microRNA information: hsa-miR-122-5p

SectionIDlink
Mature name: hsa-miR-122-5pmiRbase
Accession: MIMAT0000421miRbase
Precursor name: hsa-mir-122 miRbase
Precursor accession: MI0000442miRbase
Symbol: MIR122HGNC
RefSeq ID: NR_029667GenBank
Sequence: UGGAGUGUGACAAUGGUGUUUG



Reported expression in cancers: hsa-miR-122-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-122-5p

bladder cancerdownregulation"However the mount of miR-122 in bladder cancer and ......"27508026
hsa-miR-122-5p

breast cancerdownregulation"Breast cancer specific TRAIL expression mediated b ......"25150312qPCR
hsa-miR-122-5p

colorectal cancerdownregulation"Secondly validation of the results was carried out ......"27365381qPCR
hsa-miR-122-5p

gastric cancerupregulation"Plasma miR 122 and miR 192 as potential novel biom ......"24481716Reverse transcription PCR; qPCR
hsa-miR-122-5p

kidney renal cell cancerdownregulation"We analyzed 70 matched pairs of clear cell renal c ......"21784468qPCR; Microarray
hsa-miR-122-5p

kidney renal cell cancerupregulation"The aim of the present study was to investigate th ......"24175769qPCR
hsa-miR-122-5p

liver cancerdownregulation"Downregulation of miR 122 in the rodent and human ......"16924677Microarray
hsa-miR-122-5p

liver cancerdownregulation"Because understanding the pathogenesis of viral-as ......"18307259qPCR
hsa-miR-122-5p

liver cancerdownregulation"miR-122 a hepato-specific microRNA miRNA is freque ......"18692484
hsa-miR-122-5p

liver cancerdownregulation"MicroRNA 122 a tumor suppressor microRNA that regu ......"19296470Microarray
hsa-miR-122-5p

liver cancerdownregulation"OBJECTIVE miR-122 is highly abundant in liver and ......"19891584
hsa-miR-122-5p

liver cancerdownregulation"Proteomic identification of microRNA 122a target p ......"20859956
hsa-miR-122-5p

liver cancerdownregulation"miR-122 is a highly abundant hepatocyte-specific m ......"21038412
hsa-miR-122-5p

liver cancerdownregulation"Their aberrant expression revealed relations share ......"21554203
hsa-miR-122-5p

liver cancerdownregulation"Expression of microRNAs miR 21 miR 31 miR 122 miR ......"22213236qPCR
hsa-miR-122-5p

liver cancerdownregulation"We identified seven miRNAs that are also downregul ......"23719066
hsa-miR-122-5p

liver cancerdownregulation"miR-122 a liver specific miRNA is significantly do ......"24244539
hsa-miR-122-5p

liver cancerdownregulation"Identification of typical miRNAs and target genes ......"24452951Microarray
hsa-miR-122-5p

liver cancerdownregulation"Antitumor function of microRNA 122 against hepatoc ......"24531873
hsa-miR-122-5p

liver cancerdownregulation"MiR-122 is normally downregulated in HCC and regar ......"24653623
hsa-miR-122-5p

liver cancerdownregulation"MicroRNA-122 miR-122 a mammalian liver-specific mi ......"25422324
hsa-miR-122-5p

liver cancerdownregulation"MicroRNA-122 miR-122 is considered as a tumor supp ......"26252254
hsa-miR-122-5p

liver cancerdownregulation"These results indicated that activation of IGF-1R ......"26655273
hsa-miR-122-5p

pancreatic cancerderegulation"miR-122 let-7 family and miR-101 are down-regulate ......"22303361
hsa-miR-122-5p

prostate cancerderegulation"Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......"23781281
hsa-miR-122-5p

thyroid cancerupregulation"Redifferentiation and induction of tumor suppresso ......"23598436



