microRNA information: hsa-miR-10b-5p

SectionIDlink
Mature name: hsa-miR-10b-5pmiRbase
Accession: MIMAT0000254miRbase
Precursor name: hsa-mir-10b miRbase
Precursor accession: MI0000267miRbase
Symbol: MIR10BHGNC
RefSeq ID: NR_029609GenBank
Sequence: UACCCUGUAGAACCGAAUUUGUG



Reported expression in cancers: hsa-miR-10b-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-10b-5p

bladder cancerupregulation"The present study was performed to investigate the ......"24573354
hsa-miR-10b-5p

breast cancerupregulation"Tumour invasion and metastasis initiated by microR ......"17898713
hsa-miR-10b-5p

breast cancerupregulation"Recent studies have suggested that microRNA-10b mi ......"22847191
hsa-miR-10b-5p

breast cancerupregulation"Critical role of miR 10b in transforming growth fa ......"24457988
hsa-miR-10b-5p

breast cancerupregulation"Up regulation of microRNA 10b is associated with t ......"25075255qPCR
hsa-miR-10b-5p

breast cancerupregulation"With an eye to identify novel targets for the trea ......"26206152
hsa-miR-10b-5p

breast cancerupregulation"Prognostic significance of microRNA 10b overexpres ......"27173192
hsa-miR-10b-5p

breast cancerupregulation"Specifically in breast cancer upregulation of miR- ......"27494896
hsa-miR-10b-5p

cervical and endocervical cancerdownregulation"The Downregulation of MicroRNA 10b and its Role in ......"27296950
hsa-miR-10b-5p

colorectal cancerupregulation"Increased expression of miR-10b was also associate ......"21739196
hsa-miR-10b-5p

colorectal cancerupregulation"Up regulation of mir 10b predicate advanced clinic ......"27592860qPCR
hsa-miR-10b-5p

endometrial cancerderegulation"A set of EEC-associated miRNAs in tissue and plasm ......"24491411RNA-Seq
hsa-miR-10b-5p

gastric cancerupregulation"Clinicopathologic significance of miR 10b expressi ......"23351547
hsa-miR-10b-5p

gastric cancerupregulation"Identified miRNAs were further validated in the tr ......"27756776qPCR
hsa-miR-10b-5p

glioblastomaupregulation"An analysis of The Cancer Genome Atlas data reveal ......"23307328
hsa-miR-10b-5p

head and neck cancerdownregulation"MicroRNA expression profile in head and neck cance ......"24209638Microarray
hsa-miR-10b-5p

liver cancerupregulation"MicroRNA-10b miR-10b was recently reported to be d ......"22528944qPCR
hsa-miR-10b-5p

liver cancerupregulation"Recently miR-10b is identified as a miRNA highly e ......"25236186qPCR
hsa-miR-10b-5p

lung squamous cell cancerupregulation"Additionally miR-10b is highly expressed in progre ......"24198203
hsa-miR-10b-5p

lung squamous cell cancerupregulation"We compared the expression levels of miR-10b in 73 ......"25214146qPCR
hsa-miR-10b-5p

prostate cancerupregulation"Loss of 18 miRNAs e.g.miR-34c miR-29b miR-212 and ......"23781281
hsa-miR-10b-5p

sarcomaderegulation"Here we profiled miRNA expression of chondrosarcom ......"23940002qPCR; Microarray
hsa-miR-10b-5p

thyroid cancerupregulation"The miR 221/222 cluster miR 10b and miR 92a are hi ......"23563786qPCR



