microRNA information: hsa-miR-106b-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-106b-3p | miRbase |
Accession: | MIMAT0004672 | miRbase |
Precursor name: | hsa-mir-106b | miRbase |
Precursor accession: | MI0000734 | miRbase |
Symbol: | MIR106B | HGNC |
RefSeq ID: | NR_029831 | GenBank |
Sequence: | CCGCACUGUGGGUACUUGCUGC |
Reported expression in cancers: hsa-miR-106b-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-106b-3p | bladder cancer | deregulation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | qPCR; Microarray |
hsa-miR-106b-3p | breast cancer | downregulation | "Previously it has been shown that miR-18a/b miR-25 ......" | 23144930 | qPCR |
hsa-miR-106b-3p | breast cancer | downregulation | "MicroRNA expression profiling showed miR-106b to b ......" | 24164962 | |
hsa-miR-106b-3p | breast cancer | upregulation | "Prognostic value of miR 106b expression in breast ......" | 25619461 | Reverse transcription PCR; in situ hybridization |
hsa-miR-106b-3p | breast cancer | upregulation | "MicroRNA-106b-5p miR-106b a carcinogenic miRNA is ......" | 27519168 | |
hsa-miR-106b-3p | cervical and endocervical cancer | upregulation | "MicroRNA-106b miR-106b was recently identified as ......" | 26769181 | qPCR; in situ hybridization |
hsa-miR-106b-3p | chronic myeloid leukemia | deregulation | "Some onco-miRNAs were found to be downregulated mi ......" | 25833191 | |
hsa-miR-106b-3p | colorectal cancer | upregulation | "Aberrant miR-106b expression has been reported in ......" | 26223867 | qPCR |
hsa-miR-106b-3p | endometrial cancer | downregulation | "In this pilot study we examined the expression of ......" | 25827090 | qPCR |
hsa-miR-106b-3p | gastric cancer | upregulation | "The most highly expressed miRNAs in gastric cancer ......" | 19175831 | |
hsa-miR-106b-3p | gastric cancer | upregulation | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | qPCR |
hsa-miR-106b-3p | gastric cancer | upregulation | "MicroRNAs miRNAs such as miR-17-5p miR-21 miR-106a ......" | 23267156 | |
hsa-miR-106b-3p | gastric cancer | upregulation | "We identified five miRNAs that were most consisten ......" | 24040025 | qPCR |
hsa-miR-106b-3p | head and neck cancer | deregulation | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Reverse transcription PCR |
hsa-miR-106b-3p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-106b-3p | kidney renal cell cancer | upregulation | "MicroRNA 106b functions as an oncogene in renal ce ......" | 26648244 | Microarray; qPCR; RNA-Seq |
hsa-miR-106b-3p | liver cancer | upregulation | "In this study we report that miR-106b expression i ......" | 23087084 | |
hsa-miR-106b-3p | liver cancer | upregulation | "Over expression of miR 106b promotes cell migratio ......" | 23483935 | |
hsa-miR-106b-3p | liver cancer | upregulation | "Over-expression of miR-106b was transfected by miR ......" | 25327652 | |
hsa-miR-106b-3p | liver cancer | upregulation | "Upregulation of microRNA 106b is associated with p ......" | 25466449 | qPCR |
hsa-miR-106b-3p | melanoma | upregulation | "Expression of microRNA 106b and its clinical signi ......" | 26662433 | qPCR |
Reported cancer pathway affected by hsa-miR-106b-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-106b-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "Down regualtion of miR 106b induces epithelial mes ......" | 26617763 | Luciferase |
hsa-miR-106b-3p | endometrial cancer | Epithelial mesenchymal transition pathway | "MicroRNA 106b modulates epithelial mesenchymal tra ......" | 24002805 | |
hsa-miR-106b-3p | esophageal cancer | Epithelial mesenchymal transition pathway | "MiR 106b promotes migration and invasion through e ......" | 27619676 | Transwell assay; Luciferase; Western blot |
hsa-miR-106b-3p | gastric cancer | cell cycle pathway | "To investigate the effects of miR-106b on malignan ......" | 23803041 | Flow cytometry; Transwell assay |
