microRNA information: hsa-miR-10b-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-10b-3p | miRbase |
| Accession: | MIMAT0004556 | miRbase |
| Precursor name: | hsa-mir-10b | miRbase |
| Precursor accession: | MI0000267 | miRbase |
| Symbol: | MIR10B | HGNC |
| RefSeq ID: | NR_029609 | GenBank |
| Sequence: | ACAGAUUCGAUUCUAGGGGAAU |
Reported expression in cancers: hsa-miR-10b-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-10b-3p | bladder cancer | upregulation | "The present study was performed to investigate the ......" | 24573354 | |
| hsa-miR-10b-3p | breast cancer | upregulation | "Tumour invasion and metastasis initiated by microR ......" | 17898713 | |
| hsa-miR-10b-3p | breast cancer | upregulation | "Recent studies have suggested that microRNA-10b mi ......" | 22847191 | |
| hsa-miR-10b-3p | breast cancer | upregulation | "Critical role of miR 10b in transforming growth fa ......" | 24457988 | |
| hsa-miR-10b-3p | breast cancer | upregulation | "Up regulation of microRNA 10b is associated with t ......" | 25075255 | qPCR |
| hsa-miR-10b-3p | breast cancer | upregulation | "With an eye to identify novel targets for the trea ......" | 26206152 | |
| hsa-miR-10b-3p | breast cancer | upregulation | "Prognostic significance of microRNA 10b overexpres ......" | 27173192 | |
| hsa-miR-10b-3p | breast cancer | upregulation | "Specifically in breast cancer upregulation of miR- ......" | 27494896 | |
| hsa-miR-10b-3p | cervical and endocervical cancer | downregulation | "The Downregulation of MicroRNA 10b and its Role in ......" | 27296950 | |
| hsa-miR-10b-3p | colorectal cancer | upregulation | "Increased expression of miR-10b was also associate ......" | 21739196 | |
| hsa-miR-10b-3p | colorectal cancer | upregulation | "Up regulation of mir 10b predicate advanced clinic ......" | 27592860 | qPCR |
| hsa-miR-10b-3p | endometrial cancer | deregulation | "A set of EEC-associated miRNAs in tissue and plasm ......" | 24491411 | RNA-Seq |
| hsa-miR-10b-3p | gastric cancer | upregulation | "Clinicopathologic significance of miR 10b expressi ......" | 23351547 | |
| hsa-miR-10b-3p | gastric cancer | downregulation | "DNA methylation downregulated mir 10b acts as a tu ......" | 24481854 | qPCR |
| hsa-miR-10b-3p | glioblastoma | upregulation | "An analysis of The Cancer Genome Atlas data reveal ......" | 23307328 | |
| hsa-miR-10b-3p | head and neck cancer | downregulation | "MicroRNA expression profile in head and neck cance ......" | 24209638 | Microarray |
| hsa-miR-10b-3p | liver cancer | upregulation | "MicroRNA-10b miR-10b was recently reported to be d ......" | 22528944 | qPCR |
| hsa-miR-10b-3p | liver cancer | upregulation | "Recently miR-10b is identified as a miRNA highly e ......" | 25236186 | qPCR |
| hsa-miR-10b-3p | lung squamous cell cancer | upregulation | "Additionally miR-10b is highly expressed in progre ......" | 24198203 | |
| hsa-miR-10b-3p | lung squamous cell cancer | upregulation | "We compared the expression levels of miR-10b in 73 ......" | 25214146 | qPCR |
| hsa-miR-10b-3p | prostate cancer | upregulation | "Loss of 18 miRNAs e.g.miR-34c miR-29b miR-212 and ......" | 23781281 | |
| hsa-miR-10b-3p | sarcoma | deregulation | "Here we profiled miRNA expression of chondrosarcom ......" | 23940002 | qPCR; Microarray |
| hsa-miR-10b-3p | thyroid cancer | upregulation | "The miR 221/222 cluster miR 10b and miR 92a are hi ......" | 23563786 | qPCR |
Reported cancer pathway affected by hsa-miR-10b-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-10b-3p | breast cancer | Epithelial mesenchymal transition pathway | "Critical role of miR 10b in transforming growth fa ......" | 24457988 | |