Reported cancer pathway affected by hsa-miR-10b-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-10b-5p

breast cancerEpithelial mesenchymal transition pathway"Critical role of miR 10b in transforming growth fa ......"24457988
hsa-miR-10b-5p

breast cancerApoptosis pathway"Based on the results obtained in the last decade s ......"26199650
hsa-miR-10b-5p

breast cancerEpithelial mesenchymal transition pathway"miR 10b expression in breast cancer stem cells sup ......"27113763Western blot; Luciferase
hsa-miR-10b-5p

endometrial cancerApoptosis pathway"miR 10b Inhibits Apoptosis and Promotes Proliferat ......"27447302Luciferase
hsa-miR-10b-5p

gastric cancerPI3K/Akt signaling pathway"miR 10b promotes cell invasion through RhoC AKT si ......"22293682
hsa-miR-10b-5p

gastric cancerApoptosis pathway"DNA methylation downregulated mir 10b acts as a tu ......"24481854
hsa-miR-10b-5p

glioblastomaApoptosis pathway"MicroRNA 10b pleiotropically regulates invasion an ......"23034333
hsa-miR-10b-5p

glioblastomacell cycle pathway"MicroRNA-21 miR-21 and microRNA-10b miR-10b are on ......"27508339
hsa-miR-10b-5p

liver cancercell cycle pathway"miR 10b exerts oncogenic activity in human hepatoc ......"27756250Colony formation; Luciferase
hsa-miR-10b-5p

lung squamous cell cancerApoptosis pathway; cell cycle pathway"microRNA miR 10b inhibition reduces cell prolifera ......"25988292Flow cytometry; Western blot
hsa-miR-10b-5p

pancreatic cancerEpithelial mesenchymal transition pathway"microRNA 10b enhances pancreatic cancer cell invas ......"24096486Luciferase
hsa-miR-10b-5p

retinoblastomacell cycle pathway"To investigate differential expression of microRNA ......"21941147
hsa-miR-10b-5p

sarcomaApoptosis pathway"miR 10b promotes invasion by targeting KLF4 in ost ......"27764757Flow cytometry; Transwell assay; Wound Healing Assay; Luciferase



Reported cancer prognosis affected by hsa-miR-10b-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-10b-5p

bladder cancercell migration; metastasis"MicroRNA 10b promotes migration and invasion throu ......"24573354Transwell assay; Luciferase
hsa-miR-10b-5p

breast cancermetastasis; cell migration; progression"Tumour invasion and metastasis initiated by microR ......"17898713
hsa-miR-10b-5p

breast cancermetastasis"The first proves that miR-10b indirectly activates ......"18373886
hsa-miR-10b-5p

breast cancermalignant trasformation"Real-time quantitative PCR RQ-PCR is a sensitive a ......"18718003
hsa-miR-10b-5p

breast cancermetastasis"MicroRNA arrays were done comparing small RNAs tha ......"19585508
hsa-miR-10b-5p

breast cancerprogression"Hyaluronan CD44 interaction promotes c Src mediate ......"20843787
hsa-miR-10b-5p

breast cancermetastasis"The relative concentrations of breast cancer-assoc ......"21047409
hsa-miR-10b-5p

breast cancermetastasis"Role of miR 10b in breast cancer metastasis; In pa ......"21067538
hsa-miR-10b-5p

breast cancerpoor survival"Forty-nine primary triple-negative breast cancer c ......"21270527
hsa-miR-10b-5p

breast cancercell migration"Cysteine rich 61 connective tissue growth factor n ......"22020939
hsa-miR-10b-5p

breast cancercell migration"Delivery of MicroRNA 10b with Polylysine Nanoparti ......"22259248Wound Healing Assay
hsa-miR-10b-5p

breast cancermetastasis"Real Time RT-PCR was performed to identify the miR ......"22524830
hsa-miR-10b-5p

breast cancermotility; cell migration"Targeting of syndecan 1 by microRNA miR 10b promot ......"22573479Flow cytometry; Luciferase; Western blot
hsa-miR-10b-5p

breast cancermetastasis; staging; tumor size; progression"MicroRNA 10b targets E cadherin and modulates brea ......"22847191
hsa-miR-10b-5p

breast cancermetastasis"Serum overexpression of microRNA 10b in patients w ......"22906258
hsa-miR-10b-5p

breast cancerprogression"MiR-10b expression was significantly higher in MFP ......"23226290
hsa-miR-10b-5p

breast cancermetastasis; differentiation"We hypothesized that miR-10b and miR-373 which are ......"23238818
hsa-miR-10b-5p

breast cancerprogression"Using quantitative TaqMan MicroRNA PCR we measured ......"23748853
hsa-miR-10b-5p

