microRNA information: hsa-miR-124-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-124-3p | miRbase |
Accession: | MIMAT0000422 | miRbase |
Precursor name: | hsa-mir-124-1 | miRbase |
Precursor accession: | MI0000443 | miRbase |
Symbol: | MIR124-1 | HGNC |
RefSeq ID: | NR_029668 | GenBank |
Sequence: | UAAGGCACGCGGUGAAUGCC |
Reported expression in cancers: hsa-miR-124-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-124-3p | breast cancer | downregulation | "The expression levels of miR-124 were examined in ......" | 24330780 | Reverse transcription PCR |
hsa-miR-124-3p | breast cancer | downregulation | "However the effects of the expression of miR-124 i ......" | 25085587 | qPCR |
hsa-miR-124-3p | breast cancer | downregulation | "miR-124 expression in breast cancer tissue was mea ......" | 25731732 | qPCR |
hsa-miR-124-3p | breast cancer | downregulation | "MicroRNA-124 miR-124 has been reported to be downr ......" | 25924779 | qPCR |
hsa-miR-124-3p | breast cancer | downregulation | "In this study we investigated to clarify the clini ......" | 26415857 | qPCR |
hsa-miR-124-3p | cervical and endocervical cancer | downregulation | "MicroRNA-124 miR-124 was reported to be attenuated ......" | 27571703 | qPCR |
hsa-miR-124-3p | colorectal cancer | downregulation | "Recently microRNA-124 miR-124 has been demonstrate ......" | 22885837 | qPCR |
hsa-miR-124-3p | colorectal cancer | downregulation | "In this study we demonstrate that expression of mi ......" | 23691514 | |
hsa-miR-124-3p | colorectal cancer | downregulation | "In this study we show that miR-124 is significantl ......" | 23940556 | |
hsa-miR-124-3p | colorectal cancer | downregulation | "Among the inferred candidates three miRNAs miR-101 ......" | 25286864 | |
hsa-miR-124-3p | colorectal cancer | downregulation | "Downregulation of rho associated protein kinase 1 ......" | 25987767 | |
hsa-miR-124-3p | colorectal cancer | downregulation | "miR-124 and miR-506 are reportedly down-regulated ......" | 26497367 | qPCR; in situ hybridization |
hsa-miR-124-3p | colorectal cancer | downregulation | "To detect the expression of miR-124 in colorectal ......" | 27578582 | qPCR |
hsa-miR-124-3p | endometrial cancer | downregulation | "Recently several studies have shown that microRNA- ......" | 24287565 | |
hsa-miR-124-3p | endometrial cancer | downregulation | "Enforced expression of miR-124 suppresses EC cell ......" | 26934121 | |
hsa-miR-124-3p | esophageal cancer | downregulation | "In this study we identified the reduced expression ......" | 27323123 | |
hsa-miR-124-3p | gastric cancer | downregulation | "The clinical significance of downregulation of mir ......" | 24805774 | Microarray |
hsa-miR-124-3p | gastric cancer | downregulation | "In this study we found that miR-124 was down-regul ......" | 26612211 | |
hsa-miR-124-3p | gastric cancer | downregulation | "Evaluation of miR 29c miR 124 miR 135a and miR 148 ......" | 26885198 | Reverse transcription PCR; qPCR |
hsa-miR-124-3p | glioblastoma | downregulation | "We used high-throughput sequencing to comprehensiv ......" | 21912681 | RNA-Seq |
hsa-miR-124-3p | kidney renal cell cancer | downregulation | "Integrated analyses allow understanding the interp ......" | 26002553 | |
hsa-miR-124-3p | liver cancer | downregulation | "Recent studies have shown that microRNA-124 miR-12 ......" | 22940133 | |
hsa-miR-124-3p | liver cancer | downregulation | "Down-regulation of miR-124 has been demonstrated i ......" | 24211205 | |
hsa-miR-124-3p | lung cancer | downregulation | "MicroRNA-124 miR-124 has been proven dysregulated ......" | 25973090 | qPCR |