Reported cancer pathway affected by hsa-miR-122-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-122-5p

bladder cancerApoptosis pathway"MiR 122 targets VEGFC in bladder cancer to inhibit ......"27508026Colony formation
hsa-miR-122-5p

breast cancercell cycle pathway"MiR 122 inhibits cell proliferation and tumorigene ......"23056576Colony formation; Luciferase
hsa-miR-122-5p

breast cancercell cycle pathway"We demonstrate that resveratrol regulates apoptoti ......"26890143
hsa-miR-122-5p

colorectal cancercell cycle pathway"In our CD patients six miRNAs were upregulated fro ......"22241525
hsa-miR-122-5p

kidney renal cell cancerPI3K/Akt signaling pathway"MicroRNA 122 promotes proliferation invasion and m ......"24175769Colony formation; Cell migration assay
hsa-miR-122-5p

liver cancerApoptosis pathway"miR 122 targets an anti apoptotic gene Bcl w in hu ......"18692484
hsa-miR-122-5p

liver cancerApoptosis pathway"miR 122 affects the viability and apoptosis of hep ......"19891584Flow cytometry
hsa-miR-122-5p

liver cancerApoptosis pathway"Small molecule modifiers of microRNA miR 122 funct ......"20527935
hsa-miR-122-5p

liver cancerEpithelial mesenchymal transition pathway; Apoptosis pathway"Modulation of the unfolded protein response is the ......"21750653
hsa-miR-122-5p

liver cancerApoptosis pathway"MicroRNA 122 suppresses cell proliferation and ind ......"22276989Luciferase; Western blot
hsa-miR-122-5p

liver cancerApoptosis pathway"Methylation regulation of liver specific microRNA ......"24085423Flow cytometry
hsa-miR-122-5p

liver cancerApoptosis pathway"miR 122 regulates tumorigenesis in hepatocellular ......"24244539
hsa-miR-122-5p

liver cancercell cycle pathway; Apoptosis pathway"miRNAs are small non-coding RNAs which target comp ......"24496037
hsa-miR-122-5p

liver cancerEpithelial mesenchymal transition pathway"Antitumor function of microRNA 122 against hepatoc ......"24531873
hsa-miR-122-5p

liver cancerApoptosis pathway"Gα12 overexpressed in hepatocellular carcinoma re ......"25965999Colony formation
hsa-miR-122-5p

liver cancerApoptosis pathway"MicroRNA 122 affects cell aggressiveness and apopt ......"26252254
hsa-miR-122-5p

liver cancercell cycle pathway; Apoptosis pathway"Exosomes derived from miR 122 modified adipose tis ......"26514126Western blot; Flow cytometry
hsa-miR-122-5p

liver cancerApoptosis pathway"MicroRNA 122 confers sorafenib resistance to hepat ......"26655273
hsa-miR-122-5p

liver cancerApoptosis pathway"MiR 122 Reverses the Doxorubicin Resistance in Hep ......"27138141Luciferase
hsa-miR-122-5p

liver cancerWnt signaling pathway"WNT1 Gene from WNT Signaling Pathway Is a Direct T ......"27687586Luciferase
hsa-miR-122-5p

lung squamous cell cancercell cycle pathway; Apoptosis pathway"MiR 122 Induces Radiosensitization in Non Small Ce ......"26389880
hsa-miR-122-5p

lung squamous cell cancerEpithelial mesenchymal transition pathway"miR 122 inhibits metastasis and epithelial mesench ......"26604787
hsa-miR-122-5p

lymphomaApoptosis pathway"miR 122 regulates p53/Akt signalling and the chemo ......"22235305
hsa-miR-122-5p

sarcomacell cycle pathway"MicroRNA sponge blocks the tumor suppressing funct ......"25269820



Reported cancer prognosis affected by hsa-miR-122-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-122-5p

bladder cancermetastasis; tumorigenesis; cell migration"MiR 122 targets VEGFC in bladder cancer to inhibit ......"27508026Colony formation
hsa-miR-122-5p

breast cancerstaging; drug resistance; recurrence; metastasis"De novo sequencing of circulating miRNAs identifie ......"22400902
hsa-miR-122-5p

breast cancertumorigenesis; progression"MiR 122 inhibits cell proliferation and tumorigene ......"23056576Colony formation; Luciferase
hsa-miR-122-5p

breast cancerdrug resistance"Neoadjuvant Chemotherapy in Breast Cancer Patients ......"25078559
hsa-miR-122-5p

breast cancerdrug resistance"Breast cancer specific TRAIL expression mediated b ......"25150312Luciferase
hsa-miR-122-5p

breast cancerdrug resistance"The association of the expression of miR 122 5p an ......"25318895
hsa-miR-122-5p