breast cancerstaging; metastasis"None of the investigated single miRNAs or miRNA cl ......"24196612
hsa-miR-10b-5p

breast cancermetastasis; malignant trasformation"The overexpression of miR-21 miR-10b and miR-19a i ......"24416156
hsa-miR-10b-5p

breast cancermetastasis; progression"Evaluation of microRNA 10b prognostic significance ......"24897960
hsa-miR-10b-5p

breast cancermetastasis; tumor size"Stem-loop real-time RT-PCR was used to detect the ......"25047098
hsa-miR-10b-5p

breast cancermetastasis"Up regulation of microRNA 10b is associated with t ......"25075255
hsa-miR-10b-5p

breast cancermetastasis"The objective of the present study is to evaluate ......"25369070
hsa-miR-10b-5p

breast cancermalignant trasformation"Exosome mediated transfer of miR 10b promotes cell ......"25428807Western blot; Luciferase
hsa-miR-10b-5p

breast cancerpoor survival"MicroRNA 10b and minichromosome maintenance comple ......"25596707
hsa-miR-10b-5p

breast cancerworse prognosis"In addition we showed that higher levels of serum ......"26120471
hsa-miR-10b-5p

breast cancermetastasis"Using real-time quantitative polymerase chain reac ......"26124926
hsa-miR-10b-5p

breast cancermetastasis; worse prognosis"Based on the results obtained in the last decade s ......"26199650
hsa-miR-10b-5p

breast cancerdrug resistance; metastasis"Functional role of miR 10b in tamoxifen resistance ......"26206152Luciferase
hsa-miR-10b-5p

breast cancermetastasis"Overexpression of Metastatic Related MicroRNAs Mir ......"26236665MTT assay
hsa-miR-10b-5p

breast cancermetastasis"Combining miR 10b Targeted Nanotherapy with Low Do ......"26359455
hsa-miR-10b-5p

breast cancermetastasis; poor survival"miR 10b expression in breast cancer stem cells sup ......"27113763Western blot; Luciferase
hsa-miR-10b-5p

breast cancerstaging; poor survival"Prognostic significance of microRNA 10b overexpres ......"27173192
hsa-miR-10b-5p

breast cancerprogression"We identified eight microRNAs miR-10a miR-10b miR- ......"27433802
hsa-miR-10b-5p

breast cancerprogression"MicroRNA 10b promotes abnormal expression of the p ......"27494896
hsa-miR-10b-5p

cervical and endocervical cancerstaging; poor survival"Our findings showed that elevated expression of mi ......"26427662
hsa-miR-10b-5p

cervical and endocervical cancerstaging; tumorigenesis; progression"The Downregulation of MicroRNA 10b and its Role in ......"27296950
hsa-miR-10b-5p

colorectal cancerstaging; progression"Increased expression of miR-10b was also associate ......"21739196
hsa-miR-10b-5p

colorectal cancerdrug resistance; worse prognosis; poor survival"MicroRNA 10b is a prognostic indicator in colorect ......"22322955
hsa-miR-10b-5p

colorectal cancermetastasis"Four miRNAs downregulated in LM let-7i miR-10b miR ......"25663689
hsa-miR-10b-5p

colorectal cancercell migration; metastasis; staging"miR 10b promotes invasion by targeting HOXD10 in c ......"27347170
hsa-miR-10b-5p

colorectal cancermetastasis"Secondly validation of the results was carried out ......"27365381
hsa-miR-10b-5p

colorectal cancerstaging; metastasis; poor survival; differentiation; worse prognosis"Up regulation of mir 10b predicate advanced clinic ......"27592860
hsa-miR-10b-5p

endometrial cancermetastasis"miR 10b Inhibits Apoptosis and Promotes Proliferat ......"27447302Luciferase
hsa-miR-10b-5p

esophageal cancermotility; cell migration; metastasis"MicroRNA 10b promotes migration and invasion throu ......"20075075
hsa-miR-10b-5p

gastric cancerpoor survival"Several microarray studies have reported microRNA ......"19951901
hsa-miR-10b-5p