hsa-miR-106b-3p | head and neck cancer | cell cycle pathway | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Flow cytometry |
hsa-miR-106b-3p | kidney renal cell cancer | Apoptosis pathway | "MicroRNA 106b functions as an oncogene in renal ce ......" | 26648244 | Flow cytometry; MTT assay |
hsa-miR-106b-3p | liver cancer | Apoptosis pathway | "Role of the miR 106b 25 microRNA cluster in hepato ......" | 19486339 | |
hsa-miR-106b-3p | liver cancer | Epithelial mesenchymal transition pathway | "Over expression of miR 106b promotes cell migratio ......" | 23483935 | |
hsa-miR-106b-3p | liver cancer | cell cycle pathway | "Effects of miR 106b expression on the proliferatio ......" | 25327652 | Flow cytometry |
hsa-miR-106b-3p | lung cancer | MAPK signaling pathway | "RNA-seq data and miRNA-seq data of lung adenocarci ......" | 27338053 | |
hsa-miR-106b-3p | prostate cancer | cell cycle pathway | "Down regulation of microRNA 106b is involved in p2 ......" | 20878953 | |
hsa-miR-106b-3p | thyroid cancer | Apoptosis pathway | "microRNA 106b mediated down regulation of C1orf24 ......" | 26317551 | Luciferase |
Reported cancer prognosis affected by hsa-miR-106b-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-106b-3p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
hsa-miR-106b-3p | bladder cancer | staging | "Urinary cell free microRNA 106b as a novel biomark ......" | 25168920 | |
hsa-miR-106b-3p | breast cancer | poor survival; metastasis | "Previously it has been shown that miR-18a/b miR-25 ......" | 23144930 | |
hsa-miR-106b-3p | breast cancer | motility; metastasis | "Downregulation of miR 106b induced breast cancer c ......" | 24164962 | RNAi |
hsa-miR-106b-3p | breast cancer | metastasis; staging; progression | "MiR 106b expression determines the proliferation p ......" | 24292682 | |
hsa-miR-106b-3p | breast cancer | poor survival; recurrence | "Prognostic value of miR 106b expression in breast ......" | 25619461 | |
hsa-miR-106b-3p | breast cancer | drug resistance | "Cantharidin modulates the E2F1/MCM7 miR 106b 93/p2 ......" | 26722252 | MTT assay; Western blot |
hsa-miR-106b-3p | breast cancer | cell migration; staging; worse prognosis | "MicroRNA 106b targets FUT6 to promote cell migrati ......" | 27519168 | |
hsa-miR-106b-3p | cervical and endocervical cancer | cell migration; progression; tumorigenesis | "MicroRNA 106b is involved in transforming growth f ......" | 26769181 | Transwell assay; Western blot; Luciferase |
hsa-miR-106b-3p | colorectal cancer | cell migration; staging; metastasis; poor survival | "MicroRNA 106b promotes colorectal cancer cell migr ......" | 26223867 | MTT assay; Transwell assay; Wound Healing Assay; Western blot; Luciferase |
hsa-miR-106b-3p | colorectal cancer | drug resistance | "MiR 106b induces cell radioresistance via the PTEN ......" | 26238857 | Luciferase |
hsa-miR-106b-3p | colorectal cancer | metastasis | "Down regualtion of miR 106b induces epithelial mes ......" | 26617763 | Luciferase |
hsa-miR-106b-3p | esophageal cancer | metastasis | "MiR 106b promotes migration and invasion through e ......" | 27619676 | Transwell assay; Luciferase; Western blot |
hsa-miR-106b-3p | gastric cancer | metastasis | "Differential expression of miRNAs was studied usin ......" | 20726036 | |
hsa-miR-106b-3p | gastric cancer | metastasis; poor survival | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | |
hsa-miR-106b-3p | gastric cancer | malignant trasformation; progression | "To investigate the effects of miR-106b on malignan ......" | 23803041 | Flow cytometry; Transwell assay |
hsa-miR-106b-3p | gastric cancer | tumorigenesis | "Deregulation of the expression of these miRNAs in ......" | 24643999 | |
hsa-miR-106b-3p | gastric cancer | cell migration; worse prognosis | "MicroRNA 106b in cancer associated fibroblasts fro ......" | 24842611 | |
hsa-miR-106b-3p | gastric cancer | staging; metastasis; differentiation; progression | "Downregulation of serum miR 17 and miR 106b levels ......" | 25561770 | |
