCA -0.417; TCGA HNSC -0.466; TCGA KIRC -0.152; TCGA KIRP -0.206; TCGA LIHC -0.198; TCGA LUAD -0.148; TCGA LUSC -0.11; TCGA PRAD -0.136; TCGA SARC -0.473; TCGA UCEC -0.158
hsa-miR-103a-3p
CPEB2
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.345; TCGA BRCA -0.151; TCGA ESCA -0.52; TCGA HNSC -0.411; TCGA LIHC -0.28; TCGA LUAD -0.157; TCGA PRAD -0.209; TCGA SARC -0.487; TCGA STAD -0.126; TCGA UCEC -0.208
hsa-miR-103a-3p
DNAJB4
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.557; TCGA BRCA -0.474; TCGA ESCA -0.468; TCGA HNSC -0.332; TCGA KIRC -0.1; TCGA KIRP -0.277; TCGA LIHC -0.297; TCGA LUAD -0.199; TCGA PRAD -0.572; TCGA SARC -0.316; TCGA STAD -0.256
hsa-miR-103a-3p
FAM122A
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.174; TCGA BRCA -0.291; TCGA CESC -0.127; TCGA ESCA -0.218; TCGA HNSC -0.166; TCGA KIRC -0.208; TCGA KIRP -0.255; TCGA LGG -0.073; TCGA LIHC -0.193; TCGA OV -0.122; TCGA PRAD -0.185; TCGA SARC -0.156; TCGA STAD -0.104; TCGA UCEC -0.161
hsa-miR-103a-3p
FGF2
13 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.951; TCGA BRCA -0.724; TCGA COAD -0.555; TCGA ESCA -0.94; TCGA KIRP -0.337; TCGA LGG -0.127; TCGA LIHC -0.334; TCGA OV -0.237; TCGA PRAD -0.712; TCGA SARC -0.399; TCGA THCA -0.522; TCGA STAD -0.524; TCGA UCEC -0.705
hsa-miR-103a-3p
GABARAPL1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.369; TCGA BRCA -0.271; TCGA CESC -0.314; TCGA COAD -0.307; TCGA ESCA -0.426; TCGA KIRC -0.714; TCGA KIRP -0.178; TCGA LIHC -0.703; TCGA LUAD -0.148; TCGA PRAD -0.205; TCGA STAD -0.469; TCGA UCEC -0.271
hsa-miR-103a-3p
GLRX
9 cancers: BLCA; CESC; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.314; TCGA CESC -0.265; TCGA HNSC -0.233; TCGA LIHC -0.464; TCGA LUAD -0.297; TCGA LUSC -0.536; TCGA PRAD -0.223; TCGA THCA -0.353; TCGA STAD -0.205
hsa-miR-103a-3p
GTPBP1
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.07; TCGA ESCA -0.136; TCGA HNSC -0.105; TCGA KIRC -0.159; TCGA KIRP -0.187; TCGA LGG -0.192; TCGA PRAD -0.053; TCGA SARC -0.17; TCGA THCA -0.121; TCGA STAD -0.12; TCGA UCEC -0.113
hsa-miR-103a-3p
ITGA2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.259; TCGA BRCA -0.519; TCGA CESC -0.373; TCGA HNSC -0.263; TCGA KIRC -0.42; TCGA KIRP -0.746; TCGA PRAD -0.687; TCGA SARC -0.293; TCGA THCA -0.9; TCGA UCEC -0.466
hsa-miR-103a-3p
KATNAL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.78; TCGA BRCA -0.283; TCGA CESC -0.183; TCGA COAD -0.282; TCGA ESCA -0.399; TCGA HNSC -0.141; TCGA LIHC -0.236; TCGA LUAD -0.194; TCGA LUSC -0.144; TCGA PRAD -0.466; TCGA SARC -0.212; TCGA THCA -0.137; TCGA STAD -0.168; TCGA UCEC -0.292
hsa-miR-103a-3p
KLF4
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.37; TCGA BRCA -0.372; TCGA CESC -0.298; TCGA ESCA -0.34; TCGA HNSC -0.332; TCGA LIHC -0.456; TCGA PRAD -0.162; TCGA THCA -0.396; TCGA STAD -0.26; TCGA UCEC -0.412
hsa-miR-103a-3p
LATS1
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.152; TCGA BRCA -0.63; TCGA HNSC -0.249; TCGA KIRC -0.3; TCGA KIRP -0.656; TCGA LGG -0.373; TCGA PRAD -0.46; TCGA SARC -0.254; TCGA UCEC -0.2
hsa-miR-103a-3p
LUZP1
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.157; TCGA BRCA -0.357; TCGA HNSC -0.178; TCGA KIRC -0.18; TCGA KIRP -0.217; TCGA LUAD -0.166; TCGA PAAD -0.162; TCGA PRAD -0.279; TCGA UCEC -0.102
hsa-miR-103a-3p
MAP4
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.258; TCGA BRCA -0.124; TCGA COAD -0.161; TCGA ESCA -0.411; TCGA HNSC -0.272; TCGA KIRC -0.155; TCGA LUAD -0.231; TCGA LUSC -0.239; TCGA PAAD -0.137; TCGA PRAD -0.152; TCGA SARC -0.3; TCGA THCA -0.211; TCGA STAD -0.2; TCGA UCEC -0.069
hsa-miR-103a-3p
MYO5A
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.504; TCGA BRCA -0.304; TCGA COAD -0.252; TCGA ESCA -0.508; TCGA HNSC -0.196; TCGA LUAD -0.151; TCGA LUSC -0.157; TCGA THCA -0.244; TCGA STAD -0.158
hsa-miR-103a-3p
N4BP1
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.084; TCGA BRCA -0.156; TCGA ESCA -0.35; TCGA HNSC -0.253; TCGA KIRC -0.059; TCGA LIHC -0.083; TCGA LUAD -0.08; TCGA LUSC -0.259; TCGA PRAD -0.105; TCGA STAD -0.15; TCGA UCEC -0.205
hsa-miR-103a-3p
NDEL1
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.109; TCGA BRCA -0.134; TCGA ESCA -0.343; TCGA HNSC -0.244; TCGA KIRP -0.111; TCGA LIHC -0.219; TCGA LUAD -0.098; TCGA LUSC -0.131; TCGA PRAD -0.085; TCGA THCA -0.191; TCGA STAD -0.158; TCGA UCEC -0.141
hsa-miR-103a-3p
PDE4D
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.484; TCGA BRCA -0.364; TCGA ESCA -0.52; TCGA HNSC -0.172; TCGA KIRC -0.164; TCGA KIRP -0.16; TCGA LIHC -0.253; TCGA LUAD -0.414; TCGA LUSC -0.193; TCGA PRAD -0.504; TCGA SARC -0.966; TCGA STAD -0.175; TCGA UCEC -0.411
hsa-miR-103a-3p
PDK4
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.536; TCGA BRCA -0.351; TCGA CESC -0.442; TCGA COAD -0.487; TCGA ESCA -1.198; TCGA HNSC -0.798; TCGA KIRP -0.467; TCGA LIHC -0.719; TCGA LUAD -0.435; TCGA LUSC -0.624; TCGA OV -0.145; TCGA PRAD -0.826; TCGA SARC -0.953; TCGA STAD -0.921; TCGA UCEC -0.426
hsa-miR-103a-3p
PLSCR4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.901; TCGA BRCA -0.596; TCGA CESC -0.47; TCGA COAD -0.187; TCGA ESCA -0.664; TCGA HNSC -0.641; TCGA KIRP -0.516; TCGA LIHC -0.52; TCGA LUAD -0.285; TCGA LUSC -0.339; TCGA PRAD -0.57; TCGA SARC -0.262; TCGA STAD -0.544; TCGA UCEC -0.633
hsa-miR-103a-3p
PRKAB2
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.215; TCGA BRCA -0.203; TCGA ESCA -0.276; TCGA HNSC -0.166; TCGA KIRC -0.139; TCGA KIRP -0.246; TCGA LGG -0.131; TCGA PAAD -0.198; TCGA PRAD -0.126; TCGA SARC -0.437