gastric cancermetastasis; differentiation"miR 10b promotes cell invasion through RhoC AKT si ......"22293682
hsa-miR-10b-5p

gastric cancerstaging; metastasis; worse prognosis; poor survival; progression"Clinicopathologic significance of miR 10b expressi ......"23351547
hsa-miR-10b-5p

gastric cancercell migration; tumorigenesis; metastasis"DNA methylation downregulated mir 10b acts as a tu ......"24481854
hsa-miR-10b-5p

gastric cancerprogression; tumorigenesis; worse prognosis"MicroRNA 10b promotes migration and invasion throu ......"26311318
hsa-miR-10b-5p

gastric cancerpoor survival"Using quantitative reverse transcription polymeras ......"27756776
hsa-miR-10b-5p

glioblastomametastasis"We determined CSF levels of several cancer-associa ......"22492962
hsa-miR-10b-5p

glioblastomaworse prognosis; cell migration; recurrence; drug resistance"Oncogenic effects of miR 10b in glioblastoma stem ......"23307328
hsa-miR-10b-5p

glioblastomadrug resistance"MicroRNA 10b inhibition reduces E2F1 mediated tran ......"25738367
hsa-miR-10b-5p

head and neck cancerstaging; differentiation; tumor size"Three hypoxia-related microRNAs hsa-miR-210 hsa-mi ......"20187102
hsa-miR-10b-5p

head and neck cancerpoor survival"Further analyses indicate that the stimulation of ......"27002147
hsa-miR-10b-5p

kidney renal cell cancermetastasis; staging"We used the microarray technology to profile miRNA ......"22623952
hsa-miR-10b-5p

liver cancermalignant trasformation"Our study identified and validated miR-224 overexp ......"18433021
hsa-miR-10b-5p

liver cancermetastasis; worse prognosis; poor survival; cell migration; motility"MicroRNA 10b promotes migration and invasion throu ......"22528944Luciferase; Western blot
hsa-miR-10b-5p

liver cancercell migration; staging; motility"miR 10b is overexpressed in hepatocellular carcino ......"25236186Wound Healing Assay; Luciferase
hsa-miR-10b-5p

lung cancermetastasis"Effects of MicroRNA 10b on lung cancer cell prolif ......"25063061Western blot; Cell proliferation assay; Cell Proliferation Assay
hsa-miR-10b-5p

lung squamous cell cancerprogression; poor survival"Additionally miR-10b is highly expressed in progre ......"24198203
hsa-miR-10b-5p

lung squamous cell cancercell migration"MicroRNA 10b overexpression promotes non small cel ......"24216130Transwell assay; Wound Healing Assay; Western blot
hsa-miR-10b-5p

lung squamous cell cancerworse prognosis; staging; poor survival"MicroRNA 10b indicates a poor prognosis of non sma ......"25214146Western blot
hsa-miR-10b-5p

lung squamous cell cancermetastasis"The differentially expressed microRNAs associated ......"25628919
hsa-miR-10b-5p

lung squamous cell cancerprogression"microRNA miR 10b inhibition reduces cell prolifera ......"25988292Flow cytometry; Western blot
hsa-miR-10b-5p

lung squamous cell cancermetastasis"Expression levels of microRNA 145 and microRNA 10b ......"26909466
hsa-miR-10b-5p

melanomametastasis"Evaluation of the expressions pattern of miR 10b 2 ......"26208390
hsa-miR-10b-5p

melanomametastasis"microRNA 10b is a prognostic biomarker for melanom ......"26743475
hsa-miR-10b-5p

ovarian cancercell migration"Loss of HOXD10 expression induced by upregulation ......"23670532
hsa-miR-10b-5p

pancreatic cancermalignant trasformation"miR-148a/b and miR-375 expression were found decre ......"21738581
hsa-miR-10b-5p

pancreatic cancerworse prognosis; poor survival"MicroRNA 10b is overexpressed in pancreatic cancer ......"22018284
hsa-miR-10b-5p

pancreatic cancercell migration; metastasis"microRNA 10b enhances pancreatic cancer cell invas ......"24096486Luciferase
hsa-miR-10b-5p

sarcomaprogression; tumorigenesis"miR 10b promotes invasion by targeting KLF4 in ost ......"27764757Flow cytometry; Transwell assay; Wound Healing Assay; Luciferase
hsa-miR-10b-5p

thyroid cancerworse prognosis; staging"The miR 221/222 cluster miR 10b and miR 92a are hi ......"23563786
hsa-miR-10b-5p

thyroid cancerrecurrence"In the present study we investigated whether miR-9 ......"26007293