hsa-miR-106b-3p | kidney renal cell cancer | metastasis | "We examined the expression levels of selected micr ......" | 20609231 | |
hsa-miR-106b-3p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-106b-3p | kidney renal cell cancer | metastasis; cell migration | "MicroRNA 106b functions as an oncogene in renal ce ......" | 26648244 | Flow cytometry; MTT assay |
hsa-miR-106b-3p | liver cancer | metastasis; cell migration | "Over expression of miR 106b promotes cell migratio ......" | 23483935 | |
hsa-miR-106b-3p | liver cancer | metastasis | "Effects of miR 106b expression on the proliferatio ......" | 25327652 | Flow cytometry |
hsa-miR-106b-3p | liver cancer | worse prognosis; tumor size; poor survival | "Upregulation of microRNA 106b is associated with p ......" | 25466449 | |
hsa-miR-106b-3p | liver cancer | progression; poor survival; differentiation | "miR 106b promotes cancer progression in hepatitis ......" | 27298561 | |
hsa-miR-106b-3p | lung squamous cell cancer | cell migration | "MicroRNA 106b 25 cluster targets β TRCP2 increase ......" | 23611780 | Colony formation |
hsa-miR-106b-3p | lymphoma | differentiation | "We also used microarray analysis to identify a dif ......" | 21698185 | |
hsa-miR-106b-3p | melanoma | metastasis; staging; poor survival; progression; worse prognosis | "Expression of microRNA 106b and its clinical signi ......" | 26662433 | |
hsa-miR-106b-3p | pancreatic cancer | worse prognosis | "We furthermore show that hsa-miR-106b which itself ......" | 26621835 | |
hsa-miR-106b-3p | prostate cancer | drug resistance | "Down regulation of microRNA 106b is involved in p2 ......" | 20878953 | |
hsa-miR-106b-3p | prostate cancer | recurrence | "MicroRNA 106b 25 cluster expression is associated ......" | 22986525 | Western blot; Colony formation |
hsa-miR-106b-3p | prostate cancer | differentiation | "We demonstrate hypoxia promotes neuronal and neuro ......" | 24135225 | |
hsa-miR-106b-3p | prostate cancer | progression | "CIC overexpression suppressed prostate cancer cell ......" | 26124181 | RNAi |
hsa-miR-106b-3p | thyroid cancer | malignant trasformation | "microRNA 106b mediated down regulation of C1orf24 ......" | 26317551 | Luciferase |
Reported gene related to hsa-miR-106b-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-106b-3p | breast cancer | PTEN | "Cantharidin modulates the E2F1/MCM7 miR 106b 93/p2 ......" | 26722252 |
hsa-miR-106b-3p | colorectal cancer | PTEN | "We further identified PTEN and p21 as novel direct ......" | 26238857 |
hsa-miR-106b-3p | gastric cancer | PTEN | "MicroRNA 106b in cancer associated fibroblasts fro ......" | 24842611 |
hsa-miR-106b-3p | breast cancer | SMAD7 | "The miR 106b 25 cluster targets Smad7 activates TG ......" | 22286770 |
hsa-miR-106b-3p | esophageal cancer | SMAD7 | "MiR 106b promotes migration and invasion through e ......" | 27619676 |
hsa-miR-106b-3p | gastric cancer | SMAD7 | "Smad7 which inhibits transforming growth factor-β ......" | 25286029 |
hsa-miR-106b-3p | liver cancer | APC | "miR 106b downregulates adenomatous polyposis coli ......" | 23087084 |
hsa-miR-106b-3p | esophageal cancer | BRD2 | "The present study showed that miR-106b was pronoun ......" | 27619676 |
hsa-miR-106b-3p | breast cancer | BSG | "We also found that EMMPRIN could down-regulate miR ......" | 27325313 |
hsa-miR-106b-3p | prostate cancer | CASP7 | "MicroRNA 106b 25 cluster expression is associated ......" | 22986525 |
hsa-miR-106b-3p | gastric cancer | CD44 | "miR 106b modulates cancer stem cell characteristic ......" | 25286029 |
hsa-miR-106b-3p | bladder cancer | CDKN2A | "In conclusion DE-miRNAs in bladder cancer tissue s ......" | 25955758 |
hsa-miR-106b-3p | cervical and endocervical cancer | DAB2 | "The expression of the miR-106b target gene DAB2 in ......" | 26769181 |
hsa-miR-106b-3p | breast cancer | DGCR8 | "Based on the bioinformatics prediction rs417309 is ......" | 23629745 |