hsa-miR-124-3p | lung cancer | downregulation | "The purpose of our study was to investigate the fu ......" | 27251409 | qPCR |
hsa-miR-124-3p | lung squamous cell cancer | downregulation | "Down-regulated expression of miR-124 gene has been ......" | 27376157 | |
hsa-miR-124-3p | melanoma | downregulation | "One of these miRNAs miR-124 has been found aberran ......" | 27657824 | |
hsa-miR-124-3p | ovarian cancer | downregulation | "The expression of miR-124 was assessed in clinical ......" | 24279510 | |
hsa-miR-124-3p | pancreatic cancer | downregulation | "In this study we investigated the epigenetic modif ......" | 23334332 | |
hsa-miR-124-3p | prostate cancer | downregulation | "Recent studies have shown that downregulation of t ......" | 23069658 | |
hsa-miR-124-3p | sarcoma | deregulation | "In this study we found that miR-124 was downregula ......" | 27644254 |
Reported cancer pathway affected by hsa-miR-124-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-124-3p | B cell lymphoma | Apoptosis pathway | "Here we show that miR-124 influences GC-induced ap ......" | 25576220 | |
hsa-miR-124-3p | acute myeloid leukemia | Apoptosis pathway | "Dysregulation of miR 124 1 predicts favorable prog ......" | 24135052 | |
hsa-miR-124-3p | bladder cancer | cell cycle pathway | "miR-124-3p is down-regulated in various cancers an ......" | 24180482 | Flow cytometry; MTT assay; Transwell assay; Wound Healing Assay; Western blot; Luciferase |
hsa-miR-124-3p | bladder cancer | cell cycle pathway | "MiR 124 retards bladder cancer growth by directly ......" | 25348738 | |
hsa-miR-124-3p | breast cancer | cell cycle pathway | "Finally our approach led us to identify and valida ......" | 22333974 | |
hsa-miR-124-3p | breast cancer | Epithelial mesenchymal transition pathway | "MiR 124 targets Slug to regulate epithelial mesenc ......" | 23250910 | Colony formation |
hsa-miR-124-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "A luciferase reporter assay was used to determine ......" | 23816858 | Luciferase; Western blot; Flow cytometry |
hsa-miR-124-3p | breast cancer | Apoptosis pathway | "However the effects of the expression of miR-124 i ......" | 25085587 | Western blot; Luciferase |
hsa-miR-124-3p | breast cancer | cell cycle pathway | "MiR 124 inhibits cell proliferation in breast canc ......" | 25731732 | Luciferase |
hsa-miR-124-3p | breast cancer | Apoptosis pathway | "Codelivery of a miR 124 Mimic and Obatoclax by Cho ......" | 27266580 | Colony formation |
hsa-miR-124-3p | cervical and endocervical cancer | Apoptosis pathway | "MALAT1 miR 124 RBG2 axis is involved in growth and ......" | 26242259 | |
hsa-miR-124-3p | cervical and endocervical cancer | Epithelial mesenchymal transition pathway | "MicroRNA-124 miR-124 was reported to be attenuated ......" | 27571703 | |
hsa-miR-124-3p | colorectal cancer | Apoptosis pathway | "In this study we demonstrate that expression of mi ......" | 23691514 | Luciferase; Colony formation |
hsa-miR-124-3p | colorectal cancer | Apoptosis pathway | "MiR 124 suppresses growth of human colorectal canc ......" | 23940556 | |
hsa-miR-124-3p | colorectal cancer | Apoptosis pathway | "The pro apoptotic role of the regulatory feedback ......" | 24619225 | |
hsa-miR-124-3p | colorectal cancer | Apoptosis pathway | "In this study we investigated the role of miR-124 ......" | 25818238 | |
hsa-miR-124-3p | endometrial cancer | Epithelial mesenchymal transition pathway | "Reactivation of epigenetically silenced miR 124 re ......" | 26934121 | |
hsa-miR-124-3p | esophageal cancer | cell cycle pathway; Apoptosis pathway | "STAT3 is involved in miR 124 mediated suppressive ......" | 25928665 | Luciferase |