Reported gene related to hsa-miR-10b-5p

miRNAcancergenereportingPUBMED
hsa-miR-10b-5p

bladder cancerHOXD10"MicroRNA 10b promotes migration and invasion throu ......"24573354
hsa-miR-10b-5p

breast cancerHOXD10"MicroRNA-10b miR-10b has a prominent role in regul ......"24897960
hsa-miR-10b-5p

breast cancerHOXD10"The first proves that miR-10b indirectly activates ......"18373886
hsa-miR-10b-5p

breast cancerHOXD10"Moreover upon uptake miR-10b can suppress the prot ......"25428807
hsa-miR-10b-5p

breast cancerHOXD10"Among the several miRNAs miRNA-10b miR-10b express ......"22020939
hsa-miR-10b-5p

breast cancerHOXD10"Recent studies revealed that micro RNA-10b mir-10b ......"22259248
hsa-miR-10b-5p

colorectal cancerHOXD10"miR 10b promotes invasion by targeting HOXD10 in c ......"27347170
hsa-miR-10b-5p

colorectal cancerHOXD10"MiR-10b expression was also inversely correlated w ......"25606801
hsa-miR-10b-5p

gastric cancerHOXD10"miR 10b promotes cell invasion through RhoC AKT si ......"22293682
hsa-miR-10b-5p

gastric cancerHOXD10"MicroRNA 10b promotes migration and invasion throu ......"26311318
hsa-miR-10b-5p

liver cancerHOXD10"We also showed that HOXD10 was negatively regulate ......"25236186
hsa-miR-10b-5p

ovarian cancerHOXD10"Loss of HOXD10 expression induced by upregulation ......"23670532
hsa-miR-10b-5p

bladder cancerKLF4"MicroRNA 10b promotes migration and invasion throu ......"24573354
hsa-miR-10b-5p

breast cancerKLF4"Moreover upon uptake miR-10b can suppress the prot ......"25428807
hsa-miR-10b-5p

esophageal cancerKLF4"MicroRNA 10b promotes migration and invasion throu ......"20075075
hsa-miR-10b-5p

gastric cancerKLF4"Augmented miR 10b expression associated with depre ......"26191201
hsa-miR-10b-5p

lung cancerKLF4"MicroRNA-10b may promote proliferation and invasio ......"25063061
hsa-miR-10b-5p

lung squamous cell cancerKLF4"Krüppel-like factor 4 KLF4 may be indirectly targ ......"24216130
hsa-miR-10b-5p

sarcomaKLF4"miR 10b promotes invasion by targeting KLF4 in ost ......"27764757
hsa-miR-10b-5p

breast cancerRHOC"The first proves that miR-10b indirectly activates ......"18373886
hsa-miR-10b-5p

breast cancerRHOC"Knockdown and overexpression experiments revealed ......"27494896
hsa-miR-10b-5p

breast cancerRHOC"BRMS1 decreased metastasis-promoting miR-10b -373 ......"19585508
hsa-miR-10b-5p

colorectal cancerRHOC"These findings suggest that miR-10b may stimulate ......"27347170
hsa-miR-10b-5p

colorectal cancerRHOC"MicroRNA 10b is upregulated and has an invasive ro ......"25606801
hsa-miR-10b-5p

gastric cancerRHOC"miR 10b promotes cell invasion through RhoC AKT si ......"22293682
hsa-miR-10b-5p

liver cancerRHOC"miR 10b is overexpressed in hepatocellular carcino ......"25236186
hsa-miR-10b-5p

breast cancerCDH1"MicroRNA 10b targets E cadherin and modulates brea ......"22847191
hsa-miR-10b-5p