hsa-miR-103a-3p
PRKAR2A
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA BLCA -0.351; TCGA BRCA -0.598; TCGA HNSC -0.529; TCGA KIRC -0.552; TCGA KIRP -0.574; TCGA LUAD -0.183; TCGA LUSC -0.248; TCGA PRAD -0.519; TCGA SARC -0.49; TCGA UCEC -0.161
hsa-miR-103a-3p
PTEN
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.181; TCGA BRCA -0.31; TCGA ESCA -0.257; TCGA HNSC -0.212; TCGA KIRP -0.138; TCGA LUAD -0.178; TCGA LUSC -0.454; TCGA PRAD -0.268; TCGA UCEC -0.183
hsa-miR-103a-3p
RAB23
12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.742; TCGA BRCA -0.223; TCGA COAD -0.201; TCGA ESCA -0.388; TCGA KIRP -0.149; TCGA LGG -0.113; TCGA LUAD -0.193; TCGA PRAD -0.209; TCGA SARC -0.838; TCGA THCA -0.319; TCGA STAD -0.308; TCGA UCEC -0.253
hsa-miR-103a-3p
RECK
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.71; TCGA BRCA -0.524; TCGA COAD -0.444; TCGA ESCA -0.815; TCGA HNSC -0.255; TCGA KIRP -0.192; TCGA LUAD -0.269; TCGA LUSC -0.53; TCGA OV -0.105; TCGA PRAD -0.103; TCGA STAD -0.566; TCGA UCEC -0.349
hsa-miR-103a-3p
RIMS3
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.422; TCGA BRCA -0.291; TCGA ESCA -1.071; TCGA HNSC -0.394; TCGA KIRC -0.19; TCGA PRAD -0.619; TCGA SARC -1.2; TCGA THCA -0.193; TCGA STAD -0.713; TCGA UCEC -0.304
hsa-miR-103a-3p
RNF144B
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUSC; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.16; TCGA BRCA -0.25; TCGA ESCA -0.455; TCGA HNSC -0.258; TCGA KIRP -0.42; TCGA LIHC -0.313; TCGA LUSC -0.285; TCGA PRAD -0.121; TCGA STAD -0.151
hsa-miR-103a-3p
RNF217
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.827; TCGA BRCA -0.492; TCGA COAD -0.485; TCGA ESCA -0.887; TCGA HNSC -0.155; TCGA KIRP -0.291; TCGA LIHC -0.183; TCGA PRAD -0.314; TCGA SARC -0.415; TCGA STAD -0.629
hsa-miR-103a-3p
RUNX1T1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -1.212; TCGA BRCA -0.769; TCGA CESC -0.388; TCGA COAD -0.614; TCGA ESCA -1.202; TCGA HNSC -0.616; TCGA KIRC -0.309; TCGA KIRP -1.016; TCGA LUAD -0.37; TCGA LUSC -0.858; TCGA PRAD -0.853; TCGA SARC -0.435; TCGA STAD -0.637; TCGA UCEC -1.17
hsa-miR-103a-3p
SAV1
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC
miRNAWalker2 validate
TCGA BLCA -0.204; TCGA BRCA -0.312; TCGA HNSC -0.187; TCGA KIRC -0.321; TCGA KIRP -0.221; TCGA LIHC -0.257; TCGA LUAD -0.089; TCGA PRAD -0.101; TCGA SARC -0.131
hsa-miR-103a-3p
SF3A1
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.054; TCGA BRCA -0.14; TCGA HNSC -0.098; TCGA KIRC -0.195; TCGA KIRP -0.214; TCGA LGG -0.21; TCGA LUAD -0.121; TCGA PRAD -0.157; TCGA SARC -0.089; TCGA THCA -0.079; TCGA UCEC -0.059
hsa-miR-103a-3p
SMAD7
9 cancers: BLCA; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.259; TCGA ESCA -0.233; TCGA HNSC -0.142; TCGA KIRP -0.318; TCGA LUAD -0.176; TCGA LUSC -0.372; TCGA PRAD -0.139; TCGA STAD -0.133; TCGA UCEC -0.124
hsa-miR-103a-3p
SUN2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; OV; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.092; TCGA BRCA -0.106; TCGA COAD -0.119; TCGA ESCA -0.292; TCGA HNSC -0.14; TCGA KIRP -0.154; TCGA LIHC -0.315; TCGA LUSC -0.113; TCGA OV -0.186; TCGA SARC -0.581; TCGA THCA -0.276; TCGA STAD -0.293; TCGA UCEC -0.227
hsa-miR-103a-3p
TIMP3
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.633; TCGA BRCA -0.401; TCGA COAD -0.509; TCGA ESCA -1.139; TCGA HNSC -0.357; TCGA KIRC -0.367; TCGA KIRP -0.343; TCGA LGG -0.219; TCGA LIHC -0.194; TCGA LUAD -0.495; TCGA LUSC -0.784; TCGA OV -0.221; TCGA PRAD -0.541; TCGA STAD -0.583; TCGA UCEC -0.647
hsa-miR-103a-3p
TLE4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.25; TCGA BRCA -0.348; TCGA CESC -0.421; TCGA COAD -0.239; TCGA ESCA -0.4; TCGA HNSC -0.297; TCGA KIRC -0.222; TCGA KIRP -0.224; TCGA LIHC -0.24; TCGA SARC -0.189; TCGA THCA -0.419; TCGA STAD -0.343; TCGA UCEC -0.426
hsa-miR-103a-3p
TMEM100
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.976; TCGA BRCA -0.342; TCGA COAD -0.751; TCGA ESCA -1.347; TCGA HNSC -0.562; TCGA LGG -0.774; TCGA LIHC -1.2; TCGA LUSC -0.54; TCGA PRAD -0.582; TCGA THCA -1.362; TCGA STAD -1.281; TCGA UCEC -0.315
hsa-miR-103a-3p
TMEM43
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.109; TCGA BRCA -0.252; TCGA CESC -0.144; TCGA COAD -0.086; TCGA ESCA -0.253; TCGA HNSC -0.123; TCGA LGG -0.122; TCGA LUAD -0.162; TCGA LUSC -0.132; TCGA PAAD -0.173; TCGA PRAD -0.191; TCGA SARC -0.215; TCGA THCA -0.316; TCGA STAD -0.174; TCGA UCEC -0.194
hsa-miR-103a-3p
YWHAH
9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PRAD; SARC; THCA
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.06; TCGA CESC -0.119; TCGA HNSC -0.074; TCGA LUAD -0.203; TCGA LUSC -0.134; TCGA PRAD -0.088; TCGA SARC -0.431; TCGA THCA -0.331
hsa-miR-103a-3p
ZRANB1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; SARC
miRNAWalker2 validate
TCGA BLCA -0.108; TCGA BRCA -0.154; TCGA COAD -0.068; TCGA ESCA -0.101; TCGA HNSC -0.147; TCGA KIRC -0.098; TCGA KIRP -0.197; TCGA PRAD -0.072; TCGA SARC -0.085
hsa-miR-103a-3p
ZYX
13 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.477; TCGA CESC -0.238; TCGA COAD -0.233; TCGA ESCA -0.312; TCGA LUAD -0.124; TCGA LUSC -0.356; TCGA OV -0.083; TCGA PAAD -0.287; TCGA PRAD -0.231; TCGA SARC -0.404; TCGA THCA -0.432; TCGA STAD -0.329; TCGA UCEC -0.385
hsa-miR-103a-3p
AFF4
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC
MirTarget; miRNATAP
TCGA BLCA -0.085; TCGA BRCA -0.252; TCGA ESCA -0.259; TCGA HNSC -0.287; TCGA KIRC -0.109; TCGA KIRP -0.229; TCGA LGG -0.215; TCGA LIHC -0.181; TCGA PRAD -0.155; TCGA SARC -0.244
hsa-miR-103a-3p
RNF38
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.146; TCGA BRCA -0.23; TCGA ESCA -0.149; TCGA HNSC -0.198; TCGA KIRC -0.216; TCGA KIRP -0.309; TCGA LGG -0.154; TCGA PRAD -0.204; TCGA SARC -0.569; TCGA UCEC -0.149
hsa-miR-103a-3p
GPC6
12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -1.302; TCGA BRCA -0.626; TCGA COAD -0.435; TCGA ESCA -0.895; TCGA KIRP -0.4; TCGA LGG -0.342; TCGA LUAD -0.584; TCGA LUSC -0.926; TCGA OV -0.251; TCGA PRAD -0.159; TCGA THCA -0.39; TCGA STAD -0.323
hsa-miR-103a-3p
SGMS2
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.58; TCGA BRCA -0.534; TCGA CESC -0.27; TCGA ESCA -0.684; TCGA HNSC -0.457; TCGA KIRC -0.195; TCGA KIRP -0.5; TCGA LIHC -0.648; TCGA LUAD -0.273; TCGA LUSC -0.634; TCGA PAAD -0.342; TCGA SARC -0.669; TCGA THCA -0.563; TCGA STAD -0.147; TCGA UCEC -0.154
hsa-miR-103a-3p
BACH2
11 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.952; TCGA BRCA -0.455; TCGA COAD -0.613; TCGA KIRC -0.528; TCGA LGG -0.274; TCGA LIHC -0.609; TCGA LUAD -0.194; TCGA PRAD -0.262; TCGA THCA -0.639; TCGA STAD -0.279; TCGA UCEC -0.34
hsa-miR-103a-3p
AKAP2
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -1.293; TCGA BRCA -0.771; TCGA COAD -0.339; TCGA ESCA -0.745; TCGA HNSC -0.747; TCGA KIRC -0.256; TCGA KIRP -0.596; TCGA LIHC -0.363; TCGA LUAD -0.358; TCGA LUSC -0.775; TCGA PRAD -0.842; TCGA SARC -0.735; TCGA THCA -0.453; TCGA UCEC -0.584
hsa-miR-103a-3p
TSPAN5
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.365; TCGA ESCA -0.413; TCGA HNSC -0.321; TCGA KIRC -0.674; TCGA KIRP -1.116; TCGA LUAD -0.207; TCGA PRAD -0.382; TCGA THCA -0.287; TCGA STAD -0.238; TCGA UCEC -0.501
hsa-miR-103a-3p
RBM24
9 cancers: BLCA; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.25; TCGA COAD -0.618; TCGA ESCA -0.834; TCGA HNSC -0.637; TCGA LUSC -0.332; TCGA PRAD -0.657; TCGA SARC -1.86; TCGA STAD -0.755; TCGA UCEC -0.714
hsa-miR-103a-3p
TMEM71
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.693; TCGA BRCA -0.445; TCGA CESC -0.613; TCGA ESCA -0.835; TCGA HNSC -0.27; TCGA LIHC -0.198; TCGA PRAD -0.376; TCGA THCA -0.296; TCGA STAD -0.416; TCGA UCEC -0.255
hsa-miR-103a-3p
HERC2
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.134; TCGA HNSC -0.108; TCGA KIRC -0.161; TCGA KIRP -0.205; TCGA LIHC -0.105; TCGA PRAD -0.13; TCGA SARC -0.263; TCGA UCEC -0.189
hsa-miR-103a-3p
MEF2D
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.291; TCGA CESC -0.21; TCGA COAD -0.136; TCGA ESCA -0.288; TCGA HNSC -0.157; TCGA KIRP -0.168; TCGA LUAD -0.164; TCGA LUSC -0.211; TCGA OV -0.063; TCGA PRAD -0.118; TCGA SARC -0.33; TCGA STAD -0.288; TCGA UCEC -0.294
hsa-miR-103a-3p
RAB11FIP2
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.103; TCGA BRCA -0.322; TCGA ESCA -0.38; TCGA HNSC -0.158; TCGA KIRC -0.266; TCGA KIRP -0.407; TCGA PRAD -0.387; TCGA SARC -0.227; TCGA UCEC -0.169
hsa-miR-103a-3p
CNTNAP1
9 cancers: BLCA; BRCA; COAD; ESCA; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.63; TCGA BRCA -0.094; TCGA COAD -0.751; TCGA ESCA -0.776; TCGA PRAD -0.504; TCGA SARC -0.293; TCGA THCA -0.148; TCGA STAD -0.467; TCGA UCEC -0.393
hsa-miR-103a-3p
PAFAH1B2
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA
MirTarget
TCGA BLCA -0.125; TCGA BRCA -0.54; TCGA HNSC -0.223; TCGA KIRC -0.336; TCGA KIRP -0.483; TCGA LGG -0.113; TCGA LIHC -0.214; TCGA LUAD -0.29; TCGA LUSC -0.226; TCGA PRAD -0.371; TCGA THCA -0.143
hsa-miR-103a-3p
CCDC50
9 cancers: BLCA; BRCA; CESC; COAD; LGG; LUSC; PAAD; SARC; STAD
MirTarget
TCGA BLCA -0.197; TCGA BRCA -0.271; TCGA CESC -0.166; TCGA COAD -0.095; TCGA LGG -0.286; TCGA LUSC -0.194; TCGA PAAD -0.135; TCGA SARC -0.193; TCGA STAD -0.099
hsa-miR-103a-3p
PIK3R1
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.176; TCGA BRCA -0.516; TCGA ESCA -0.323; TCGA HNSC -0.399; TCGA KIRP -0.228; TCGA LGG -0.281; TCGA LIHC -0.188; TCGA PRAD -0.438; TCGA SARC -0.384; TCGA THCA -0.148; TCGA STAD -0.142; TCGA UCEC -0.236
hsa-miR-103a-3p
EPHA3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.844; TCGA BRCA -0.335; TCGA COAD -0.404; TCGA ESCA -0.865; TCGA HNSC -0.411; TCGA KIRP -0.58; TCGA LIHC -0.581; TCGA LUAD -0.326; TCGA LUSC -0.578; TCGA PRAD -0.457; TCGA THCA -0.274; TCGA STAD -0.449; TCGA UCEC -0.763
hsa-miR-103a-3p
FAT3
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.551; TCGA BRCA -0.666; TCGA COAD -0.632; TCGA ESCA -1.161; TCGA KIRC -0.473; TCGA LGG -0.227; TCGA PRAD -1.322; TCGA SARC -1.429; TCGA STAD -1.134; TCGA UCEC -0.549
hsa-miR-103a-3p
CORO2B
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.446; TCGA BRCA -0.378; TCGA COAD -0.42; TCGA ESCA -0.678; TCGA HNSC -0.429; TCGA KIRC -0.747; TCGA KIRP -0.713; TCGA LUSC -0.657; TCGA PRAD -0.61; TCGA STAD -0.651; TCGA UCEC -0.546
hsa-miR-103a-3p
DYNC1LI2
9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; PRAD; SARC; UCEC
MirTarget
TCGA BLCA -0.065; TCGA BRCA -0.239; TCGA ESCA -0.241; TCGA HNSC -0.165; TCGA LIHC -0.171; TCGA LUAD -0.087; TCGA PRAD -0.139; TCGA SARC -0.126; TCGA UCEC -0.083
hsa-miR-103a-3p
FERMT2
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.913; TCGA BRCA -0.475; TCGA COAD -0.54; TCGA ESCA -0.857; TCGA HNSC -0.248; TCGA KIRC -0.218; TCGA KIRP -0.359; TCGA LUAD -0.208; TCGA LUSC -0.523; TCGA PRAD -0.553; TCGA SARC -0.639; TCGA THCA -0.094; TCGA STAD -0.642; TCGA UCEC -0.291