hsa-miR-106b-3p | colorectal cancer | DLC1 | "MicroRNA 106b promotes colorectal cancer cell migr ......" | 26223867 |
hsa-miR-106b-3p | gastric cancer | E2F1 | "In turn miR-106b and miR-93 regulate E2F1 expressi ......" | 18328430 |
hsa-miR-106b-3p | gastric cancer | E2F5 | "Overexpression of miR-106b shortened the G0/G1 pha ......" | 23803041 |
hsa-miR-106b-3p | breast cancer | ERBB2 | "High expression of miR-18a/b are strongly associat ......" | 23144930 |
hsa-miR-106b-3p | thyroid cancer | FAM129A | "microRNA 106b mediated down regulation of C1orf24 ......" | 26317551 |
hsa-miR-106b-3p | breast cancer | FUT6 | "MicroRNA 106b targets FUT6 to promote cell migrati ......" | 27519168 |
hsa-miR-106b-3p | colorectal cancer | INSR | "We found overexpression of miR-106b could induce r ......" | 26238857 |
hsa-miR-106b-3p | pancreatic cancer | ITCH | "We furthermore show that hsa-miR-106b which itself ......" | 26621835 |
hsa-miR-106b-3p | breast cancer | JUN | "TGF-β1 enhances the transcription of miR-106b via ......" | 24292682 |
hsa-miR-106b-3p | breast cancer | MCM7 | "TGF-β1 enhances the transcription of miR-106b via ......" | 24292682 |
hsa-miR-106b-3p | breast cancer | MMP2 | "Downregulation of miR 106b induced breast cancer c ......" | 24164962 |
hsa-miR-106b-3p | liver cancer | PPFIA3 | "The differentially expressed hsa-miR-106b was chos ......" | 25916067 |
hsa-miR-106b-3p | colorectal cancer | PRRX1 | "Down regualtion of miR 106b induces epithelial mes ......" | 26617763 |
hsa-miR-106b-3p | liver cancer | PTPRT | "The differentially expressed hsa-miR-106b was chos ......" | 25916067 |
hsa-miR-106b-3p | liver cancer | RHOA | "Further functional studies demonstrated that miR-1 ......" | 23483935 |
hsa-miR-106b-3p | liver cancer | RHOC | "Further functional studies demonstrated that miR-1 ......" | 23483935 |
hsa-miR-106b-3p | kidney renal cell cancer | SETD2 | "miR 106b 5p targets tumor suppressor gene SETD2 to ......" | 25714014 |
hsa-miR-106b-3p | breast cancer | SIX1 | "The miR 106b 25 cluster targets Smad7 activates TG ......" | 22286770 |
hsa-miR-106b-3p | lung squamous cell cancer | SNAI1 | "MicroRNA 106b 25 cluster targets β TRCP2 increase ......" | 23611780 |
hsa-miR-106b-3p | breast cancer | STAT3 | "We also found that EMMPRIN could down-regulate miR ......" | 27325313 |
hsa-miR-106b-3p | thyroid cancer | TPCN1 | "To demonstrate that miR-106b reduces C1orf24 expre ......" | 26317551 |
hsa-miR-106b-3p | endometrial cancer | TWIST1 | "MicroRNA 106b modulates epithelial mesenchymal tra ......" | 24002805 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-106b-3p | FOXO1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.224; TCGA BRCA -0.118; TCGA CESC -0.192; TCGA COAD -0.297; TCGA ESCA -0.317; TCGA KIRC -0.346; TCGA KIRP -0.17; TCGA LIHC -0.354; TCGA LUAD -0.119; TCGA LUSC -0.122; TCGA PAAD -0.302; TCGA PRAD -0.192; TCGA STAD -0.155; TCGA UCEC -0.429 |
hsa-miR-106b-3p | KIAA0232 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.14; TCGA BRCA -0.25; TCGA CESC -0.088; TCGA ESCA -0.197; TCGA HNSC -0.149; TCGA KIRC -0.303; TCGA KIRP -0.15; TCGA LIHC -0.121; TCGA LUSC -0.091; TCGA STAD -0.204; TCGA UCEC -0.141 |
hsa-miR-106b-3p | MECP2 | 9 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.069; TCGA BRCA -0.087; TCGA ESCA -0.074; TCGA KIRC -0.139; TCGA KIRP -0.07; TCGA SARC -0.159; TCGA THCA -0.053; TCGA STAD -0.147; TCGA UCEC -0.173 |
hsa-miR-106b-3p | TNRC6C | 9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.159; TCGA BRCA -0.252; TCGA CESC -0.149; TCGA ESCA -0.205; TCGA KIRC -0.067; TCGA LIHC -0.105; TCGA PAAD -0.25; TCGA STAD -0.234; TCGA UCEC -0.217 |
hsa-miR-106b-3p | UQCR11 | 10 cancers: BRCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.127; TCGA HNSC -0.207; TCGA KIRC -0.167; TCGA LUAD -0.07; TCGA OV -0.336; TCGA PAAD -0.174; TCGA PRAD -0.128; TCGA SARC -0.118; TCGA THCA -0.136; TCGA STAD -0.095 |
Enriched cancer pathways of putative targets