breast cancermetastasis; progression"Breast cancer secreted miR 122 reprograms glucose ......"25621950
hsa-miR-122-5p

breast cancerdrug resistance"We demonstrate that resveratrol regulates apoptoti ......"26890143
hsa-miR-122-5p

colon cancerdrug resistance"Overexpression of microRNA 122 re sensitizes 5 FU ......"24898807
hsa-miR-122-5p

colorectal cancerstaging; drug resistance"To explore the potential molecular biomarkers pred ......"24460313
hsa-miR-122-5p

colorectal cancermetastasis"Secondly validation of the results was carried out ......"27365381
hsa-miR-122-5p

colorectal cancerpoor survival; worse prognosis"Plasma miR 122 and miR 200 family are prognostic m ......"27632639
hsa-miR-122-5p

esophageal cancerdrug resistance"Esophageal cancer selective expression of TRAIL me ......"24659424
hsa-miR-122-5p

gastric cancermetastasis; worse prognosis; poor survival"Plasma miR 122 and miR 192 as potential novel biom ......"24481716
hsa-miR-122-5p

kidney renal cell cancertumorigenesis"With the advent of second-generation sequencing th ......"21253009
hsa-miR-122-5p

kidney renal cell cancermetastasis; malignant trasformation; recurrence"miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......"23178446
hsa-miR-122-5p

kidney renal cell cancerprogression"MicroRNA 122 promotes proliferation invasion and m ......"24175769Colony formation; Cell migration assay
hsa-miR-122-5p

liver cancertumorigenesis"Downregulation of miR 122 in the rodent and human ......"16924677
hsa-miR-122-5p

liver cancermalignant trasformation; worse prognosis"Because understanding the pathogenesis of viral-as ......"18307259
hsa-miR-122-5p

liver cancermetastasis; tumorigenesis"MicroRNA 122 a tumor suppressor microRNA that regu ......"19296470
hsa-miR-122-5p

liver cancerworse prognosis; progression; cell migration; differentiation"Loss of miR 122 expression in liver cancer correla ......"19617899
hsa-miR-122-5p

liver cancerpoor survival; tumorigenesis; drug resistance; malignant trasformation"MicroRNA 122 inhibits tumorigenic properties of he ......"19726678
hsa-miR-122-5p

liver cancertumorigenesis"miR 122 affects the viability and apoptosis of hep ......"19891584Flow cytometry
hsa-miR-122-5p

liver cancertumorigenesis; staging; poor survival"A novel GSK 3 beta C/EBP alpha miR 122 insulin lik ......"21038412Luciferase
hsa-miR-122-5p

liver cancerrecurrence"Sequencing and bioinformatics based analyses of th ......"21283620
hsa-miR-122-5p

liver cancermalignant trasformation; tumorigenesis"miR 122 inhibits viral replication and cell prolif ......"21725618
hsa-miR-122-5p

liver cancerdrug resistance; tumorigenesis; poor survival"Modulation of the unfolded protein response is the ......"21750653
hsa-miR-122-5p

liver cancerdifferentiation"Epigenetic modulation of miR 122 facilitates human ......"22140464
hsa-miR-122-5p

liver cancerstaging; worse prognosis"Expression of microRNAs miR 21 miR 31 miR 122 miR ......"22213236
hsa-miR-122-5p

liver cancerstaging; poor survival"Serum microRNA 1 and microRNA 122 are prognostic m ......"23810247
hsa-miR-122-5p

liver cancermetastasis; tumorigenesis"Hepatic loss of miR 122 predisposes mice to hepato ......"24113455
hsa-miR-122-5p

liver cancerdrug resistance; tumorigenesis; progression"microRNA 122 abundance in hepatocellular carcinoma ......"24130799
hsa-miR-122-5p

liver cancertumorigenesis; cell migration"miR 122 regulates tumorigenesis in hepatocellular ......"24244539
hsa-miR-122-5p

liver cancermetastasis"miR 122 targets pyruvate kinase M2 and affects met ......"24466275
hsa-miR-122-5p

liver cancercell migration; worse prognosis"miRNAs are small non-coding RNAs which target comp ......"24496037
hsa-miR-122-5p

