microRNA information: hsa-miR-10a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-10a-5p | miRbase |
Accession: | MIMAT0000253 | miRbase |
Precursor name: | hsa-mir-10a | miRbase |
Precursor accession: | MI0000266 | miRbase |
Symbol: | MIR10A | HGNC |
RefSeq ID: | NR_029608 | GenBank |
Sequence: | UACCCUGUAGAUCCGAAUUUGUG |
Reported expression in cancers: hsa-miR-10a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-10a-5p | acute myeloid leukemia | downregulation | "The differentially expressed microRNAs miRNAs miR ......" | 22967414 | qPCR; Microarray |
hsa-miR-10a-5p | acute myeloid leukemia | upregulation | "Serum level of miR 10 5p as a prognostic biomarker ......" | 26134365 | |
hsa-miR-10a-5p | cervical and endocervical cancer | upregulation | "Vote-counting analysis showed that up-regulation w ......" | 25920605 | |
hsa-miR-10a-5p | cervical and endocervical cancer | upregulation | "Upregulation of miR 20a and miR 10a expression lev ......" | 26427662 | qPCR |
hsa-miR-10a-5p | gastric cancer | deregulation | "miRNA expression profile in primary gastric cancer ......" | 22969895 | Microarray |
hsa-miR-10a-5p | head and neck cancer | deregulation | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Reverse transcription PCR |
hsa-miR-10a-5p | liver cancer | downregulation | "Because understanding the pathogenesis of viral-as ......" | 18307259 | qPCR |
hsa-miR-10a-5p | liver cancer | downregulation | "Expression levels of three identified miRNAs miR-1 ......" | 22976466 | |
hsa-miR-10a-5p | lung squamous cell cancer | deregulation | "We further validated our results by RT-qPCR for di ......" | 23756108 | qPCR |
hsa-miR-10a-5p | lung squamous cell cancer | deregulation | "Other miRNAs including miR-5100 and miR-650 were u ......" | 26870288 | |
hsa-miR-10a-5p | lymphoma | downregulation | "The expression levels of miR-10a and miR-342-3p we ......" | 26870215 | |
hsa-miR-10a-5p | pancreatic cancer | upregulation | "Retinoic acid receptor antagonists inhibit miR 10a ......" | 19747919 | Northern blot |
hsa-miR-10a-5p | prostate cancer | deregulation | "RESULTS A total of 162 miRNAs were differentially ......" | 26628405 | |
hsa-miR-10a-5p | thyroid cancer | downregulation | "Interestingly miR-152-3p miR-185-5p and miR-574-3p ......" | 27586203 |
Reported cancer pathway affected by hsa-miR-10a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-10a-5p | head and neck cancer | cell cycle pathway | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Flow cytometry |
Reported cancer prognosis affected by hsa-miR-10a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-10a-5p | acute myeloid leukemia | drug resistance; malignant trasformation | "MicroRNA 10a expression in FAB different subtype o ......" | 25687041 | |
hsa-miR-10a-5p | acute myeloid leukemia | poor survival | "Serum level of miR 10 5p as a prognostic biomarker ......" | 26134365 | |
hsa-miR-10a-5p | bladder cancer | poor survival | "miR-100 was under expressed in 100% of low grade p ......" | 22999546 | |
hsa-miR-10a-5p | bladder cancer | malignant trasformation | "Analyses in human urothelial cells identify methyl ......" | 23867826 | |
hsa-miR-10a-5p | bladder cancer | staging; progression; malignant trasformation | "Formalin-fixed paraffin-embedded samples of 44 Ta ......" | 24439061 | |