hsa-miR-103a-3p
VCAN
9 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.003; TCGA BRCA -0.362; TCGA COAD -0.333; TCGA ESCA -0.475; TCGA LGG -0.554; TCGA LUAD -0.657; TCGA LUSC -0.504; TCGA THCA -1.175; TCGA UCEC -0.313
hsa-miR-103a-3p
RNF125
9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUSC; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.172; TCGA BRCA -0.332; TCGA CESC -0.313; TCGA HNSC -0.216; TCGA LIHC -0.64; TCGA LUSC -0.264; TCGA PRAD -0.113; TCGA THCA -0.357; TCGA UCEC -0.286
hsa-miR-103a-3p
SNRK
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.3; TCGA CESC -0.144; TCGA ESCA -0.366; TCGA HNSC -0.227; TCGA KIRP -0.374; TCGA LGG -0.078; TCGA LIHC -0.209; TCGA LUAD -0.163; TCGA LUSC -0.207; TCGA SARC -0.25; TCGA STAD -0.156; TCGA UCEC -0.189
hsa-miR-103a-3p
BMX
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.646; TCGA BRCA -0.34; TCGA COAD -0.609; TCGA ESCA -0.84; TCGA HNSC -0.429; TCGA LIHC -0.298; TCGA LUSC -0.7; TCGA SARC -0.404; TCGA STAD -0.563; TCGA UCEC -0.392
hsa-miR-103a-3p
BHLHE40
11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; UCEC
MirTarget
TCGA BLCA -0.397; TCGA CESC -0.307; TCGA ESCA -0.364; TCGA HNSC -0.267; TCGA KIRP -0.269; TCGA LIHC -0.311; TCGA LUAD -0.213; TCGA LUSC -0.178; TCGA PRAD -0.194; TCGA THCA -0.575; TCGA UCEC -0.118
hsa-miR-103a-3p
FAM131B
12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.571; TCGA BRCA -0.199; TCGA CESC -0.528; TCGA HNSC -0.226; TCGA KIRP -0.493; TCGA LUAD -0.389; TCGA LUSC -0.53; TCGA OV -0.146; TCGA SARC -0.335; TCGA THCA -0.379; TCGA STAD -0.528; TCGA UCEC -0.695
hsa-miR-103a-3p
IFFO1
9 cancers: BLCA; CESC; COAD; ESCA; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.735; TCGA CESC -0.379; TCGA COAD -0.344; TCGA ESCA -0.508; TCGA LUSC -0.379; TCGA PRAD -0.178; TCGA THCA -0.184; TCGA STAD -0.331; TCGA UCEC -0.498
hsa-miR-103a-3p
MBNL1
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.33; TCGA BRCA -0.329; TCGA ESCA -0.196; TCGA HNSC -0.141; TCGA LIHC -0.084; TCGA PRAD -0.246; TCGA SARC -0.602; TCGA THCA -0.137; TCGA STAD -0.119; TCGA UCEC -0.147
hsa-miR-103a-3p
TMEM47
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.323; TCGA BRCA -0.569; TCGA CESC -0.63; TCGA COAD -0.299; TCGA ESCA -1.116; TCGA HNSC -0.403; TCGA KIRP -0.608; TCGA LIHC -0.614; TCGA LUAD -0.403; TCGA LUSC -0.42; TCGA PRAD -0.501; TCGA SARC -1.164; TCGA STAD -0.627; TCGA UCEC -0.523
hsa-miR-103a-3p
TECPR2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.191; TCGA BRCA -0.083; TCGA COAD -0.132; TCGA ESCA -0.299; TCGA HNSC -0.125; TCGA KIRC -0.168; TCGA PRAD -0.198; TCGA SARC -0.232; TCGA STAD -0.307; TCGA UCEC -0.202
hsa-miR-103a-3p
ARHGAP5
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC
MirTarget
TCGA BLCA -0.1; TCGA BRCA -0.382; TCGA ESCA -0.279; TCGA HNSC -0.279; TCGA KIRC -0.378; TCGA KIRP -0.405; TCGA LIHC -0.19; TCGA PRAD -0.212; TCGA SARC -0.187
hsa-miR-103a-3p
RORA
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.47; TCGA BRCA -0.311; TCGA COAD -0.355; TCGA ESCA -0.647; TCGA HNSC -0.399; TCGA KIRP -0.563; TCGA LIHC -0.41; TCGA PRAD -0.249; TCGA STAD -0.258; TCGA UCEC -0.241
hsa-miR-103a-3p
ROR1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.289; TCGA BRCA -0.944; TCGA COAD -0.541; TCGA ESCA -0.906; TCGA HNSC -0.659; TCGA KIRP -0.651; TCGA LUSC -0.858; TCGA PRAD -0.992; TCGA SARC -0.698; TCGA THCA -1.115; TCGA STAD -0.446; TCGA UCEC -0.529
hsa-miR-103a-3p
KIAA2022
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.847; TCGA BRCA -0.23; TCGA COAD -1.166; TCGA ESCA -2.029; TCGA KIRC -1.742; TCGA KIRP -0.954; TCGA PRAD -0.289; TCGA SARC -1.52; TCGA STAD -1.397
hsa-miR-103a-3p
GRAMD2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.404; TCGA BRCA -0.497; TCGA CESC -0.308; TCGA HNSC -0.225; TCGA KIRC -0.354; TCGA KIRP -0.445; TCGA LUSC -0.403; TCGA PRAD -0.463; TCGA SARC -0.347; TCGA THCA -0.29
hsa-miR-103a-3p
CPEB3
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC
MirTarget; miRNATAP
TCGA BLCA -0.191; TCGA BRCA -0.318; TCGA CESC -0.208; TCGA ESCA -0.407; TCGA HNSC -0.489; TCGA KIRC -0.449; TCGA KIRP -0.247; TCGA LIHC -0.781; TCGA PRAD -0.169; TCGA SARC -0.159
hsa-miR-103a-3p
CDK14
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.617; TCGA BRCA -0.353; TCGA CESC -0.335; TCGA COAD -0.489; TCGA ESCA -0.673; TCGA KIRC -0.15; TCGA KIRP -0.286; TCGA LIHC -0.14; TCGA LUAD -0.385; TCGA LUSC -0.326; TCGA PRAD -0.091; TCGA THCA -0.222; TCGA STAD -0.413; TCGA UCEC -0.357
hsa-miR-103a-3p
UBR3
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC
MirTarget; miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.314; TCGA ESCA -0.148; TCGA HNSC -0.214; TCGA KIRC -0.224; TCGA KIRP -0.267; TCGA LIHC -0.155; TCGA PRAD -0.165; TCGA SARC -0.308
hsa-miR-103a-3p
RNASEL
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.096; TCGA BRCA -0.233; TCGA CESC -0.442; TCGA ESCA -0.188; TCGA HNSC -0.189; TCGA LIHC -0.442; TCGA LUSC -0.174; TCGA PRAD -0.298; TCGA SARC -0.156; TCGA STAD -0.14; TCGA UCEC -0.298
hsa-miR-103a-3p
EBF1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.787; TCGA BRCA -0.447; TCGA CESC -0.325; TCGA COAD -0.345; TCGA ESCA -0.564; TCGA HNSC -0.207; TCGA KIRP -0.48; TCGA LGG -0.409; TCGA LUAD -0.359; TCGA LUSC -0.453; TCGA OV -0.256; TCGA PRAD -0.381; TCGA STAD -0.216; TCGA UCEC -0.43
hsa-miR-103a-3p
ZHX3