| hsa-miR-10b-3p | breast cancer | Apoptosis pathway | "Based on the results obtained in the last decade s ......" | 26199650 | |
| hsa-miR-10b-3p | breast cancer | Epithelial mesenchymal transition pathway | "miR 10b expression in breast cancer stem cells sup ......" | 27113763 | Western blot; Luciferase |
| hsa-miR-10b-3p | endometrial cancer | Apoptosis pathway | "miR 10b Inhibits Apoptosis and Promotes Proliferat ......" | 27447302 | Luciferase |
| hsa-miR-10b-3p | gastric cancer | PI3K/Akt signaling pathway | "miR 10b promotes cell invasion through RhoC AKT si ......" | 22293682 | |
| hsa-miR-10b-3p | gastric cancer | Apoptosis pathway | "DNA methylation downregulated mir 10b acts as a tu ......" | 24481854 | |
| hsa-miR-10b-3p | glioblastoma | Apoptosis pathway | "MicroRNA 10b pleiotropically regulates invasion an ......" | 23034333 | |
| hsa-miR-10b-3p | glioblastoma | cell cycle pathway | "MicroRNA-21 miR-21 and microRNA-10b miR-10b are on ......" | 27508339 | |
| hsa-miR-10b-3p | liver cancer | cell cycle pathway | "miR 10b exerts oncogenic activity in human hepatoc ......" | 27756250 | Colony formation; Luciferase |
| hsa-miR-10b-3p | lung squamous cell cancer | Apoptosis pathway; cell cycle pathway | "microRNA miR 10b inhibition reduces cell prolifera ......" | 25988292 | Flow cytometry; Western blot |
| hsa-miR-10b-3p | pancreatic cancer | Epithelial mesenchymal transition pathway | "microRNA 10b enhances pancreatic cancer cell invas ......" | 24096486 | Luciferase |
| hsa-miR-10b-3p | retinoblastoma | cell cycle pathway | "To investigate differential expression of microRNA ......" | 21941147 | |
| hsa-miR-10b-3p | sarcoma | Apoptosis pathway | "miR 10b promotes invasion by targeting KLF4 in ost ......" | 27764757 | Flow cytometry; Transwell assay; Wound Healing Assay; Luciferase |
Reported cancer prognosis affected by hsa-miR-10b-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-10b-3p | bladder cancer | cell migration; metastasis | "MicroRNA 10b promotes migration and invasion throu ......" | 24573354 | Transwell assay; Luciferase |
| hsa-miR-10b-3p | breast cancer | metastasis; cell migration; progression | "Tumour invasion and metastasis initiated by microR ......" | 17898713 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "The first proves that miR-10b indirectly activates ......" | 18373886 | |
| hsa-miR-10b-3p | breast cancer | malignant trasformation | "Real-time quantitative PCR RQ-PCR is a sensitive a ......" | 18718003 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "MicroRNA arrays were done comparing small RNAs tha ......" | 19585508 | |
| hsa-miR-10b-3p | breast cancer | progression | "Hyaluronan CD44 interaction promotes c Src mediate ......" | 20843787 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "The relative concentrations of breast cancer-assoc ......" | 21047409 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "Role of miR 10b in breast cancer metastasis; In pa ......" | 21067538 | |
| hsa-miR-10b-3p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-10b-3p | breast cancer | cell migration | "Cysteine rich 61 connective tissue growth factor n ......" | 22020939 | |
| hsa-miR-10b-3p | breast cancer | cell migration | "Delivery of MicroRNA 10b with Polylysine Nanoparti ......" | 22259248 | Wound Healing Assay |
| hsa-miR-10b-3p | breast cancer | metastasis | "Real Time RT-PCR was performed to identify the miR ......" | 22524830 | |
