microRNA information: hsa-miR-1180-3p

SectionIDlink
Mature name: hsa-miR-1180-3pmiRbase
Accession: MIMAT0005825miRbase
Precursor name: hsa-mir-1180 miRbase
Precursor accession: MI0006273miRbase
Symbol: MIR1180HGNC
RefSeq ID: NR_031591GenBank
Sequence: UUUCCGGCUCGCGUGGGUGUGU



Reported expression in cancers: hsa-miR-1180-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-1180-3p

liver cancerupregulation"In the present study we demonstrate that miR-1180 ......"26928365



Reported cancer pathway affected by hsa-miR-1180-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-1180-3p

liver cancerApoptosis pathway"MiR 1180 promotes apoptotic resistance to human he ......"26928365



Reported cancer prognosis affected by hsa-miR-1180-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-1180-3p

kidney papillary renal cell cancerstaging; poor survival"In the training stage the expression levels of 12 ......"25906110
hsa-miR-1180-3p

liver cancerdrug resistance"MiR 1180 promotes apoptotic resistance to human he ......"26928365



Reported gene related to hsa-miR-1180-3p

miRNAcancergenereportingPUBMED
hsa-miR-1180-3p

liver cancerNFASC"MiR 1180 promotes apoptotic resistance to human he ......"26928365
hsa-miR-1180-3p

liver cancerTNFAIP3"TNFAIP3 interacting protein 2 TNIP2 a potential ta ......"27044843
hsa-miR-1180-3p

liver cancerTNIP2"MiR 1180 promoted the proliferation of hepatocellu ......"27044843



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-1180-3p
FUT7
11 cancers: BLCA; CESC; HNSC; KIRP; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.37; TCGA CESC -0.407; TCGA HNSC -0.417; TCGA KIRP -0.222; TCGA LUAD -0.255; TCGA LUSC -0.533; TCGA OV -0.258; TCGA PAAD -0.193; TCGA SARC -0.353; TCGA THCA -1.03; TCGA STAD -0.192
hsa-miR-1180-3p
RPLP1
10 cancers: BLCA; CESC; KIRP; LGG; LUAD; OV; PAAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.057; TCGA CESC -0.113; TCGA KIRP -0.199; TCGA LGG -0.223; TCGA LUAD -0.056; TCGA OV -0.158; TCGA PAAD -0.142; TCGA SARC -0.108; TCGA THCA -0.218; TCGA STAD -0.101
hsa-miR-1180-3p
TSPAN9
12 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.113; TCGA BRCA -0.082; TCGA CESC -0.126; TCGA COAD -0.135; TCGA KIRP -0.155; TCGA LGG -0.054; TCGA LIHC -0.102; TCGA LUAD -0.074; TCGA LUSC -0.151; TCGA PAAD -0.144; TCGA STAD -0.193; TCGA UCEC -0.184
hsa-miR-1180-3p
ZMIZ1
9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LUSC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.091; TCGA CESC -0.129; TCGA COAD -0.095; TCGA ESCA -0.076; TCGA KIRC -0.08; TCGA LGG -0.166; TCGA LUSC -0.108; TCGA STAD -0.191; TCGA UCEC -0.146
hsa-miR-1180-3p
COL12A1
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC
MirTarget
TCGA BLCA -0.15; TCGA BRCA -0.097; TCGA COAD -0.25; TCGA KIRC -0.297; TCGA KIRP -0.263; TCGA LIHC -0.248; TCGA LUAD -0.27; TCGA LUSC -0.416; TCGA OV -0.31; TCGA PAAD -0.482; TCGA THCA -0.625; TCGA UCEC -0.173
hsa-miR-1180-3p
ETS1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.244; TCGA BRCA -0.211; TCGA CESC -0.161; TCGA COAD -0.166; TCGA ESCA -0.295; TCGA HNSC -0.156; TCGA KIRP -0.369; TCGA LGG -0.344; TCGA LIHC -0.293; TCGA LUAD -0.134; TCGA LUSC -0.512; TCGA OV -0.158; TCGA PAAD -0.143; TCGA SARC -0.102; TCGA THCA -0.16; TCGA STAD -0.153; TCGA UCEC -0.232
hsa-miR-1180-3p
TEF
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; OV; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.124; TCGA BRCA -0.13; TCGA CESC -0.219; TCGA COAD -0.267; TCGA HNSC -0.131; TCGA KIRP -0.145; TCGA LIHC -0.094; TCGA LUAD -0.131; TCGA OV -0.135; TCGA SARC -0.135; TCGA STAD -0.387; TCGA UCEC -0.262





Enriched cancer pathways of putative targets