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.326; TCGA BRCA -0.131; TCGA ESCA -0.406; TCGA KIRC -0.386; TCGA KIRP -0.256; TCGA LGG -0.081; TCGA LIHC -0.294; TCGA SARC -0.305; TCGA STAD -0.204; TCGA UCEC -0.204
hsa-miR-103a-3p
SLAIN2
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.149; TCGA BRCA -0.221; TCGA HNSC -0.205; TCGA KIRC -0.124; TCGA KIRP -0.152; TCGA LIHC -0.113; TCGA LUAD -0.135; TCGA PRAD -0.114; TCGA SARC -0.227; TCGA THCA -0.056; TCGA STAD -0.093; TCGA UCEC -0.061
hsa-miR-103a-3p
ADAMTSL3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; OV; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -1.454; TCGA BRCA -0.469; TCGA CESC -0.663; TCGA COAD -0.946; TCGA ESCA -1.207; TCGA HNSC -0.829; TCGA KIRC -0.231; TCGA KIRP -1.007; TCGA LIHC -0.883; TCGA OV -0.247; TCGA PRAD -0.622; TCGA STAD -1.026; TCGA UCEC -0.765
hsa-miR-103a-3p
PHYHIPL
9 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUSC; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.451; TCGA BRCA -0.412; TCGA COAD -0.635; TCGA ESCA -0.652; TCGA LGG -0.372; TCGA LUSC -0.368; TCGA PRAD -0.626; TCGA SARC -0.857; TCGA STAD -0.357
hsa-miR-103a-3p
ARIH1
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.058; TCGA BRCA -0.278; TCGA ESCA -0.115; TCGA HNSC -0.121; TCGA KIRC -0.093; TCGA KIRP -0.174; TCGA LGG -0.054; TCGA LIHC -0.122; TCGA LUAD -0.135; TCGA PRAD -0.091; TCGA SARC -0.15; TCGA THCA -0.058
hsa-miR-103a-3p
RGS4
12 cancers: BLCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.016; TCGA CESC -0.424; TCGA COAD -0.591; TCGA ESCA -0.529; TCGA KIRP -0.766; TCGA LIHC -0.521; TCGA LUAD -0.637; TCGA LUSC -0.597; TCGA PRAD -0.193; TCGA THCA -1.112; TCGA STAD -0.443; TCGA UCEC -0.325
hsa-miR-103a-3p
TSPAN9
10 cancers: BLCA; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.236; TCGA COAD -0.246; TCGA ESCA -0.319; TCGA KIRP -0.134; TCGA LUAD -0.15; TCGA LUSC -0.133; TCGA PAAD -0.232; TCGA PRAD -0.082; TCGA STAD -0.322; TCGA UCEC -0.228
hsa-miR-103a-3p
ITPR1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.501; TCGA BRCA -0.319; TCGA CESC -0.218; TCGA COAD -0.405; TCGA ESCA -0.934; TCGA HNSC -0.4; TCGA KIRC -0.536; TCGA KIRP -0.696; TCGA LIHC -0.257; TCGA LUSC -0.414; TCGA PRAD -0.885; TCGA SARC -1.139; TCGA STAD -0.538; TCGA UCEC -0.551
hsa-miR-103a-3p
SNX12
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.18; TCGA BRCA -0.142; TCGA HNSC -0.195; TCGA KIRC -0.265; TCGA KIRP -0.228; TCGA LGG -0.103; TCGA LUAD -0.144; TCGA LUSC -0.078; TCGA PRAD -0.246; TCGA STAD -0.236; TCGA UCEC -0.098
hsa-miR-103a-3p
KY
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.028; TCGA BRCA -0.675; TCGA CESC -0.66; TCGA COAD -0.535; TCGA ESCA -1.092; TCGA HNSC -0.515; TCGA KIRC -0.511; TCGA KIRP -0.735; TCGA PRAD -1.424; TCGA SARC -1.513; TCGA STAD -1.092; TCGA UCEC -0.611
hsa-miR-103a-3p
SEMA3D
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; STAD
MirTarget
TCGA BLCA -0.829; TCGA BRCA -0.883; TCGA COAD -1.105; TCGA ESCA -0.846; TCGA KIRC -0.697; TCGA KIRP -0.52; TCGA LGG -0.366; TCGA LUAD -0.43; TCGA PRAD -0.89; TCGA STAD -0.641
hsa-miR-103a-3p
FOXP1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC
MirTarget
TCGA BLCA -0.19; TCGA BRCA -0.211; TCGA CESC -0.239; TCGA ESCA -0.384; TCGA HNSC -0.212; TCGA KIRC -0.242; TCGA KIRP -0.249; TCGA LUAD -0.297; TCGA LUSC -0.43; TCGA PAAD -0.158; TCGA SARC -0.252; TCGA UCEC -0.325
hsa-miR-103a-3p
MYH9
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.219; TCGA BRCA -0.142; TCGA COAD -0.129; TCGA ESCA -0.281; TCGA HNSC -0.229; TCGA LUAD -0.284; TCGA LUSC -0.24; TCGA PAAD -0.193; TCGA PRAD -0.134; TCGA SARC -0.488; TCGA THCA -0.196; TCGA UCEC -0.299
hsa-miR-103a-3p
DCUN1D3
12 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget
TCGA BLCA -0.162; TCGA BRCA -0.211; TCGA ESCA -0.287; TCGA HNSC -0.177; TCGA LGG -0.141; TCGA LIHC -0.291; TCGA LUAD -0.179; TCGA LUSC -0.211; TCGA PAAD -0.14; TCGA PRAD -0.147; TCGA THCA -0.17; TCGA UCEC -0.117
hsa-miR-103a-3p
RET
9 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUSC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.427; TCGA COAD -0.457; TCGA ESCA -1.275; TCGA KIRC -0.333; TCGA LIHC -0.724; TCGA LUSC -0.441; TCGA PRAD -0.333; TCGA THCA -1.128; TCGA STAD -0.667
hsa-miR-103a-3p
SPAG9
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; PRAD; SARC; UCEC
MirTarget
TCGA BLCA -0.105; TCGA BRCA -0.295; TCGA ESCA -0.258; TCGA HNSC -0.159; TCGA KIRP -0.124; TCGA LGG -0.14; TCGA LIHC -0.193; TCGA PRAD -0.128; TCGA SARC -0.099; TCGA UCEC -0.11
hsa-miR-103a-3p
FAT4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.877; TCGA BRCA -0.634; TCGA COAD -0.4; TCGA ESCA -0.769; TCGA HNSC -0.539; TCGA KIRP -0.754; TCGA LIHC -0.63; TCGA LUSC -0.517; TCGA PRAD -0.831; TCGA SARC -0.381; TCGA STAD -0.498; TCGA UCEC -0.51
hsa-miR-103a-3p
CAB39
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC
MirTarget; miRNATAP
TCGA BLCA -0.173; TCGA BRCA -0.201; TCGA ESCA -0.236; TCGA HNSC -0.227; TCGA KIRC -0.275; TCGA KIRP -0.129; TCGA LIHC -0.058; TCGA LUAD -0.174; TCGA LUSC -0.133; TCGA SARC -0.118
hsa-miR-103a-3p
TACC1
12 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.351; TCGA BRCA -0.444; TCGA ESCA -0.383; TCGA KIRC -0.245; TCGA KIRP -0.258; TCGA LIHC -0.139; TCGA LUAD -0.162; TCGA PRAD -0.605; TCGA SARC -0.728; TCGA THCA -0.166; TCGA STAD -0.19; TCGA UCEC -0.562
hsa-miR-103a-3p
NOTCH2