| hsa-miR-10b-3p | breast cancer | motility; cell migration | "Targeting of syndecan 1 by microRNA miR 10b promot ......" | 22573479 | Flow cytometry; Luciferase; Western blot |
| hsa-miR-10b-3p | breast cancer | metastasis; staging; tumor size; progression | "MicroRNA 10b targets E cadherin and modulates brea ......" | 22847191 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "Serum overexpression of microRNA 10b in patients w ......" | 22906258 | |
| hsa-miR-10b-3p | breast cancer | progression | "MiR-10b expression was significantly higher in MFP ......" | 23226290 | |
| hsa-miR-10b-3p | breast cancer | metastasis; differentiation | "We hypothesized that miR-10b and miR-373 which are ......" | 23238818 | |
| hsa-miR-10b-3p | breast cancer | progression | "Using quantitative TaqMan MicroRNA PCR we measured ......" | 23748853 | |
| hsa-miR-10b-3p | breast cancer | staging; metastasis | "None of the investigated single miRNAs or miRNA cl ......" | 24196612 | |
| hsa-miR-10b-3p | breast cancer | metastasis; malignant trasformation | "The overexpression of miR-21 miR-10b and miR-19a i ......" | 24416156 | |
| hsa-miR-10b-3p | breast cancer | metastasis; progression | "Evaluation of microRNA 10b prognostic significance ......" | 24897960 | |
| hsa-miR-10b-3p | breast cancer | metastasis; tumor size | "Stem-loop real-time RT-PCR was used to detect the ......" | 25047098 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "Up regulation of microRNA 10b is associated with t ......" | 25075255 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "The objective of the present study is to evaluate ......" | 25369070 | |
| hsa-miR-10b-3p | breast cancer | malignant trasformation | "Exosome mediated transfer of miR 10b promotes cell ......" | 25428807 | Western blot; Luciferase |
| hsa-miR-10b-3p | breast cancer | poor survival | "MicroRNA 10b and minichromosome maintenance comple ......" | 25596707 | |
| hsa-miR-10b-3p | breast cancer | metastasis | "Using real-time quantitative polymerase chain reac ......" | 26124926 | |
| hsa-miR-10b-3p | breast cancer | metastasis; worse prognosis | "Based on the results obtained in the last decade s ......" | 26199650 | |
| hsa-miR-10b-3p | breast cancer | drug resistance; metastasis | "Functional role of miR 10b in tamoxifen resistance ......" | 26206152 | Luciferase |
| hsa-miR-10b-3p | breast cancer | metastasis | "Overexpression of Metastatic Related MicroRNAs Mir ......" | 26236665 | MTT assay |
| hsa-miR-10b-3p | breast cancer | metastasis | "Combining miR 10b Targeted Nanotherapy with Low Do ......" | 26359455 | |
| hsa-miR-10b-3p | breast cancer | metastasis; poor survival | "miR 10b expression in breast cancer stem cells sup ......" | 27113763 | Western blot; Luciferase |
| hsa-miR-10b-3p | breast cancer | staging; poor survival | "Prognostic significance of microRNA 10b overexpres ......" | 27173192 | |
| hsa-miR-10b-3p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
| hsa-miR-10b-3p | breast cancer | progression | "MicroRNA 10b promotes abnormal expression of the p ......" | 27494896 | |
| hsa-miR-10b-3p | cervical and endocervical cancer | staging; poor survival | "Our findings showed that elevated expression of mi ......" | 26427662 | |
| hsa-miR-10b-3p | cervical and endocervical cancer | staging; tumorigenesis; progression | "The Downregulation of MicroRNA 10b and its Role in ......" | 27296950 | |
| hsa-miR-10b-3p | colorectal cancer | staging; progression | "Increased expression of miR-10b was also associate ......" | 21739196 | |
