microRNA information: hsa-miR-105-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-105-5p | miRbase |
| Accession: | MIMAT0000102 | miRbase |
| Precursor name: | hsa-mir-105-1 | miRbase |
| Precursor accession: | MI0000111 | miRbase |
| Symbol: | MIR105-1 | HGNC |
| RefSeq ID: | NR_029521 | GenBank |
| Sequence: | UCAAAUGCUCAGACUCCUGUGGU |
Reported expression in cancers: hsa-miR-105-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-105-5p | colorectal cancer | deregulation | "Differential expression of miRNAs in colorectal ca ......" | 22529906 | RNA-Seq |
| hsa-miR-105-5p | liver cancer | downregulation | "In the current study we found that miR-105 express ......" | 25280563 |
Reported cancer pathway affected by hsa-miR-105-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-105-5p | liver cancer | PI3K/Akt signaling pathway | "In the current study we found that miR-105 express ......" | 25280563 |
Reported cancer prognosis affected by hsa-miR-105-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-105-5p | colorectal cancer | tumorigenesis | "Differential expression of miRNAs in colorectal ca ......" | 22529906 |
Reported gene related to hsa-miR-105-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-105-5p | prostate cancer | CDK6 | "miR 105 inhibits prostate tumour growth by suppres ......" | 23950948 |