hsa-miR-124-3p | esophageal cancer | cell cycle pathway; Apoptosis pathway | "miR 124 radiosensitizes human esophageal cancer ce ......" | 27323123 | Wound Healing Assay; Luciferase; Western blot |
hsa-miR-124-3p | gastric cancer | Apoptosis pathway | "Cell apoptosis of MGC-803 cells was measured using ......" | 26109806 | Flow cytometry; Western blot |
hsa-miR-124-3p | gastric cancer | cell cycle pathway | "miR 124 interacts with the Notch1 signalling pathw ......" | 26612211 | |
hsa-miR-124-3p | glioblastoma | Apoptosis pathway; cell cycle pathway | "Downregulation of miR 124 promotes the growth and ......" | 23624869 | |
hsa-miR-124-3p | glioblastoma | cell cycle pathway | "Here we demonstrate that gap junctions mediate an ......" | 25753094 | |
hsa-miR-124-3p | kidney renal cell cancer | Apoptosis pathway | "miR 124 represses FZD5 to attenuate P glycoprotein ......" | 25861751 | |
hsa-miR-124-3p | kidney renal cell cancer | cell cycle pathway | "Integrated analyses allow understanding the interp ......" | 26002553 | |
hsa-miR-124-3p | liver cancer | cell cycle pathway | "MiR 124 suppresses cell proliferation in hepatocel ......" | 22940133 | |
hsa-miR-124-3p | liver cancer | Apoptosis pathway | "Down-regulation of miR-124 has been demonstrated i ......" | 24211205 | Luciferase |
hsa-miR-124-3p | lung cancer | Apoptosis pathway; Epithelial mesenchymal transition pathway | "The purpose of our study was to investigate the fu ......" | 27251409 | Luciferase |
hsa-miR-124-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "The feedback loop between miR 124 and TGF β pathw ......" | 26818357 | |
hsa-miR-124-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "Abnormal expression of microRNA-124 miR-124 was fo ......" | 27073840 | Western blot; Luciferase |
hsa-miR-124-3p | lung squamous cell cancer | Apoptosis pathway | "Down-regulated expression of miR-124 gene has been ......" | 27376157 | Colony formation |
hsa-miR-124-3p | prostate cancer | Apoptosis pathway | "miR 124 and Androgen Receptor Signaling Inhibitors ......" | 26573802 | |
hsa-miR-124-3p | retinoblastoma | cell cycle pathway | "To investigate differential expression of microRNA ......" | 21941147 | |
hsa-miR-124-3p | sarcoma | Apoptosis pathway | "The tumor suppressor role of miR 124 in osteosarco ......" | 24971902 | Luciferase |
hsa-miR-124-3p | sarcoma | Wnt signaling pathway | "However the detailed mechanism of miR-124 in the r ......" | 26259653 | Luciferase |
Reported cancer prognosis affected by hsa-miR-124-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-124-3p | B cell lymphoma | drug resistance | "Here we show that miR-124 influences GC-induced ap ......" | 25576220 | |
hsa-miR-124-3p | B cell lymphoma | poor survival | "Here we identify microRNA-124 miR-124 as a negativ ......" | 25915824 | |
hsa-miR-124-3p | acute myeloid leukemia | worse prognosis; differentiation; poor survival | "Dysregulation of miR 124 1 predicts favorable prog ......" | 24135052 | |
hsa-miR-124-3p | bladder cancer | motility | "miR-124-3p is down-regulated in various cancers an ......" | 24180482 | Flow cytometry; MTT assay; Transwell assay; Wound Healing Assay; Western blot; Luciferase |
hsa-miR-124-3p | bladder cancer | motility; progression; metastasis | "MiR 124 exerts tumor suppressive functions on the ......" | 26310391 | Western blot; Luciferase |
hsa-miR-124-3p | breast cancer | worse prognosis | "Genetic variants at the miR 124 binding site on th ......" | 21318219 | |
hsa-miR-124-3p | breast cancer | metastasis | "miR 124 suppresses multiple steps of breast cancer ......" | 22085528 | |
hsa-miR-124-3p | breast cancer | progression | "Finally our approach led us to identify and valida ......" | 22333974 | |