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.385; TCGA BRCA -0.393; TCGA ESCA -0.371; TCGA HNSC -0.301; TCGA KIRP -0.249; TCGA LIHC -0.2; TCGA LUAD -0.158; TCGA LUSC -0.129; TCGA PAAD -0.527; TCGA PRAD -0.198; TCGA THCA -0.387; TCGA STAD -0.243; TCGA UCEC -0.122
hsa-miR-103a-3p
CLOCK
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC
MirTarget
TCGA BLCA -0.151; TCGA BRCA -0.533; TCGA HNSC -0.347; TCGA KIRC -0.383; TCGA KIRP -0.675; TCGA LIHC -0.427; TCGA LUAD -0.233; TCGA PRAD -0.492; TCGA SARC -0.325
hsa-miR-103a-3p
SH3PXD2A
10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.438; TCGA BRCA -0.236; TCGA COAD -0.142; TCGA HNSC -0.173; TCGA LUAD -0.212; TCGA LUSC -0.232; TCGA PRAD -0.413; TCGA THCA -0.135; TCGA STAD -0.152; TCGA UCEC -0.268
hsa-miR-103a-3p
PMEPA1
11 cancers: BLCA; BRCA; CESC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC
mirMAP
TCGA BLCA -0.747; TCGA BRCA -0.182; TCGA CESC -0.345; TCGA KIRP -0.397; TCGA LIHC -0.281; TCGA LUAD -0.494; TCGA LUSC -0.838; TCGA OV -0.285; TCGA PAAD -0.512; TCGA THCA -0.287; TCGA UCEC -0.495
hsa-miR-103a-3p
IL6ST
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.83; TCGA BRCA -0.867; TCGA ESCA -0.673; TCGA HNSC -0.974; TCGA KIRC -0.422; TCGA KIRP -1.013; TCGA LIHC -0.667; TCGA LUAD -0.217; TCGA LUSC -0.519; TCGA PRAD -1.033; TCGA SARC -0.619; TCGA THCA -0.311; TCGA STAD -0.208; TCGA UCEC -0.696
hsa-miR-103a-3p
ALPK3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.28; TCGA BRCA -0.336; TCGA COAD -0.438; TCGA ESCA -0.552; TCGA HNSC -0.545; TCGA LUAD -0.279; TCGA LUSC -0.408; TCGA PRAD -0.134; TCGA SARC -1.009; TCGA STAD -0.276
hsa-miR-103a-3p
JDP2
9 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.341; TCGA CESC -0.214; TCGA COAD -0.166; TCGA HNSC -0.226; TCGA LIHC -0.325; TCGA LUSC -0.298; TCGA PRAD -0.232; TCGA THCA -0.136; TCGA STAD -0.428
hsa-miR-103a-3p
WTIP
9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; OV; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.125; TCGA COAD -0.439; TCGA ESCA -0.581; TCGA KIRC -0.262; TCGA KIRP -0.315; TCGA OV -0.13; TCGA PAAD -0.459; TCGA THCA -0.359; TCGA STAD -0.481
hsa-miR-103a-3p
SCN2B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -1.379; TCGA BRCA -0.71; TCGA CESC -0.436; TCGA COAD -1.395; TCGA ESCA -1.555; TCGA HNSC -0.752; TCGA KIRC -1.382; TCGA KIRP -1.069; TCGA LUAD -0.347; TCGA LUSC -0.657; TCGA PAAD -0.513; TCGA PRAD -0.974; TCGA SARC -0.887; TCGA STAD -1.41; TCGA UCEC -0.791
hsa-miR-103a-3p
MR1
10 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.13; TCGA BRCA -0.126; TCGA CESC -0.385; TCGA HNSC -0.106; TCGA LIHC -0.291; TCGA LUSC -0.327; TCGA PAAD -0.263; TCGA PRAD -0.533; TCGA SARC -0.115; TCGA STAD -0.254
hsa-miR-103a-3p
MMP16
10 cancers: BLCA; BRCA; COAD; KIRP; LGG; LUAD; LUSC; PRAD; THCA; UCEC
mirMAP
TCGA BLCA -0.618; TCGA BRCA -0.41; TCGA COAD -0.304; TCGA KIRP -0.51; TCGA LGG -0.452; TCGA LUAD -0.421; TCGA LUSC -0.436; TCGA PRAD -0.579; TCGA THCA -1.085; TCGA UCEC -0.273
hsa-miR-103a-3p
NFASC
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.781; TCGA BRCA -0.336; TCGA COAD -0.542; TCGA ESCA -1.22; TCGA HNSC -0.358; TCGA KIRC -0.644; TCGA KIRP -0.829; TCGA LIHC -0.328; TCGA LUSC -0.425; TCGA PRAD -0.436; TCGA SARC -1.747; TCGA STAD -0.815; TCGA UCEC -0.731
hsa-miR-103a-3p
MECP2
10 cancers: BLCA; COAD; ESCA; KIRC; KIRP; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.084; TCGA COAD -0.135; TCGA ESCA -0.158; TCGA KIRC -0.184; TCGA KIRP -0.29; TCGA OV -0.099; TCGA PRAD -0.178; TCGA SARC -0.251; TCGA STAD -0.184; TCGA UCEC -0.149
hsa-miR-103a-3p
SGCD
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -1.691; TCGA BRCA -0.565; TCGA COAD -0.666; TCGA ESCA -1.357; TCGA HNSC -0.734; TCGA LIHC -0.608; TCGA LUAD -0.619; TCGA LUSC -0.805; TCGA PRAD -0.403; TCGA SARC -0.515; TCGA THCA -0.475; TCGA STAD -0.719; TCGA UCEC -0.349
hsa-miR-103a-3p
SYNPO
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.671; TCGA BRCA -0.293; TCGA CESC -0.413; TCGA COAD -0.224; TCGA ESCA -0.685; TCGA HNSC -0.424; TCGA LIHC -0.312; TCGA LUAD -0.275; TCGA LUSC -0.622; TCGA PRAD -0.436; TCGA SARC -0.408; TCGA THCA -0.225; TCGA STAD -0.511; TCGA UCEC -0.422
hsa-miR-103a-3p
FAM26E
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.83; TCGA BRCA -0.456; TCGA COAD -0.398; TCGA ESCA -0.663; TCGA HNSC -0.26; TCGA KIRC -0.213; TCGA KIRP -0.492; TCGA LGG -0.149; TCGA LIHC -0.17; TCGA LUAD -0.475; TCGA LUSC -0.671; TCGA PRAD -0.147; TCGA SARC -0.373; TCGA STAD -0.171; TCGA UCEC -0.358
hsa-miR-103a-3p
ZFP36L1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.344; TCGA BRCA -0.158; TCGA CESC -0.342; TCGA ESCA -0.358; TCGA HNSC -0.184; TCGA LIHC -0.162; TCGA PAAD -0.42; TCGA PRAD -0.381; TCGA THCA -0.379; TCGA STAD -0.262; TCGA UCEC -0.218
hsa-miR-103a-3p
TEAD1
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.413; TCGA BRCA -0.42; TCGA COAD -0.167; TCGA ESCA -0.296; TCGA HNSC -0.241; TCGA KIRC -0.201; TCGA KIRP -0.309; TCGA LGG -0.435; TCGA LIHC -0.193; TCGA LUAD -0.195; TCGA PRAD -0.52; TCGA SARC -0.436; TCGA THCA -0.238; TCGA STAD -0.194; TCGA UCEC -0.129
hsa-miR-103a-3p
LDOC1L
13 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.167; TCGA BRCA -0.236; TCGA KIRC -0.314; TCGA KIRP -0.286; TCGA LGG -0.247; TCGA LIHC -0.17; TCGA LUAD -0.229; TCGA OV -0.127; TCGA PRAD -0.138; TCGA SARC -0.237; TCGA THCA -0.186; TCGA STAD -0.093; TCGA UCEC -0.171
hsa-miR-103a-3p
PCGF5
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC
miRNATAP
TCGA BLCA -0.18; TCGA BRCA -0.276; TCGA ESCA -0.201; TCGA HNSC -0.204; TCGA KIRC -0.167; TCGA KIRP -0.261; TCGA LIHC -0.124; TCGA LUAD -0.249; TCGA LUSC -0.144; TCGA PRAD -0.25; TCGA SARC -0.231
