microRNA information: hsa-miR-1236-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1236-3p | miRbase |
| Accession: | MIMAT0005591 | miRbase |
| Precursor name: | hsa-mir-1236 | miRbase |
| Precursor accession: | MI0006326 | miRbase |
| Symbol: | MIR1236 | HGNC |
| RefSeq ID: | NR_031601 | GenBank |
| Sequence: | CCUCUUCCCCUUGUCUCUCCAG |
Reported expression in cancers: hsa-miR-1236-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-1236-3p | kidney renal cell cancer | downregulation | "Targeted p21WAF1/CIP1 activation by miR 1236 inhib ......" | 26421587 | qPCR |
| hsa-miR-1236-3p | ovarian cancer | downregulation | "Here we report that miR-1236-3p expression was dow ......" | 24573236 |
Reported cancer pathway affected by hsa-miR-1236-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1236-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1236-3p | B cell lymphoma | staging; drug resistance | "In the discovery phase real-time polymerase chain ......" | 24858372 | |
| hsa-miR-1236-3p | kidney renal cell cancer | poor survival; progression | "Targeted p21WAF1/CIP1 activation by miR 1236 inhib ......" | 26421587 | Western blot; Cell proliferation assay; Colony formation; Cell Proliferation Assay |
| hsa-miR-1236-3p | ovarian cancer | cell migration; metastasis | "miR 1236 3p represses the cell migration and invas ......" | 24573236 | Luciferase |
Reported gene related to hsa-miR-1236-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1236-3p | kidney renal cell cancer | CCND1 | "Functional experiments showed that increased miR-1 ......" | 26421587 |
| hsa-miR-1236-3p | kidney renal cell cancer | LARP6 | "Chromatin immunoprecipitation assay in the human R ......" | 26421587 |
| hsa-miR-1236-3p | kidney renal cell cancer | PCNA | "Functional experiments showed that increased miR-1 ......" | 26421587 |
| hsa-miR-1236-3p | ovarian cancer | ZEB1 | "miR 1236 3p represses the cell migration and invas ......" | 24573236 |