hsa-miR-124-3p | breast cancer | metastasis; motility | "MiR 124 targets Slug to regulate epithelial mesenc ......" | 23250910 | Colony formation |
hsa-miR-124-3p | breast cancer | motility; metastasis | "A luciferase reporter assay was used to determine ......" | 23816858 | Luciferase; Western blot; Flow cytometry |
hsa-miR-124-3p | breast cancer | staging; metastasis | "In this study we investigated the role of miR-124 ......" | 24330780 | Luciferase |
hsa-miR-124-3p | breast cancer | metastasis | "However the effects of the expression of miR-124 i ......" | 25085587 | Western blot; Luciferase |
hsa-miR-124-3p | breast cancer | progression; tumorigenesis | "MiR 124 inhibits cell proliferation in breast canc ......" | 25731732 | Luciferase |
hsa-miR-124-3p | breast cancer | worse prognosis; poor survival; staging; metastasis; differentiation; progression | "MicroRNA-124 miR-124 has been reported to be downr ......" | 25924779 | |
hsa-miR-124-3p | breast cancer | poor survival; staging; metastasis | "In this study we investigated to clarify the clini ......" | 26415857 | |
hsa-miR-124-3p | breast cancer | progression | "miR 124 downregulation leads to breast cancer prog ......" | 26918449 | |
hsa-miR-124-3p | breast cancer | cell migration | "Codelivery of a miR 124 Mimic and Obatoclax by Cho ......" | 27266580 | Colony formation |
hsa-miR-124-3p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
hsa-miR-124-3p | breast cancer | progression | "Decreased miR 124 3p Expression Prompted Breast Ca ......" | 27468577 | Luciferase; Western blot |
hsa-miR-124-3p | breast cancer | malignant trasformation; progression | "Studies have shown that miR-124 is involved in the ......" | 27748910 | Colony formation; Luciferase |
hsa-miR-124-3p | cervical and endocervical cancer | tumorigenesis | "Methylation mediated silencing and tumour suppress ......" | 20579385 | |
hsa-miR-124-3p | cervical and endocervical cancer | motility; metastasis | "MiR 124 represses vasculogenic mimicry and cell mo ......" | 25218344 | |
hsa-miR-124-3p | cervical and endocervical cancer | tumorigenesis | "The methylation status was determined using Human ......" | 26797462 | |
hsa-miR-124-3p | colorectal cancer | differentiation; worse prognosis; poor survival; staging; tumor size | "Recently microRNA-124 miR-124 has been demonstrate ......" | 22885837 | |
hsa-miR-124-3p | colorectal cancer | worse prognosis | "miR 124 miR 137 and miR 340 regulate colorectal ca ......" | 22895557 | |
hsa-miR-124-3p | colorectal cancer | worse prognosis | "The pro apoptotic role of the regulatory feedback ......" | 24619225 | |
hsa-miR-124-3p | colorectal cancer | tumorigenesis; motility | "Here through bioinformatic analyses and functional ......" | 24909917 | |
hsa-miR-124-3p | colorectal cancer | cell migration; staging; metastasis | "Downregulation of rho associated protein kinase 1 ......" | 25987767 | Western blot; Colony formation |
hsa-miR-124-3p | colorectal cancer | tumorigenesis | "Pri miR 124 rs531564 polymorphism and colorectal c ......" | 26423518 | |
hsa-miR-124-3p | colorectal cancer | progression | "miR 124 and miR 506 inhibit colorectal cancer prog ......" | 26497367 | Western blot; Luciferase |
hsa-miR-124-3p | colorectal cancer | metastasis; progression | "MicroRNA 124 MiR 124 Inhibits Cell Proliferation M ......" | 27159971 | Western blot; Colony formation |
hsa-miR-124-3p | endometrial cancer | poor survival | "Reactivation of epigenetically silenced miR 124 re ......" | 26934121 | |
hsa-miR-124-3p | gastric cancer | metastasis; differentiation; tumor size | "To investigate the DNA methylation status of the p ......" | 21365509 | |
