---

microRNA information: hsa-miR-1237-3p

Section	ID	link
Mature name:	hsa-miR-1237-3p	miRbase
Accession:	MIMAT0005592	miRbase
Precursor name:	hsa-mir-1237	miRbase
Precursor accession:	MI0006327	miRbase
Symbol:	MIR1237	HGNC
RefSeq ID:	NR_031602	GenBank
Sequence:	UCCUUCUGCUCCGUCCCCCAG

---

Reported expression in cancers: hsa-miR-1237-3p

miRNA	cancer	regulation	reporting	PUBMED	method

---

Reported cancer pathway affected by hsa-miR-1237-3p

miRNA	cancer	pathway	reporting	PUBMED	functional study

---

Reported cancer prognosis affected by hsa-miR-1237-3p

miRNA	cancer	prognosis	reporting	PUBMED	functional study
hsa-miR-1237-3p	chordoma	worse prognosis; poor survival; recurrence	"A miRNA array was used to profile differentially e ......"	25850393
hsa-miR-1237-3p	gastric cancer	cell migration	"Here we determined that MIR219.2 MIR663b and MIR12 ......"	26043902

---

Reported gene related to hsa-miR-1237-3p

miRNA	cancer	gene	reporting	PUBMED
hsa-miR-1237-3p	chordoma	CHDM	"Altered miR-1237-3p expression was then found to b ......"	25850393