breast cancerCDH1"Treating breast cancer cells with the miR-10b inhi ......"24457988
hsa-miR-10b-5p

breast cancerCDH1"This was supported by analysis of breast cancer ce ......"27494896
hsa-miR-10b-5p

lung squamous cell cancerCDH1"MicroRNA 10b indicates a poor prognosis of non sma ......"25214146
hsa-miR-10b-5p

esophageal cancerHTATIP2"Reduction of TIP30 in esophageal squamous cell car ......"25312779
hsa-miR-10b-5p

pancreatic cancerHTATIP2"microRNA 10b enhances pancreatic cancer cell invas ......"24096486
hsa-miR-10b-5p

breast cancerTWIST1"In breast metastatic cells miR-10b expression is e ......"22020939
hsa-miR-10b-5p

gastric cancerTWIST1"As a microRNA induced by Twist miR-10b function as ......"22293682
hsa-miR-10b-5p

breast cancerADAMTS2"The addition of miR-10b RERs to the Nottingham Pro ......"24897960
hsa-miR-10b-5p

glioblastomaAMACR"Nineteen and 26 microRNAs exhibited cohort-depende ......"21737610
hsa-miR-10b-5p

colorectal cancerBCL2"To explore the mechanism of chemoresistance in miR ......"22322955
hsa-miR-10b-5p

colorectal cancerBCL2L11"In vitro studies revealed that miR-10b directly in ......"22322955
hsa-miR-10b-5p

breast cancerBRMS1"BRMS1 decreased metastasis-promoting miR-10b -373 ......"19585508
hsa-miR-10b-5p

liver cancerCADM1"MicroRNA 10b promotes migration and invasion throu ......"22528944
hsa-miR-10b-5p

breast cancerCD44"In breast cancer overexpression of the transmembra ......"22573479
hsa-miR-10b-5p

pancreatic cancerCRYGD"Moreover miR-10b overexpression accelerated pancre ......"24096486
hsa-miR-10b-5p

liver cancerCSMD1"miR 10b exerts oncogenic activity in human hepatoc ......"27756250
hsa-miR-10b-5p

head and neck cancerDOT1L"Treatment of CSCs with DOT1L-specific small interf ......"27002147
hsa-miR-10b-5p

glioblastomaE2F1"MicroRNA 10b inhibition reduces E2F1 mediated tran ......"25738367
hsa-miR-10b-5p

pancreatic cancerEGF"microRNA 10b enhances pancreatic cancer cell invas ......"24096486
hsa-miR-10b-5p

pancreatic cancerEGFR"The actions of EGF in the presence of miR-10b were ......"24096486
hsa-miR-10b-5p

breast cancerERBB2"miR-10b was positively correlated with the ER and ......"25232827
hsa-miR-10b-5p

breast cancerFAM3A"MiR-10b was used for differentiation of N patients ......"23238818
hsa-miR-10b-5p

pancreatic cancerFGFR1"Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......"21738581
hsa-miR-10b-5p

breast cancerHDAC4"Functional role of miR 10b in tamoxifen resistance ......"26206152
hsa-miR-10b-5p

ovarian cancerHOTAIR"Two types of ncRNAs miRNA‑10b miR-10b and homemo ......"23670532
hsa-miR-10b-5p

cervical and endocervical cancerHOXA1"Moreover overexpression of miR-10b in cervical can ......"27296950
hsa-miR-10b-5p

endometrial cancerHOXB3"miR 10b Inhibits Apoptosis and Promotes Proliferat ......"27447302
hsa-miR-10b-5p

gastric cancerHOXD4"After 5-aza-2'-deoxycytidine treatment of gastric ......"21562367
hsa-miR-10b-5p

breast cancerIK"The relative expression of miR-10b in tumor as com ......"24897960
hsa-miR-10b-5p

breast cancerJUN"MicroRNA 10b promotes abnormal expression of the p ......"27494896
hsa-miR-10b-5p

pancreatic cancerKAT5"By gene profiling we identified potential targets ......"24096486
hsa-miR-10b-5p

lung squamous cell cancerKL"And a significant inverse correlation between the ......"25988292
hsa-miR-10b-5p