hsa-miR-124-3p | gastric cancer | metastasis | "MicroRNA-124 miR-124 a pivotal member of the p53 n ......" | 24658854 | Colony formation |
hsa-miR-124-3p | gastric cancer | tumorigenesis; staging; metastasis; differentiation | "The clinical significance of downregulation of mir ......" | 24805774 | |
hsa-miR-124-3p | gastric cancer | drug resistance | "Cell apoptosis of MGC-803 cells was measured using ......" | 26109806 | Flow cytometry; Western blot |
hsa-miR-124-3p | gastric cancer | staging; metastasis | "Evaluation of miR 29c miR 124 miR 135a and miR 148 ......" | 26885198 | |
hsa-miR-124-3p | gastric cancer | tumorigenesis | "Epigenetic silencing of miR 124 prevents spermine ......" | 27041578 | |
hsa-miR-124-3p | glioblastoma | differentiation | "miR 124 and miR 137 inhibit proliferation of gliob ......" | 18577219 | |
hsa-miR-124-3p | glioblastoma | differentiation; malignant trasformation; progression | "Downregulation of miR 124 promotes the growth and ......" | 23624869 | |
hsa-miR-124-3p | glioblastoma | differentiation | "Interestingly we observed that several identified ......" | 24465609 | |
hsa-miR-124-3p | glioblastoma | poor survival; progression | "Here we show that miR-124 expression is negatively ......" | 24954504 | |
hsa-miR-124-3p | glioblastoma | drug resistance | "Instead of attenuating the virus with mutations in ......" | 25200130 | |
hsa-miR-124-3p | head and neck cancer | drug resistance | "miR 124 Regulates the Epithelial Restricted with S ......" | 26227488 | Colony formation |
hsa-miR-124-3p | kidney renal cell cancer | staging; recurrence | "Hsa mir 124 3 CpG island methylation is associated ......" | 23321515 | |
hsa-miR-124-3p | kidney renal cell cancer | drug resistance | "miR 124 represses FZD5 to attenuate P glycoprotein ......" | 25861751 | |
hsa-miR-124-3p | kidney renal cell cancer | metastasis; poor survival | "Integrated analyses allow understanding the interp ......" | 26002553 | |
hsa-miR-124-3p | liver cancer | tumorigenesis | "miR 124 and miR 203 are epigenetically silenced tu ......" | 19843643 | |
hsa-miR-124-3p | liver cancer | metastasis; motility; worse prognosis | "Recent profile studies of microRNA miRNA expressio ......" | 21672940 | Luciferase |
hsa-miR-124-3p | liver cancer | tumorigenesis | "MiR 124 suppresses cell proliferation in hepatocel ......" | 22940133 | |
hsa-miR-124-3p | liver cancer | tumorigenesis | "Down-regulation of miR-124 has been demonstrated i ......" | 24211205 | Luciferase |
hsa-miR-124-3p | liver cancer | tumorigenesis | "Methylation regulated miR 124 1 suppresses tumorig ......" | 27029030 | Luciferase; Colony formation; Western blot |
hsa-miR-124-3p | lung cancer | progression | "MicroRNA-124 miR-124 has been proven dysregulated ......" | 25973090 | |
hsa-miR-124-3p | lung cancer | cell migration | "The purpose of our study was to investigate the fu ......" | 27251409 | Luciferase |
hsa-miR-124-3p | lung cancer | poor survival | "Dysregulation of microRNAs miRNAs is involved in t ......" | 27735038 | |
hsa-miR-124-3p | lung squamous cell cancer | poor survival | "Using a linear combination of the miR CT values wi ......" | 24007627 | |
hsa-miR-124-3p | lung squamous cell cancer | metastasis | "NF κB mediated miR 124 suppresses metastasis of n ......" | 25749519 | |
hsa-miR-124-3p | lung squamous cell cancer | worse prognosis | "In the present study we investigated whether singl ......" | 26632718 | |
hsa-miR-124-3p | lung squamous cell cancer | metastasis; cell migration | "The feedback loop between miR 124 and TGF β pathw ......" | 26818357 | |