| hsa-miR-10b-3p | colorectal cancer | drug resistance; worse prognosis; poor survival | "MicroRNA 10b is a prognostic indicator in colorect ......" | 22322955 | |
| hsa-miR-10b-3p | colorectal cancer | metastasis | "Four miRNAs downregulated in LM let-7i miR-10b miR ......" | 25663689 | |
| hsa-miR-10b-3p | colorectal cancer | cell migration; metastasis; staging | "miR 10b promotes invasion by targeting HOXD10 in c ......" | 27347170 | |
| hsa-miR-10b-3p | colorectal cancer | metastasis | "Secondly validation of the results was carried out ......" | 27365381 | |
| hsa-miR-10b-3p | colorectal cancer | staging; metastasis; poor survival; differentiation; worse prognosis | "Up regulation of mir 10b predicate advanced clinic ......" | 27592860 | |
| hsa-miR-10b-3p | endometrial cancer | metastasis | "miR 10b Inhibits Apoptosis and Promotes Proliferat ......" | 27447302 | Luciferase |
| hsa-miR-10b-3p | esophageal cancer | motility; cell migration; metastasis | "MicroRNA 10b promotes migration and invasion throu ......" | 20075075 | |
| hsa-miR-10b-3p | gastric cancer | poor survival | "Several microarray studies have reported microRNA ......" | 19951901 | |
| hsa-miR-10b-3p | gastric cancer | metastasis; differentiation | "miR 10b promotes cell invasion through RhoC AKT si ......" | 22293682 | |
| hsa-miR-10b-3p | gastric cancer | staging; metastasis; worse prognosis; poor survival; progression | "Clinicopathologic significance of miR 10b expressi ......" | 23351547 | |
| hsa-miR-10b-3p | gastric cancer | cell migration; tumorigenesis; metastasis | "DNA methylation downregulated mir 10b acts as a tu ......" | 24481854 | |
| hsa-miR-10b-3p | gastric cancer | progression; tumorigenesis; worse prognosis | "MicroRNA 10b promotes migration and invasion throu ......" | 26311318 | |
| hsa-miR-10b-3p | glioblastoma | metastasis | "We determined CSF levels of several cancer-associa ......" | 22492962 | |
| hsa-miR-10b-3p | glioblastoma | worse prognosis; cell migration; recurrence; drug resistance | "Oncogenic effects of miR 10b in glioblastoma stem ......" | 23307328 | |
| hsa-miR-10b-3p | glioblastoma | drug resistance | "MicroRNA 10b inhibition reduces E2F1 mediated tran ......" | 25738367 | |
| hsa-miR-10b-3p | head and neck cancer | staging; differentiation; tumor size | "Three hypoxia-related microRNAs hsa-miR-210 hsa-mi ......" | 20187102 | |
| hsa-miR-10b-3p | head and neck cancer | poor survival | "Further analyses indicate that the stimulation of ......" | 27002147 | |
| hsa-miR-10b-3p | kidney renal cell cancer | metastasis; staging | "We used the microarray technology to profile miRNA ......" | 22623952 | |
| hsa-miR-10b-3p | liver cancer | malignant trasformation | "Our study identified and validated miR-224 overexp ......" | 18433021 | |
| hsa-miR-10b-3p | liver cancer | metastasis; worse prognosis; poor survival; cell migration; motility | "MicroRNA 10b promotes migration and invasion throu ......" | 22528944 | Luciferase; Western blot |
| hsa-miR-10b-3p | liver cancer | cell migration; staging; motility | "miR 10b is overexpressed in hepatocellular carcino ......" | 25236186 | Wound Healing Assay; Luciferase |
| hsa-miR-10b-3p | lung cancer | metastasis | "Effects of MicroRNA 10b on lung cancer cell prolif ......" | 25063061 | Western blot; Cell proliferation assay; Cell Proliferation Assay |
| hsa-miR-10b-3p | lung squamous cell cancer | progression; poor survival | "Additionally miR-10b is highly expressed in progre ......" | 24198203 | |
| hsa-miR-10b-3p | lung squamous cell cancer | cell migration | "MicroRNA 10b overexpression promotes non small cel ......" | 24216130 | Transwell assay; Wound Healing Assay; Western blot |