liver cancermetastasis; worse prognosis; differentiation; tumor size; tumorigenesis; drug resistance"Antitumor function of microRNA 122 against hepatoc ......"24531873
hsa-miR-122-5p

liver cancermotility; metastasis; worse prognosis; cell migration"MicroRNA 122 triggers mesenchymal epithelial trans ......"24992599
hsa-miR-122-5p

liver cancermetastasis; motility"MicroRNA 122 miR-122 is a tumor suppressor for hep ......"25023326
hsa-miR-122-5p

liver cancerpoor survival"Univariate analysis revealed that miR-200a miR-21 ......"25275448
hsa-miR-122-5p

liver cancertumorigenesis; worse prognosis"Decreased expression of hepatocyte nuclear factor ......"25422324
hsa-miR-122-5p

liver cancerpoor survival; tumor size; worse prognosis"High serum microRNA 122 level is independently ass ......"25636448
hsa-miR-122-5p

liver cancerstaging"In the discovery stage 2 serum samples pooled from ......"25962820
hsa-miR-122-5p

liver cancerprogression; staging; metastasis; poor survival; recurrence"Gα12 overexpressed in hepatocellular carcinoma re ......"25965999Colony formation
hsa-miR-122-5p

liver cancerstaging"High circulating microRNA 122 expression is a poor ......"26129878
hsa-miR-122-5p

liver cancerpoor survival; cell migration"MicroRNA 122 affects cell aggressiveness and apopt ......"26252254
hsa-miR-122-5p

liver cancerprogression"A panel of ten cancer-associated miRNAs was analyz ......"26264553
hsa-miR-122-5p

liver cancertumorigenesis"Upregulation of microRNA 122 by farnesoid X recept ......"26302777Western blot; Luciferase
hsa-miR-122-5p

liver cancerdrug resistance"MicroRNA 122 confers sorafenib resistance to hepat ......"26655273
hsa-miR-122-5p

liver cancermetastasis"Differential TGFβ pathway targeting by miR 122 in ......"26987776
hsa-miR-122-5p

liver cancerdrug resistance"MiR 122 Reverses the Doxorubicin Resistance in Hep ......"27138141Luciferase
hsa-miR-122-5p

liver cancerprogression; staging"miR 122 mediated translational repression of PEG10 ......"27370270Western blot
hsa-miR-122-5p

lung cancerstaging; poor survival"Using real-time RT-PCR we analyzed the expression ......"24282590
hsa-miR-122-5p

lung squamous cell cancerpoor survival; drug resistance"MiR 122 Induces Radiosensitization in Non Small Ce ......"26389880
hsa-miR-122-5p

lung squamous cell cancermetastasis"miR 122 inhibits metastasis and epithelial mesench ......"26604787
hsa-miR-122-5p

lymphomastaging; malignant trasformation"miR 122 regulates p53/Akt signalling and the chemo ......"22235305
hsa-miR-122-5p

pancreatic cancertumorigenesis"miR-122 let-7 family and miR-101 are down-regulate ......"22303361
hsa-miR-122-5p

pancreatic cancerstaging"The miRNAs expression profile of early stage was s ......"24785459
hsa-miR-122-5p

prostate cancerdrug resistance"To solve this problem we inserted miRNA response e ......"24292881Luciferase
hsa-miR-122-5p

sarcomacell migration; tumorigenesis"MicroRNA sponge blocks the tumor suppressing funct ......"25269820
hsa-miR-122-5p

sarcomadrug resistance"The present study aimed to employ the miRNA respon ......"25335093Luciferase
hsa-miR-122-5p

thyroid cancerdifferentiation"Redifferentiation and induction of tumor suppresso ......"23598436