hsa-miR-124-3p | lung squamous cell cancer | tumorigenesis; worse prognosis | "Down-regulated expression of miR-124 gene has been ......" | 27376157 | Colony formation |
hsa-miR-124-3p | lung squamous cell cancer | metastasis; worse prognosis; tumorigenesis | "Combined Effect of Metastasis Related MicroRNA miR ......" | 27444357 | |
hsa-miR-124-3p | melanoma | malignant trasformation | "Upregulation of miR 124 by physcion 8 O β glucopy ......" | 27657824 | |
hsa-miR-124-3p | ovarian cancer | cell migration; metastasis; motility | "MiR 124 inhibits the migration and invasion of ova ......" | 24279510 | Transwell assay; Wound Healing Assay; Luciferase |
hsa-miR-124-3p | pancreatic cancer | metastasis; progression; poor survival | "Methylation mediated silencing of the miR 124 gene ......" | 23334332 | |
hsa-miR-124-3p | prostate cancer | malignant trasformation | "Tumor suppressive miR 124 targets androgen recepto ......" | 23069658 | |
hsa-miR-124-3p | prostate cancer | progression | "The miR 124 prolyl hydroxylase P4HA1 MMP1 axis pla ......" | 25115393 | |
hsa-miR-124-3p | prostate cancer | motility | "MiR 124 suppresses cell motility and adhesion by t ......" | 25969668 | Luciferase |
hsa-miR-124-3p | prostate cancer | drug resistance; progression | "miR 124 and Androgen Receptor Signaling Inhibitors ......" | 26573802 | |
hsa-miR-124-3p | sarcoma | metastasis | "The tumor suppressor role of miR 124 in osteosarco ......" | 24971902 | Luciferase |
hsa-miR-124-3p | sarcoma | malignant trasformation; cell migration; metastasis | "However the detailed mechanism of miR-124 in the r ......" | 26259653 | Luciferase |
hsa-miR-124-3p | sarcoma | worse prognosis | "Single nucleotide polymorphism of hsa miR 124a aff ......" | 27540978 | |
hsa-miR-124-3p | sarcoma | staging; metastasis; differentiation; poor survival | "The tumor suppressor miR 124 inhibits cell prolife ......" | 27644254 |
Reported gene related to hsa-miR-124-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-124-3p | colorectal cancer | STAT3 | "MiR 124 suppresses growth of human colorectal canc ......" | 23940556 |
hsa-miR-124-3p | endometrial cancer | STAT3 | "miR 124 functions as a tumor suppressor in the end ......" | 24287565 |
hsa-miR-124-3p | esophageal cancer | STAT3 | "STAT3 is involved in miR 124 mediated suppressive ......" | 25928665 |
hsa-miR-124-3p | gastric cancer | STAT3 | "In summary the in vitro data suggest that paeonifl ......" | 26109806 |
hsa-miR-124-3p | liver cancer | STAT3 | "In this study we found that miR-124 suppresses the ......" | 24211205 |
hsa-miR-124-3p | bladder cancer | ROCK1 | "In addition ROCK1 was identified as a new target o ......" | 24180482 |
hsa-miR-124-3p | colorectal cancer | ROCK1 | "To investigate the roles and interactions of rho-a ......" | 25987767 |
hsa-miR-124-3p | colorectal cancer | ROCK1 | "MiR-124 inhibits neoplastic transformation cell pr ......" | 27159971 |
hsa-miR-124-3p | gastric cancer | ROCK1 | "miR 124 inhibits growth and invasion of gastric ca ......" | 25169484 |
hsa-miR-124-3p | breast cancer | SNAI2 | "The protein expression level and luciferase activi ......" | 27748910 |
hsa-miR-124-3p | breast cancer | SNAI2 | "MiR 124 targets Slug to regulate epithelial mesenc ......" | 23250910 |
hsa-miR-124-3p | lung cancer | SNAI2 | "We examined the levels of Slug and miR-124 in NSCL ......" | 27735038 |
hsa-miR-124-3p | prostate cancer | SNAI2 | "Slug was proven to be a target of miR-124 and medi ......" | 24969691 |
hsa-miR-124-3p | prostate cancer | AR | "Regulation and methylation of tumor suppressor miR ......" | 25860954 |
hsa-miR-124-3p | prostate cancer | AR | "miR-124 targets the androgen receptor AR transcrip ......" | 26573802 |