| hsa-miR-10b-3p | lung squamous cell cancer | worse prognosis; staging; poor survival | "MicroRNA 10b indicates a poor prognosis of non sma ......" | 25214146 | Western blot |
| hsa-miR-10b-3p | lung squamous cell cancer | metastasis | "The differentially expressed microRNAs associated ......" | 25628919 | |
| hsa-miR-10b-3p | lung squamous cell cancer | progression | "microRNA miR 10b inhibition reduces cell prolifera ......" | 25988292 | Flow cytometry; Western blot |
| hsa-miR-10b-3p | lung squamous cell cancer | metastasis | "Expression levels of microRNA 145 and microRNA 10b ......" | 26909466 | |
| hsa-miR-10b-3p | melanoma | metastasis | "Evaluation of the expressions pattern of miR 10b 2 ......" | 26208390 | |
| hsa-miR-10b-3p | melanoma | metastasis | "microRNA 10b is a prognostic biomarker for melanom ......" | 26743475 | |
| hsa-miR-10b-3p | ovarian cancer | cell migration | "Loss of HOXD10 expression induced by upregulation ......" | 23670532 | |
| hsa-miR-10b-3p | pancreatic cancer | malignant trasformation | "miR-148a/b and miR-375 expression were found decre ......" | 21738581 | |
| hsa-miR-10b-3p | pancreatic cancer | worse prognosis; poor survival | "MicroRNA 10b is overexpressed in pancreatic cancer ......" | 22018284 | |
| hsa-miR-10b-3p | pancreatic cancer | cell migration; metastasis | "microRNA 10b enhances pancreatic cancer cell invas ......" | 24096486 | Luciferase |
| hsa-miR-10b-3p | sarcoma | progression; tumorigenesis | "miR 10b promotes invasion by targeting KLF4 in ost ......" | 27764757 | Flow cytometry; Transwell assay; Wound Healing Assay; Luciferase |
| hsa-miR-10b-3p | thyroid cancer | worse prognosis; staging | "The miR 221/222 cluster miR 10b and miR 92a are hi ......" | 23563786 | |
| hsa-miR-10b-3p | thyroid cancer | recurrence | "In the present study we investigated whether miR-9 ......" | 26007293 |
Reported gene related to hsa-miR-10b-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-10b-3p | bladder cancer | HOXD10 | "MicroRNA 10b promotes migration and invasion throu ......" | 24573354 |
| hsa-miR-10b-3p | breast cancer | HOXD10 | "MicroRNA-10b miR-10b has a prominent role in regul ......" | 24897960 |
| hsa-miR-10b-3p | breast cancer | HOXD10 | "The first proves that miR-10b indirectly activates ......" | 18373886 |
| hsa-miR-10b-3p | breast cancer | HOXD10 | "Moreover upon uptake miR-10b can suppress the prot ......" | 25428807 |
| hsa-miR-10b-3p | breast cancer | HOXD10 | "Among the several miRNAs miRNA-10b miR-10b express ......" | 22020939 |
| hsa-miR-10b-3p | breast cancer | HOXD10 | "Recent studies revealed that micro RNA-10b mir-10b ......" | 22259248 |
| hsa-miR-10b-3p | colorectal cancer | HOXD10 | "miR 10b promotes invasion by targeting HOXD10 in c ......" | 27347170 |
| hsa-miR-10b-3p | colorectal cancer | HOXD10 | "MiR-10b expression was also inversely correlated w ......" | 25606801 |
| hsa-miR-10b-3p | gastric cancer | HOXD10 | "miR 10b promotes cell invasion through RhoC AKT si ......" | 22293682 |
| hsa-miR-10b-3p | gastric cancer | HOXD10 | "MicroRNA 10b promotes migration and invasion throu ......" | 26311318 |
| hsa-miR-10b-3p | liver cancer | HOXD10 | "We also showed that HOXD10 was negatively regulate ......" | 25236186 |
| hsa-miR-10b-3p | ovarian cancer | HOXD10 | "Loss of HOXD10 expression induced by upregulation ......" | 23670532 |
| hsa-miR-10b-3p | bladder cancer | KLF4 | "MicroRNA 10b promotes migration and invasion throu ......" | 24573354 |