hsa-miR-103a-3p
BCL2L2
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.29; TCGA BRCA -0.063; TCGA COAD -0.089; TCGA ESCA -0.379; TCGA HNSC -0.221; TCGA KIRC -0.256; TCGA PRAD -0.066; TCGA SARC -0.409; TCGA UCEC -0.135
hsa-miR-103a-3p
RASSF8
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.66; TCGA BRCA -0.386; TCGA COAD -0.429; TCGA ESCA -0.613; TCGA HNSC -0.346; TCGA KIRC -0.626; TCGA KIRP -0.438; TCGA LIHC -0.229; TCGA LUSC -0.256; TCGA OV -0.207; TCGA PRAD -0.2; TCGA SARC -0.402; TCGA STAD -0.33; TCGA UCEC -0.453
hsa-miR-103a-3p
DCLK1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.212; TCGA BRCA -0.248; TCGA COAD -0.732; TCGA ESCA -1.086; TCGA HNSC -0.401; TCGA PRAD -0.505; TCGA SARC -0.28; TCGA THCA -1.293; TCGA STAD -0.863; TCGA UCEC -0.295
hsa-miR-103a-3p
CACNA2D1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.488; TCGA BRCA -1.215; TCGA COAD -0.992; TCGA ESCA -0.758; TCGA HNSC -0.708; TCGA LUAD -0.611; TCGA LUSC -0.548; TCGA PRAD -1.34; TCGA SARC -0.724; TCGA STAD -0.653; TCGA UCEC -1.03
hsa-miR-103a-3p
NPAS3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.582; TCGA BRCA -0.357; TCGA COAD -0.904; TCGA ESCA -0.821; TCGA HNSC -0.309; TCGA KIRC -0.509; TCGA KIRP -0.643; TCGA LGG -0.309; TCGA LUSC -0.411; TCGA PRAD -0.35; TCGA THCA -0.12; TCGA STAD -0.774
hsa-miR-103a-3p
NOVA1
9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.916; TCGA CESC -0.454; TCGA COAD -1.047; TCGA ESCA -0.909; TCGA KIRP -0.247; TCGA LGG -0.343; TCGA PRAD -0.444; TCGA STAD -0.846; TCGA UCEC -0.411
hsa-miR-103a-3p
OTUD4
9 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.084; TCGA BRCA -0.306; TCGA HNSC -0.251; TCGA KIRP -0.299; TCGA LIHC -0.249; TCGA LUAD -0.097; TCGA PRAD -0.187; TCGA SARC -0.112; TCGA THCA -0.092
hsa-miR-103a-3p
NFIA
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.585; TCGA BRCA -0.267; TCGA CESC -0.221; TCGA ESCA -0.417; TCGA HNSC -0.244; TCGA LIHC -0.337; TCGA PAAD -0.395; TCGA PRAD -0.258; TCGA SARC -0.422; TCGA STAD -0.242; TCGA UCEC -0.168
hsa-miR-103a-3p
PITPNA
10 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.08; TCGA BRCA -0.133; TCGA HNSC -0.106; TCGA KIRC -0.089; TCGA LIHC -0.154; TCGA LUAD -0.068; TCGA LUSC -0.145; TCGA PRAD -0.058; TCGA STAD -0.101; TCGA UCEC -0.153
hsa-miR-103a-3p
PRKG1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.335; TCGA BRCA -0.899; TCGA CESC -0.412; TCGA COAD -0.341; TCGA ESCA -0.742; TCGA HNSC -0.713; TCGA KIRC -0.428; TCGA KIRP -0.913; TCGA LIHC -0.543; TCGA LUAD -0.626; TCGA LUSC -0.757; TCGA PRAD -1.197; TCGA SARC -0.928; TCGA STAD -0.441; TCGA UCEC -0.991
hsa-miR-103a-3p
RASL12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.015; TCGA BRCA -0.13; TCGA CESC -0.273; TCGA COAD -0.526; TCGA ESCA -0.796; TCGA HNSC -0.241; TCGA LUAD -0.26; TCGA LUSC -0.491; TCGA PRAD -0.77; TCGA SARC -1.819; TCGA STAD -0.586; TCGA UCEC -0.741
hsa-miR-103a-3p
FOXJ2
12 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.254; TCGA BRCA -0.154; TCGA CESC -0.113; TCGA COAD -0.079; TCGA KIRP -0.166; TCGA LGG -0.127; TCGA LIHC -0.138; TCGA LUAD -0.145; TCGA PRAD -0.211; TCGA SARC -0.227; TCGA STAD -0.146; TCGA UCEC -0.311
hsa-miR-103a-3p
DSEL
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.469; TCGA BRCA -0.379; TCGA COAD -0.378; TCGA ESCA -0.7; TCGA LGG -0.236; TCGA LIHC -0.613; TCGA LUAD -0.312; TCGA LUSC -0.503; TCGA THCA -0.178; TCGA STAD -0.523; TCGA UCEC -0.298
hsa-miR-103a-3p
VCL
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.446; TCGA BRCA -0.385; TCGA CESC -0.142; TCGA COAD -0.237; TCGA ESCA -0.422; TCGA HNSC -0.264; TCGA KIRC -0.245; TCGA KIRP -0.336; TCGA LUAD -0.277; TCGA LUSC -0.309; TCGA PRAD -0.751; TCGA SARC -0.765; TCGA STAD -0.281; TCGA UCEC -0.247
hsa-miR-103a-3p
ZFPM2
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.395; TCGA BRCA -0.571; TCGA COAD -0.684; TCGA ESCA -1.11; TCGA HNSC -0.426; TCGA KIRP -0.797; TCGA LGG -0.272; TCGA LIHC -0.626; TCGA LUAD -0.441; TCGA LUSC -0.737; TCGA PAAD -0.36; TCGA PRAD -0.835; TCGA SARC -0.478; TCGA THCA -0.345; TCGA STAD -0.724; TCGA UCEC -0.91
hsa-miR-103a-3p
ZFHX4
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.953; TCGA BRCA -0.545; TCGA COAD -1.079; TCGA ESCA -0.916; TCGA KIRC -0.342; TCGA LGG -0.224; TCGA PRAD -0.284; TCGA THCA -0.301; TCGA STAD -0.699
hsa-miR-103a-3p
LATS2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.545; TCGA BRCA -0.358; TCGA CESC -0.187; TCGA COAD -0.246; TCGA ESCA -0.475; TCGA HNSC -0.369; TCGA KIRC -0.113; TCGA KIRP -0.228; TCGA LIHC -0.23; TCGA LUAD -0.29; TCGA LUSC -0.429; TCGA PAAD -0.345; TCGA PRAD -0.176; TCGA STAD -0.166; TCGA UCEC -0.332
hsa-miR-103a-3p
SPTBN4
9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.408; TCGA CESC -0.307; TCGA COAD -0.396; TCGA ESCA -0.719; TCGA KIRC -0.413; TCGA LIHC -0.671; TCGA SARC -0.468; TCGA STAD -0.574; TCGA UCEC -0.294
hsa-miR-103a-3p
TSC22D3
9 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.493; TCGA CESC -0.421; TCGA COAD -0.366; TCGA ESCA -0.848; TCGA LIHC -0.539; TCGA LUSC -0.356; TCGA PRAD -0.23; TCGA STAD -0.694; TCGA UCEC -0.144
hsa-miR-103a-3p
NRP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.064; TCGA BRCA -0.324; TCGA CESC -0.38; TCGA COAD -0.448; TCGA ESCA -0.721; TCGA LGG -0.252; TCGA LIHC -0.315; TCGA LUAD -0.458; TCGA LUSC -0.594; TCGA OV -0.177; TCGA PRAD -0.587; TCGA THCA -0.219; TCGA STAD -0.552; TCGA UCEC -0.372