Reported gene related to hsa-miR-122-5p

miRNAcancergenereportingPUBMED
hsa-miR-122-5p

colon cancerPKM"Overexpression of microRNA 122 re sensitizes 5 FU ......"24898807
hsa-miR-122-5p

esophageal cancerPKM"Tanshinone ⅡA inhibits human esophageal cancer c ......"27040384
hsa-miR-122-5p

liver cancerPKM"MicroRNA 122 affects cell aggressiveness and apopt ......"26252254
hsa-miR-122-5p

liver cancerPKM"Here we show that a differentiated cell specific m ......"22140464
hsa-miR-122-5p

liver cancerPKM"The present study demonstrated the regulatory role ......"24466275
hsa-miR-122-5p

liver cancerPKM"Meanwhile luciferase reporter assay proved that th ......"27138141
hsa-miR-122-5p

breast cancerADAM10"The association of the expression of miR 122 5p an ......"25318895
hsa-miR-122-5p

liver cancerADAM10"Transduction of aggressive HCC cells Mahlavu with ......"25023326
hsa-miR-122-5p

liver cancerBCL2L2"Transduction of aggressive HCC cells Mahlavu with ......"25023326
hsa-miR-122-5p

liver cancerBCL2L2"miR 122 targets an anti apoptotic gene Bcl w in hu ......"18692484
hsa-miR-122-5p

liver cancerBPIFA4P"These findings indicate that the C to A base chang ......"24995424
hsa-miR-122-5p

liver cancerBPIFA4P"MicroRNAs miRNAs a class of short endogenous RNAs ......"21286309
hsa-miR-122-5p

liver cancerCEBPA"A novel GSK 3 beta C/EBP alpha miR 122 insulin lik ......"21038412
hsa-miR-122-5p

liver cancerCEBPA"Recently miR-122 has been reported to be regulated ......"24653623
hsa-miR-122-5p

breast cancerIGF1R"MiR 122 inhibits cell proliferation and tumorigene ......"23056576
hsa-miR-122-5p

liver cancerIGF1R"Expression of SRF or Igf1R partially reversed tumo ......"19726678
hsa-miR-122-5p

colorectal cancerPCNA"Additionally cyclin G a cell-cycle regulator miR-1 ......"22241525
hsa-miR-122-5p

liver cancerPCNA"Loss of miR-122 expression in patients with hepati ......"23221562
hsa-miR-122-5p

liver cancerTP53"Loss of miR-122 expression in patients with hepati ......"23221562
hsa-miR-122-5p

lymphomaTP53"Surprisingly miR-122 overexpression decreased the ......"22235305
hsa-miR-122-5p

liver cancerWNT1"WNT1 Gene from WNT Signaling Pathway Is a Direct T ......"27687586
hsa-miR-122-5p

liver cancerWNT1"The 3'-UTR segments of Wnt1 containing the miR-122 ......"22276989
hsa-miR-122-5p

liver cancerXPR1"Peroxisome proliferator activated receptor-gamma P ......"23703729
hsa-miR-122-5p

liver cancerXPR1"Upregulation of microRNA 122 by farnesoid X recept ......"26302777
hsa-miR-122-5p

liver cancerABCB1"MiR 122 Reverses the Doxorubicin Resistance in Hep ......"27138141
hsa-miR-122-5p

prostate cancerAD6"miR122 regulation of Ad6 significantly improves it ......"22914437
hsa-miR-122-5p

liver cancerADAM17"We further showed that one of the miR-122 targets ......"19296470
hsa-miR-122-5p

liver cancerAFP"As a single marker α-fetoprotein AFP and miR-122 ......"26264553
hsa-miR-122-5p

liver cancerAKT3"miR 122 regulates tumorigenesis in hepatocellular ......"24244539
hsa-miR-122-5p

liver cancerBCL2"In an effort to identify novel miR-122 targets we ......"18692484
hsa-miR-122-5p

liver cancerCASP3"The cellular mRNA and protein levels of Bcl-w were ......"18692484
hsa-miR-122-5p

colorectal cancerCCNG1"Additionally cyclin G a cell-cycle regulator miR-1 ......"22241525
hsa-miR-122-5p

gastric cancerCTSG"The plasma miR-122 level was again lower and the p ......"24481716
hsa-miR-122-5p

liver cancerDLL1"2-Delta Delta CT method was used for quantitative ......"19403413
hsa-miR-122-5p

liver cancerDLX4"This study proposed that the overexpression of DLX ......"25823567
hsa-miR-122-5p

gastric cancerDMPK"Our results demonstrated that assessment of decrea ......"24481716
hsa-miR-122-5p

liver cancerDR1"Peroxisome proliferator activated receptor-gamma P ......"23703729
hsa-miR-122-5p

liver cancerEGF"In summary our results reveal a novel Hnf4α/miR-1 ......"25422324
hsa-miR-122-5p