gastric cancerMAPRE1"Epigenetic regulation of microRNA 10b and targetin ......"21562367
hsa-miR-10b-5p

breast cancerMCM5"To achieve this aim we investigated microRNA-10b m ......"25596707
hsa-miR-10b-5p

pancreatic cancerMLH1"Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......"21738581
hsa-miR-10b-5p

breast cancerNF1"Knockdown and overexpression experiments revealed ......"27494896
hsa-miR-10b-5p

glioblastomaNHLRC1"All microRNAs showed detectable levels of expressi ......"23420397
hsa-miR-10b-5p

breast cancerNPS"We synthesized the antisense-miR-21 and antisense- ......"25652012
hsa-miR-10b-5p

breast cancerNR4A3"An RNA molecule sequence exactly matching the matu ......"22259248
hsa-miR-10b-5p

liver cancerPLAUR"miR 10b is overexpressed in hepatocellular carcino ......"25236186
hsa-miR-10b-5p

breast cancerPTEN"miR 10b expression in breast cancer stem cells sup ......"27113763
hsa-miR-10b-5p

breast cancerRUNX2"The median expression levels of RUNX2 and miR-10b ......"25266482
hsa-miR-10b-5p

breast cancerSDC1"In breast cancer overexpression of the transmembra ......"22573479
hsa-miR-10b-5p

breast cancerSETBP1"Herein we evaluated the effect of SEB on the expre ......"26236665
hsa-miR-10b-5p

breast cancerSMPD3"In particular nSMase2 or ceramide promotes the exo ......"25428807
hsa-miR-10b-5p

gastric cancerTIAM1"Moreover we demonstrated that T-cell lymphoma inva ......"24481854
hsa-miR-10b-5p

breast cancerVIM"Treating breast cancer cells with the miR-10b inhi ......"24457988



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-10b-5p
CDK2
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA BLCA -0.099; TCGA BRCA -0.173; TCGA CESC -0.083; TCGA HNSC -0.16; TCGA KIRC -0.119; TCGA KIRP -0.098; TCGA PRAD -0.06; TCGA SARC -0.16; TCGA UCEC -0.1
hsa-miR-10b-5p
INHBA
10 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUSC; OV; PRAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.806; TCGA BRCA -0.316; TCGA CESC -0.375; TCGA HNSC -0.758; TCGA LIHC -0.086; TCGA LUSC -0.173; TCGA OV -0.328; TCGA PRAD -0.338; TCGA SARC -0.709; TCGA STAD -0.298
hsa-miR-10b-5p
TMEM132A
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; OV; PAAD; UCEC
mirMAP
TCGA BLCA -0.153; TCGA BRCA -0.575; TCGA CESC -0.176; TCGA HNSC -0.23; TCGA KIRC -0.559; TCGA KIRP -0.195; TCGA OV -0.099; TCGA PAAD -0.162; TCGA UCEC -0.175
hsa-miR-10b-5p
TTC7A
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; OV; UCEC
mirMAP
TCGA BLCA -0.169; TCGA BRCA -0.104; TCGA CESC -0.132; TCGA HNSC -0.056; TCGA KIRC -0.118; TCGA KIRP -0.185; TCGA LUAD -0.066; TCGA LUSC -0.069; TCGA OV -0.07; TCGA UCEC -0.106
hsa-miR-10b-5p
MYBL1
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.173; TCGA BRCA -0.366; TCGA CESC -0.164; TCGA HNSC -0.142; TCGA KIRC -0.745; TCGA KIRP -0.194; TCGA PRAD -0.129; TCGA SARC -0.384; TCGA STAD -0.178; TCGA UCEC -0.136
hsa-miR-10b-5p
SLC16A3
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; SARC; UCEC
mirMAP
TCGA BRCA -0.567; TCGA CESC -0.274; TCGA ESCA -0.156; TCGA HNSC -0.227; TCGA KIRC -0.99; TCGA KIRP -0.339; TCGA LUAD -0.07; TCGA SARC -0.246; TCGA UCEC -0.246





Enriched cancer pathways of putative targets