hsa-miR-103a-3p
PDE4B
10 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.931; TCGA BRCA -0.39; TCGA HNSC -0.354; TCGA LGG -0.156; TCGA LIHC -0.483; TCGA LUAD -0.194; TCGA LUSC -0.329; TCGA PRAD -0.166; TCGA STAD -0.308; TCGA UCEC -0.159
hsa-miR-103a-3p
FAM89A
11 cancers: BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.352; TCGA KIRC -0.267; TCGA KIRP -0.246; TCGA LIHC -0.206; TCGA LUAD -0.325; TCGA LUSC -0.25; TCGA OV -0.234; TCGA PAAD -0.212; TCGA PRAD -0.332; TCGA THCA -0.262; TCGA UCEC -0.306
hsa-miR-103a-3p
PURA
11 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.128; TCGA HNSC -0.175; TCGA KIRC -0.189; TCGA KIRP -0.313; TCGA LGG -0.177; TCGA LIHC -0.108; TCGA OV -0.099; TCGA PRAD -0.227; TCGA SARC -0.138; TCGA STAD -0.076; TCGA UCEC -0.108
hsa-miR-103a-3p
TNRC6B
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.324; TCGA HNSC -0.135; TCGA KIRC -0.1; TCGA KIRP -0.4; TCGA LGG -0.192; TCGA LIHC -0.089; TCGA PRAD -0.162; TCGA SARC -0.252; TCGA UCEC -0.124
hsa-miR-103a-3p
ZBTB8A
10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA BRCA -0.171; TCGA ESCA -0.173; TCGA KIRC -0.221; TCGA KIRP -0.333; TCGA LGG -0.083; TCGA LIHC -0.121; TCGA PAAD -0.181; TCGA PRAD -0.065; TCGA SARC -0.235; TCGA UCEC -0.101
hsa-miR-103a-3p
TGFBR3
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.57; TCGA ESCA -0.531; TCGA HNSC -0.283; TCGA KIRC -0.503; TCGA KIRP -0.37; TCGA LIHC -0.516; TCGA PRAD -0.7; TCGA SARC -0.433; TCGA STAD -0.395; TCGA UCEC -0.367
hsa-miR-103a-3p
TSPYL5
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.205; TCGA COAD -0.517; TCGA ESCA -0.559; TCGA HNSC -0.256; TCGA KIRC -0.412; TCGA LIHC -0.469; TCGA PRAD -0.365; TCGA STAD -0.352; TCGA UCEC -0.486
hsa-miR-103a-3p
ZNF662
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.228; TCGA CESC -0.682; TCGA COAD -0.787; TCGA ESCA -0.812; TCGA HNSC -0.475; TCGA KIRP -0.784; TCGA PRAD -0.296; TCGA SARC -0.479; TCGA STAD -0.731; TCGA UCEC -0.212
hsa-miR-103a-3p
MTMR3
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.205; TCGA ESCA -0.308; TCGA HNSC -0.265; TCGA KIRC -0.184; TCGA KIRP -0.276; TCGA LGG -0.191; TCGA SARC -0.194; TCGA THCA -0.07; TCGA STAD -0.101; TCGA UCEC -0.18
hsa-miR-103a-3p
PDE8B
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.326; TCGA HNSC -0.232; TCGA KIRC -0.815; TCGA KIRP -0.768; TCGA LGG -0.2; TCGA LIHC -0.413; TCGA PRAD -0.475; TCGA SARC -0.772; TCGA STAD -0.485; TCGA UCEC -0.824
hsa-miR-103a-3p
ATMIN
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD
MirTarget
TCGA BRCA -0.231; TCGA ESCA -0.133; TCGA HNSC -0.116; TCGA KIRC -0.108; TCGA KIRP -0.123; TCGA LIHC -0.21; TCGA LUAD -0.122; TCGA OV -0.065; TCGA PRAD -0.115
hsa-miR-103a-3p
ZC3H12C
11 cancers: BRCA; ESCA; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.526; TCGA ESCA -0.398; TCGA KIRP -0.173; TCGA LGG -0.196; TCGA LIHC -0.259; TCGA LUSC -0.18; TCGA OV -0.132; TCGA PRAD -0.264; TCGA SARC -0.377; TCGA STAD -0.235; TCGA UCEC -0.181
hsa-miR-103a-3p
IL17RA
9 cancers: BRCA; ESCA; LIHC; LUSC; OV; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BRCA -0.111; TCGA ESCA -0.194; TCGA LIHC -0.095; TCGA LUSC -0.109; TCGA OV -0.09; TCGA PAAD -0.169; TCGA PRAD -0.237; TCGA THCA -0.161; TCGA UCEC -0.131
hsa-miR-103a-3p
MBP
9 cancers: BRCA; CESC; HNSC; KIRC; LIHC; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.209; TCGA CESC -0.155; TCGA HNSC -0.27; TCGA KIRC -0.239; TCGA LIHC -0.147; TCGA LUSC -0.249; TCGA THCA -0.195; TCGA STAD -0.132; TCGA UCEC -0.176
hsa-miR-103a-3p
DENND1B
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD
miRNATAP
TCGA BRCA -0.41; TCGA ESCA -0.207; TCGA HNSC -0.343; TCGA KIRC -0.534; TCGA KIRP -0.633; TCGA LGG -0.26; TCGA LUAD -0.177; TCGA LUSC -0.125; TCGA PRAD -0.304
hsa-miR-103a-3p
COBLL1
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; OV; SARC; UCEC
miRNATAP
TCGA BRCA -0.564; TCGA ESCA -0.342; TCGA HNSC -0.363; TCGA KIRC -0.963; TCGA KIRP -0.643; TCGA LIHC -0.284; TCGA OV -0.165; TCGA SARC -0.938; TCGA UCEC -0.154
hsa-miR-103a-3p
CA12
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA CESC -0.779; TCGA ESCA -0.72; TCGA HNSC -0.378; TCGA KIRC -0.571; TCGA KIRP -0.914; TCGA LGG -0.379; TCGA LUSC -0.427; TCGA PAAD -1.206; TCGA PRAD -0.722; TCGA SARC -0.511; TCGA UCEC -0.566
hsa-miR-103a-3p
PPP1R11
10 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; STAD
miRNAWalker2 validate
TCGA CESC -0.094; TCGA HNSC -0.087; TCGA KIRC -0.12; TCGA KIRP -0.085; TCGA LGG -0.072; TCGA LUAD -0.106; TCGA LUSC -0.113; TCGA OV -0.061; TCGA PRAD -0.092; TCGA STAD -0.136
hsa-miR-103a-3p
BTG2
12 cancers: CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.182; TCGA COAD -0.156; TCGA ESCA -0.451; TCGA HNSC -0.232; TCGA KIRC -0.425; TCGA LGG -0.184; TCGA LUSC -0.198; TCGA PAAD -0.299; TCGA PRAD -0.367; TCGA SARC -0.46; TCGA STAD -0.481; TCGA UCEC -0.279
hsa-miR-103a-3p
MAN2B2
9 cancers: CESC; ESCA; HNSC; LIHC; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA CESC -0.151; TCGA ESCA -0.171; TCGA HNSC -0.103; TCGA LIHC -0.252; TCGA LUAD -0.117; TCGA PRAD -0.173; TCGA SARC -0.146; TCGA STAD -0.118; TCGA UCEC -0.169
hsa-miR-103a-3p
KIF13B
11 cancers: ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA ESCA -0.365; TCGA HNSC -0.34; TCGA KIRC -0.62; TCGA KIRP -0.184; TCGA LIHC -0.156; TCGA LUAD -0.193; TCGA LUSC -0.461; TCGA OV -0.11; TCGA PRAD -0.16; TCGA STAD -0.139; TCGA UCEC -0.387





Enriched cancer pathways of putative targets