hsa-miR-10a-5p | breast cancer | metastasis | "Real Time RT-PCR was performed to identify the miR ......" | 22524830 | |
hsa-miR-10a-5p | breast cancer | poor survival | "Increased expression of miR 126 and miR 10a predic ......" | 23968733 | |
hsa-miR-10a-5p | breast cancer | recurrence | "Using microarray-based technology we have performe ......" | 24632820 | |
hsa-miR-10a-5p | breast cancer | malignant trasformation | "MicroRNA 10a is reduced in breast cancer and regul ......" | 25934412 | |
hsa-miR-10a-5p | breast cancer | drug resistance | "The few available studies investigating microRNA i ......" | 26473850 | |
hsa-miR-10a-5p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
hsa-miR-10a-5p | cervical and endocervical cancer | progression; worse prognosis; poor survival; staging | "Upregulation of miR 20a and miR 10a expression lev ......" | 26427662 | |
hsa-miR-10a-5p | esophageal cancer | cell migration | "To reveal miRNAs' signatures of ESCC we analyzed m ......" | 20588024 | |
hsa-miR-10a-5p | gastric cancer | metastasis; tumorigenesis | "miRNA expression profile in primary gastric cancer ......" | 22969895 | |
hsa-miR-10a-5p | glioblastoma | drug resistance | "miR 195 miR 455 3p and miR 10a * are implicated in ......" | 20444541 | |
hsa-miR-10a-5p | head and neck cancer | poor survival | "Taken together these findings strongly support the ......" | 27002147 | |
hsa-miR-10a-5p | liver cancer | malignant trasformation; worse prognosis | "Because understanding the pathogenesis of viral-as ......" | 18307259 | |
hsa-miR-10a-5p | liver cancer | metastasis | "Long non coding RNA TUSC7 acts a molecular sponge ......" | 27002617 | |
hsa-miR-10a-5p | lung cancer | drug resistance | "MicroRNA 10a silencing reverses cisplatin resistan ......" | 25586740 | |
hsa-miR-10a-5p | ovarian cancer | drug resistance | "Of these 10 miRNAs miR-193a-5p miR-375 miR-339-3p ......" | 26485143 | |
hsa-miR-10a-5p | pancreatic cancer | metastasis | "Retinoic acid receptor antagonists inhibit miR 10a ......" | 19747919 | |
hsa-miR-10a-5p | pancreatic cancer | malignant trasformation | "miR-148a/b and miR-375 expression were found decre ......" | 21738581 |
Reported gene related to hsa-miR-10a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-10a-5p | gastric cancer | HOXA1 | "Bioinformatic and immunoblot analysis indicated th ......" | 24498243 |
hsa-miR-10a-5p | pancreatic cancer | HOXA1 | "MicroRNA 10a is overexpressed in human pancreatic ......" | 22407312 |
hsa-miR-10a-5p | acute myeloid leukemia | BCL6 | "Luciferase reporter assay was used to analyze the ......" | 26590574 |
hsa-miR-10a-5p | cervical and endocervical cancer | CHL1 | "MicroRNA 10a targets CHL1 and promotes cell growth ......" | 22634495 |
hsa-miR-10a-5p | acute myeloid leukemia | FANCB | "MicroRNA 10a expression in FAB different subtype o ......" | 25687041 |
hsa-miR-10a-5p | pancreatic cancer | FGFR1 | "Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......" | 21738581 |
hsa-miR-10a-5p | pancreatic cancer | HOXB1 | "These findings suggest that miR-10a is a key media ......" | 19747919 |
hsa-miR-10a-5p | pancreatic cancer | HOXB3 | "These findings suggest that miR-10a is a key media ......" | 19747919 |
hsa-miR-10a-5p | liver cancer | HOXB4 | "The concordance for HOXB4 methylation alteration a ......" | 22976466 |