| hsa-miR-10b-3p | breast cancer | KLF4 | "Moreover upon uptake miR-10b can suppress the prot ......" | 25428807 |
| hsa-miR-10b-3p | esophageal cancer | KLF4 | "MicroRNA 10b promotes migration and invasion throu ......" | 20075075 |
| hsa-miR-10b-3p | gastric cancer | KLF4 | "Augmented miR 10b expression associated with depre ......" | 26191201 |
| hsa-miR-10b-3p | lung cancer | KLF4 | "MicroRNA-10b may promote proliferation and invasio ......" | 25063061 |
| hsa-miR-10b-3p | lung squamous cell cancer | KLF4 | "Krüppel-like factor 4 KLF4 may be indirectly targ ......" | 24216130 |
| hsa-miR-10b-3p | sarcoma | KLF4 | "miR 10b promotes invasion by targeting KLF4 in ost ......" | 27764757 |
| hsa-miR-10b-3p | breast cancer | RHOC | "The first proves that miR-10b indirectly activates ......" | 18373886 |
| hsa-miR-10b-3p | breast cancer | RHOC | "Knockdown and overexpression experiments revealed ......" | 27494896 |
| hsa-miR-10b-3p | breast cancer | RHOC | "BRMS1 decreased metastasis-promoting miR-10b -373 ......" | 19585508 |
| hsa-miR-10b-3p | colorectal cancer | RHOC | "These findings suggest that miR-10b may stimulate ......" | 27347170 |
| hsa-miR-10b-3p | colorectal cancer | RHOC | "MicroRNA 10b is upregulated and has an invasive ro ......" | 25606801 |
| hsa-miR-10b-3p | gastric cancer | RHOC | "miR 10b promotes cell invasion through RhoC AKT si ......" | 22293682 |
| hsa-miR-10b-3p | liver cancer | RHOC | "miR 10b is overexpressed in hepatocellular carcino ......" | 25236186 |
| hsa-miR-10b-3p | breast cancer | CDH1 | "MicroRNA 10b targets E cadherin and modulates brea ......" | 22847191 |
| hsa-miR-10b-3p | breast cancer | CDH1 | "Treating breast cancer cells with the miR-10b inhi ......" | 24457988 |
| hsa-miR-10b-3p | breast cancer | CDH1 | "This was supported by analysis of breast cancer ce ......" | 27494896 |
| hsa-miR-10b-3p | lung squamous cell cancer | CDH1 | "MicroRNA 10b indicates a poor prognosis of non sma ......" | 25214146 |
| hsa-miR-10b-3p | esophageal cancer | HTATIP2 | "Reduction of TIP30 in esophageal squamous cell car ......" | 25312779 |
| hsa-miR-10b-3p | pancreatic cancer | HTATIP2 | "microRNA 10b enhances pancreatic cancer cell invas ......" | 24096486 |
| hsa-miR-10b-3p | breast cancer | TWIST1 | "In breast metastatic cells miR-10b expression is e ......" | 22020939 |
| hsa-miR-10b-3p | gastric cancer | TWIST1 | "As a microRNA induced by Twist miR-10b function as ......" | 22293682 |
| hsa-miR-10b-3p | breast cancer | ADAMTS2 | "The addition of miR-10b RERs to the Nottingham Pro ......" | 24897960 |
| hsa-miR-10b-3p | glioblastoma | AMACR | "Nineteen and 26 microRNAs exhibited cohort-depende ......" | 21737610 |
| hsa-miR-10b-3p | colorectal cancer | BCL2 | "To explore the mechanism of chemoresistance in miR ......" | 22322955 |
| hsa-miR-10b-3p | colorectal cancer | BCL2L11 | "In vitro studies revealed that miR-10b directly in ......" | 22322955 |
| hsa-miR-10b-3p | breast cancer | BRMS1 | "BRMS1 decreased metastasis-promoting miR-10b -373 ......" | 19585508 |
| hsa-miR-10b-3p | liver cancer | CADM1 | "MicroRNA 10b promotes migration and invasion throu ......" | 22528944 |
| hsa-miR-10b-3p | breast cancer | CD44 | "In breast cancer overexpression of the transmembra ......" | 22573479 |
| hsa-miR-10b-3p | pancreatic cancer | CRYGD | "Moreover miR-10b overexpression accelerated pancre ......" | 24096486 |
| hsa-miR-10b-3p | liver cancer | CSMD1 | "miR 10b exerts oncogenic activity in human hepatoc ......" | 27756250 |
| hsa-miR-10b-3p | head and neck cancer | DOT1L | "Treatment of CSCs with DOT1L-specific small interf ......" | 27002147 |