lung cancerEGFR"In the 20 miRNAs miR-122 were found differently ex ......"24282590
hsa-miR-122-5p

kidney renal cell cancerEIF4EBP1"Further experiments demonstrated that overexpressi ......"24175769
hsa-miR-122-5p

breast cancerERBB2"It can be explained like that miR-122-5p expressio ......"25318895
hsa-miR-122-5p

liver cancerGALNT10"Decreased expression of hepatocyte nuclear factor ......"25422324
hsa-miR-122-5p

liver cancerGSK3B"A novel GSK 3 beta C/EBP alpha miR 122 insulin lik ......"21038412
hsa-miR-122-5p

liver cancerHINT1"Despite this several studies hint at differences i ......"24130799
hsa-miR-122-5p

breast cancerHK1"Mechanistically cancer-cell-derived miR-122 suppre ......"25621950
hsa-miR-122-5p

liver cancerIFNL3"Among HCV-infected Japanese subjects reductions in ......"24130799
hsa-miR-122-5p

liver cancerIGF1"Insulin-like growth factor 1 receptor IGF-1R was v ......"26655273
hsa-miR-122-5p

lung squamous cell cancerINSR"MiR-122 also boosts the inhibitory activity of ion ......"26389880
hsa-miR-122-5p

liver cancerMET"Gα12 overexpressed in hepatocellular carcinoma re ......"25965999
hsa-miR-122-5p

liver cancerMSC"This study aimed to determine whether adipose tiss ......"26514126
hsa-miR-122-5p

kidney renal cell cancerMTOR"Further experiments demonstrated that overexpressi ......"24175769
hsa-miR-122-5p

liver cancerMYC"c-Myc is a well-known oncogene frequently up-regul ......"24038073
hsa-miR-122-5p

liver cancerMYCN"NDRG3 a member of the N-myc downstream-regulated g ......"21725618
hsa-miR-122-5p

liver cancerNDRG3"miR 122 inhibits viral replication and cell prolif ......"21725618
hsa-miR-122-5p

lymphomaNOTCH1"Using a recently established model in which apopto ......"22235305
hsa-miR-122-5p

liver cancerNR1H4"The levels of miR-122 and FXR in HCC tissues and c ......"26302777
hsa-miR-122-5p

lung cancerOAP"The data revealed that OA suppressed the prolifera ......"25472877
hsa-miR-122-5p

liver cancerONECUT1"MiR-122 expression is regulated by liver-enriched ......"24531873
hsa-miR-122-5p

liver cancerPDK4"Furthermore the liver-specific miRNA miR-122 inhib ......"26506419
hsa-miR-122-5p

liver cancerPEG10"miR 122 mediated translational repression of PEG10 ......"27370270
hsa-miR-122-5p

breast cancerPIK3CG"We also identified a novel putative miR-122 target ......"23056576
hsa-miR-122-5p

breast cancerPPR1"Two miRNAs miR-34a and miR-122 that were significa ......"25078559
hsa-miR-122-5p

liver cancerPROM1"Our findings suggest that enhanced glycolysis is a ......"26506419
hsa-miR-122-5p

liver cancerPTTG1"Hepatitis B virus mRNA mediated miR 122 inhibition ......"23221562
hsa-miR-122-5p

liver cancerRHOA"MicroRNA 122 triggers mesenchymal epithelial trans ......"24992599
hsa-miR-122-5p

liver cancerSRF"Expression of SRF or Igf1R partially reversed tumo ......"19726678
hsa-miR-122-5p

liver cancerSTAT3"Gα12 destabilized HNF4α by accelerating ubiquiti ......"25965999
hsa-miR-122-5p

liver cancerSUV39H1"The aforementioned DNA-protein complex also contai ......"23703729
hsa-miR-122-5p

liver cancerTERT"To circumvent side effects due to TERT expression ......"26189916
hsa-miR-122-5p

lymphomaTSPYL2"Using a recently established model in which apopto ......"22235305
hsa-miR-122-5p

bladder cancerVEGFC"MiR 122 targets VEGFC in bladder cancer to inhibit ......"27508026
hsa-miR-122-5p

liver cancerZAK"Integrated gene expression analysis in a cohort of ......"24466275