hsa-miR-10a-5p | gastric cancer | HOXD10 | "While in GES-1 cells miR-10 overexpression resulte ......" | 22293682 |
hsa-miR-10a-5p | breast cancer | HOXD4 | "Here we show that microRNA-10a miR-10a targets a h ......" | 19232136 |
hsa-miR-10a-5p | acute myeloid leukemia | MDM4 | "miR 10a overexpression is associated with NPM1 mut ......" | 21784052 |
hsa-miR-10a-5p | pancreatic cancer | MLH1 | "Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......" | 21738581 |
hsa-miR-10a-5p | acute myeloid leukemia | NPM1 | "miR 10a overexpression is associated with NPM1 mut ......" | 21784052 |
hsa-miR-10a-5p | bladder cancer | PTCRA | "miR-100 was under expressed in 100% of low grade p ......" | 22999546 |
hsa-miR-10a-5p | lymphoma | TIAM1 | "Expression of microRNA 10a microRNA 342 3p and the ......" | 26870215 |
hsa-miR-10a-5p | liver cancer | TUSC7 | "Long non coding RNA TUSC7 acts a molecular sponge ......" | 27002617 |
hsa-miR-10a-5p | chronic myeloid leukemia | USF2 | "Down regulation of hsa miR 10a in chronic myeloid ......" | 19074828 |
hsa-miR-10a-5p | thyroid cancer | YAP1 | "Overexpression of miR 10a and miR 375 and downregu ......" | 23685355 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-10a-5p | NT5DC3 | 9 cancers: BLCA; BRCA; KIRC; LGG; LIHC; LUAD; LUSC; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.278; TCGA BRCA -0.058; TCGA KIRC -0.826; TCGA LGG -0.065; TCGA LIHC -0.16; TCGA LUAD -0.076; TCGA LUSC -0.219; TCGA SARC -0.227; TCGA UCEC -0.11 |
hsa-miR-10a-5p | SCD | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.121; TCGA CESC -0.206; TCGA ESCA -0.336; TCGA HNSC -0.129; TCGA KIRC -1.115; TCGA KIRP -0.295; TCGA LGG -0.165; TCGA LIHC -0.331; TCGA LUAD -0.177; TCGA PRAD -0.3; TCGA STAD -0.23 |
hsa-miR-10a-5p | SLC3A2 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; PAAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.093; TCGA BRCA -0.113; TCGA CESC -0.141; TCGA ESCA -0.433; TCGA HNSC -0.106; TCGA LIHC -0.095; TCGA LUSC -0.367; TCGA PAAD -0.193; TCGA THCA -0.09; TCGA STAD -0.115 |
hsa-miR-10a-5p | LRP12 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PAAD; SARC; UCEC | MirTarget | TCGA BLCA -0.149; TCGA BRCA -0.086; TCGA CESC -0.095; TCGA COAD -0.221; TCGA ESCA -0.727; TCGA LUSC -0.325; TCGA PAAD -0.255; TCGA SARC -0.122; TCGA UCEC -0.066 |
hsa-miR-10a-5p | MAP4K4 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; PRAD; STAD | MirTarget | TCGA BLCA -0.148; TCGA BRCA -0.069; TCGA CESC -0.129; TCGA COAD -0.071; TCGA ESCA -0.24; TCGA HNSC -0.105; TCGA KIRC -0.336; TCGA LGG -0.062; TCGA PRAD -0.066; TCGA STAD -0.133 |
hsa-miR-10a-5p | MAPKBP1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.079; TCGA CESC -0.319; TCGA COAD -0.161; TCGA ESCA -0.331; TCGA HNSC -0.132; TCGA LUSC -0.192; TCGA PAAD -0.19; TCGA SARC -0.194; TCGA UCEC -0.065 |
hsa-miR-10a-5p | IFFO2 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; SARC; STAD | MirTarget | TCGA BLCA -0.242; TCGA BRCA -0.074; TCGA CESC -0.297; TCGA COAD -0.124; TCGA ESCA -0.412; TCGA HNSC -0.212; TCGA KIRC -0.346; TCGA KIRP -0.152; TCGA SARC -0.132; TCGA STAD -0.216 |
hsa-miR-10a-5p | KIF1B | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; PAAD; PRAD; SARC | mirMAP | TCGA BLCA -0.133; TCGA BRCA -0.073; TCGA CESC -0.109; TCGA HNSC -0.113; TCGA LGG -0.086; TCGA LUAD -0.069; TCGA PAAD -0.133; TCGA PRAD -0.068; TCGA SARC -0.107 |