| hsa-miR-10b-3p | glioblastoma | E2F1 | "MicroRNA 10b inhibition reduces E2F1 mediated tran ......" | 25738367 |
| hsa-miR-10b-3p | pancreatic cancer | EGF | "microRNA 10b enhances pancreatic cancer cell invas ......" | 24096486 |
| hsa-miR-10b-3p | pancreatic cancer | EGFR | "The actions of EGF in the presence of miR-10b were ......" | 24096486 |
| hsa-miR-10b-3p | breast cancer | ERBB2 | "miR-10b was positively correlated with the ER and ......" | 25232827 |
| hsa-miR-10b-3p | breast cancer | FAM3A | "MiR-10b was used for differentiation of N patients ......" | 23238818 |
| hsa-miR-10b-3p | pancreatic cancer | FGFR1 | "Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......" | 21738581 |
| hsa-miR-10b-3p | breast cancer | HDAC4 | "Functional role of miR 10b in tamoxifen resistance ......" | 26206152 |
| hsa-miR-10b-3p | ovarian cancer | HOTAIR | "Two types of ncRNAs miRNA‑10b miR-10b and homemo ......" | 23670532 |
| hsa-miR-10b-3p | cervical and endocervical cancer | HOXA1 | "Moreover overexpression of miR-10b in cervical can ......" | 27296950 |
| hsa-miR-10b-3p | endometrial cancer | HOXB3 | "miR 10b Inhibits Apoptosis and Promotes Proliferat ......" | 27447302 |
| hsa-miR-10b-3p | gastric cancer | HOXD4 | "After 5-aza-2'-deoxycytidine treatment of gastric ......" | 21562367 |
| hsa-miR-10b-3p | breast cancer | IK | "The relative expression of miR-10b in tumor as com ......" | 24897960 |
| hsa-miR-10b-3p | breast cancer | JUN | "MicroRNA 10b promotes abnormal expression of the p ......" | 27494896 |
| hsa-miR-10b-3p | pancreatic cancer | KAT5 | "By gene profiling we identified potential targets ......" | 24096486 |
| hsa-miR-10b-3p | lung squamous cell cancer | KL | "And a significant inverse correlation between the ......" | 25988292 |
| hsa-miR-10b-3p | gastric cancer | MAPRE1 | "Epigenetic regulation of microRNA 10b and targetin ......" | 21562367 |
| hsa-miR-10b-3p | breast cancer | MCM5 | "To achieve this aim we investigated microRNA-10b m ......" | 25596707 |
| hsa-miR-10b-3p | pancreatic cancer | MLH1 | "Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......" | 21738581 |
| hsa-miR-10b-3p | breast cancer | NF1 | "Knockdown and overexpression experiments revealed ......" | 27494896 |
| hsa-miR-10b-3p | glioblastoma | NHLRC1 | "All microRNAs showed detectable levels of expressi ......" | 23420397 |
| hsa-miR-10b-3p | breast cancer | NPS | "We synthesized the antisense-miR-21 and antisense- ......" | 25652012 |
| hsa-miR-10b-3p | breast cancer | NR4A3 | "An RNA molecule sequence exactly matching the matu ......" | 22259248 |
| hsa-miR-10b-3p | liver cancer | PLAUR | "miR 10b is overexpressed in hepatocellular carcino ......" | 25236186 |
| hsa-miR-10b-3p | breast cancer | PTEN | "miR 10b expression in breast cancer stem cells sup ......" | 27113763 |
| hsa-miR-10b-3p | breast cancer | RUNX2 | "The median expression levels of RUNX2 and miR-10b ......" | 25266482 |
| hsa-miR-10b-3p | breast cancer | SDC1 | "In breast cancer overexpression of the transmembra ......" | 22573479 |
| hsa-miR-10b-3p | breast cancer | SETBP1 | "Herein we evaluated the effect of SEB on the expre ......" | 26236665 |
| hsa-miR-10b-3p | breast cancer | SMPD3 | "In particular nSMase2 or ceramide promotes the exo ......" | 25428807 |
| hsa-miR-10b-3p | gastric cancer | TIAM1 | "Moreover we demonstrated that T-cell lymphoma inva ......" | 24481854 |
| hsa-miR-10b-3p | breast cancer | VIM | "Treating breast cancer cells with the miR-10b inhi ......" | 24457988 |
Expression profile in cancer corhorts:
