microRNA information: hsa-miR-1228-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1228-3p | miRbase |
| Accession: | MIMAT0005583 | miRbase |
| Precursor name: | hsa-mir-1228 | miRbase |
| Precursor accession: | MI0006318 | miRbase |
| Symbol: | MIR1228 | HGNC |
| RefSeq ID: | NR_031597 | GenBank |
| Sequence: | UCACACCUGCCUCGCCCCCC |
Reported expression in cancers: hsa-miR-1228-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-1228-3p | breast cancer | upregulation | "Here in this study we found that miR-1228 was up-r ......" | 26261546 | |
| hsa-miR-1228-3p | liver cancer | downregulation | "The following miRNAs were downregulated in the tum ......" | 23205106 |
Reported cancer pathway affected by hsa-miR-1228-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1228-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1228-3p | breast cancer | metastasis | "MiR 1228 promotes breast cancer cell growth and me ......" | 26261546 | Luciferase |
Reported gene related to hsa-miR-1228-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1228-3p | breast cancer | MOAP1 | "Rescue experiment demonstrated that miR-1228 promo ......" | 26261546 |
| hsa-miR-1228-3p | breast cancer | SCAI | "MiR 1228 promotes breast cancer cell growth and me ......" | 26261546 |