hsa-miR-10a-5p | NCS1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; SARC; UCEC | mirMAP | TCGA BLCA -0.317; TCGA BRCA -0.202; TCGA CESC -0.262; TCGA COAD -0.271; TCGA ESCA -0.492; TCGA HNSC -0.075; TCGA LUSC -0.298; TCGA PAAD -0.204; TCGA SARC -0.201; TCGA UCEC -0.112 |
hsa-miR-10a-5p | DUSP7 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.119; TCGA BRCA -0.081; TCGA CESC -0.432; TCGA ESCA -0.501; TCGA HNSC -0.141; TCGA KIRC -0.101; TCGA LGG -0.051; TCGA LUAD -0.137; TCGA LUSC -0.249; TCGA STAD -0.153; TCGA UCEC -0.096 |
hsa-miR-10a-5p | FOXK1 | 11 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC | mirMAP | TCGA BLCA -0.11; TCGA BRCA -0.06; TCGA CESC -0.193; TCGA HNSC -0.062; TCGA LIHC -0.098; TCGA LUAD -0.133; TCGA LUSC -0.112; TCGA OV -0.068; TCGA PAAD -0.262; TCGA SARC -0.141; TCGA UCEC -0.079 |
hsa-miR-10a-5p | CHST11 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; UCEC | mirMAP | TCGA BLCA -0.486; TCGA BRCA -0.165; TCGA CESC -0.309; TCGA COAD -0.38; TCGA ESCA -0.538; TCGA HNSC -0.168; TCGA KIRC -0.715; TCGA KIRP -0.201; TCGA UCEC -0.137 |
hsa-miR-10a-5p | NRARP | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUSC; OV; PRAD; UCEC | mirMAP | TCGA BLCA -0.219; TCGA BRCA -0.099; TCGA CESC -0.196; TCGA ESCA -0.154; TCGA KIRC -0.26; TCGA LGG -0.139; TCGA LUSC -0.458; TCGA OV -0.08; TCGA PRAD -0.082; TCGA UCEC -0.056 |
hsa-miR-10a-5p | FHL3 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; SARC; UCEC | miRNATAP | TCGA BLCA -0.15; TCGA BRCA -0.08; TCGA CESC -0.164; TCGA COAD -0.222; TCGA ESCA -0.223; TCGA HNSC -0.069; TCGA KIRC -0.182; TCGA SARC -0.155; TCGA UCEC -0.098 |
hsa-miR-10a-5p | NAA15 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.053; TCGA BRCA -0.074; TCGA CESC -0.077; TCGA ESCA -0.099; TCGA HNSC -0.061; TCGA KIRC -0.087; TCGA LUSC -0.175; TCGA PRAD -0.055; TCGA SARC -0.072; TCGA STAD -0.094 |
hsa-miR-10a-5p | IER3IP1 | 9 cancers: BRCA; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA | miRNAWalker2 validate | TCGA BRCA -0.067; TCGA ESCA -0.139; TCGA KIRP -0.077; TCGA LIHC -0.104; TCGA LUAD -0.077; TCGA LUSC -0.131; TCGA PAAD -0.276; TCGA PRAD -0.076; TCGA THCA -0.088 |
hsa-miR-10a-5p | NOP2 | 9 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD | miRNAWalker2 validate | TCGA BRCA -0.198; TCGA CESC -0.102; TCGA ESCA -0.204; TCGA KIRC -0.263; TCGA KIRP -0.082; TCGA LIHC -0.15; TCGA LUAD -0.076; TCGA LUSC -0.4; TCGA PRAD -0.072 |
hsa-miR-10a-5p | PHB2 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; THCA | miRNAWalker2 validate | TCGA BRCA -0.093; TCGA ESCA -0.196; TCGA KIRC -0.12; TCGA KIRP -0.079; TCGA LGG -0.059; TCGA LIHC -0.063; TCGA LUSC -0.166; TCGA PAAD -0.152; TCGA PRAD -0.08; TCGA THCA -0.053 |
hsa-miR-10a-5p | CTNNBIP1 | 9 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; PAAD; PRAD; THCA | miRNATAP | TCGA BRCA -0.074; TCGA CESC -0.127; TCGA ESCA -0.32; TCGA HNSC -0.131; TCGA LGG -0.052; TCGA LIHC -0.118; TCGA PAAD -0.109; TCGA PRAD -0.097; TCGA THCA -0.053 |
hsa-miR-10a-5p | RAB18 | 11 cancers: CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA CESC -0.094; TCGA ESCA -0.164; TCGA HNSC -0.079; TCGA LGG -0.107; TCGA LUAD -0.092; TCGA LUSC -0.128; TCGA PAAD -0.066; TCGA PRAD -0.058; TCGA SARC -0.066; TCGA THCA -0.057; TCGA UCEC -0.056 |
Enriched cancer pathways of putative targets