hsa-miR-124-3p | prostate cancer | AR | "Tumor suppressive miR 124 targets androgen recepto ......" | 23069658 |
hsa-miR-124-3p | bladder cancer | CDK4 | "MiR 124 retards bladder cancer growth by directly ......" | 25348738 |
hsa-miR-124-3p | breast cancer | CDK4 | "MiR 124 inhibits cell proliferation in breast canc ......" | 25731732 |
hsa-miR-124-3p | esophageal cancer | CDK4 | "miR 124 radiosensitizes human esophageal cancer ce ......" | 27323123 |
hsa-miR-124-3p | gastric cancer | EZH2 | "Our study indicate that miR-124 can suppress gastr ......" | 24658854 |
hsa-miR-124-3p | liver cancer | EZH2 | "Further studies showed that miR-124 could directly ......" | 21672940 |
hsa-miR-124-3p | prostate cancer | EZH2 | "MiR-124 in turn is negatively regulated by transcr ......" | 25115393 |
hsa-miR-124-3p | gastric cancer | SPHK1 | "SPHK1 3'UTR-luciferase vector was constructed and ......" | 24257299 |
hsa-miR-124-3p | gastric cancer | SPHK1 | "miR 124 inhibits cell proliferation in gastric can ......" | 22450659 |
hsa-miR-124-3p | ovarian cancer | SPHK1 | "MiR 124 inhibits the migration and invasion of ova ......" | 24279510 |
hsa-miR-124-3p | B cell lymphoma | TP53 | "We also characterized miR-124 promoter region and ......" | 25915824 |
hsa-miR-124-3p | colorectal cancer | TP53 | "We identified and confirmed inhibitor of apoptosis ......" | 23691514 |
hsa-miR-124-3p | gastric cancer | TP53 | "MicroRNA-124 miR-124 a pivotal member of the p53 n ......" | 24658854 |
hsa-miR-124-3p | cervical and endocervical cancer | CTSG | "Compared with those carrying CC genotype individua ......" | 24589598 |
hsa-miR-124-3p | sarcoma | CTSG | "There were significant differences in the frequenc ......" | 27540978 |
hsa-miR-124-3p | breast cancer | FLOT1 | "In this study we investigated the role of miR-124 ......" | 24330780 |
hsa-miR-124-3p | kidney renal cell cancer | FLOT1 | "We compared transcriptome profiling before and aft ......" | 26002553 |
hsa-miR-124-3p | breast cancer | IQGAP1 | "Genetic variants at the miR 124 binding site on th ......" | 21318219 |
hsa-miR-124-3p | endometrial cancer | IQGAP1 | "Reactivation of epigenetically silenced miR 124 re ......" | 26934121 |
hsa-miR-124-3p | breast cancer | MALAT1 | "miR 124 downregulation leads to breast cancer prog ......" | 26918449 |
hsa-miR-124-3p | cervical and endocervical cancer | MALAT1 | "MALAT1 miR 124 RBG2 axis is involved in growth and ......" | 26242259 |
hsa-miR-124-3p | B cell lymphoma | MYC | "Here we identify microRNA-124 miR-124 as a negativ ......" | 25915824 |
hsa-miR-124-3p | ovarian cancer | MYC | "Additionally in vivo studies utilizing a xenograft ......" | 25639871 |
hsa-miR-124-3p | colorectal cancer | PPP1R13L | "We identified and confirmed inhibitor of apoptosis ......" | 23691514 |
hsa-miR-124-3p | glioblastoma | PPP1R13L | "Downregulation of miR 124 promotes the growth and ......" | 23624869 |
hsa-miR-124-3p | colorectal cancer | PRRX1 | "miR 124 regulates radiosensitivity of colorectal c ......" | 27578582 |
hsa-miR-124-3p | colorectal cancer | PRRX1 | "MiR 124 Radiosensitizes human colorectal cancer ce ......" | 24705396 |
hsa-miR-124-3p | pancreatic cancer | RAC1 | "Methylation mediated silencing of the miR 124 gene ......" | 23334332 |
hsa-miR-124-3p | sarcoma | RAC1 | "We identified and confirmed Rac1 as a novel direct ......" | 24971902 |
hsa-miR-124-3p | colorectal cancer | RNH1 | "Pri miR 124 rs531564 polymorphism and colorectal c ......" | 26423518 |
hsa-miR-124-3p | esophageal cancer | RNH1 | "Pri miR 124 rs531564 and pri miR 34b/c rs4938723 p ......" | 24945256 |
hsa-miR-124-3p | kidney renal cell cancer | ABCB1 | "Our study aimed to investigate the roles of miR-12 ......" | 25861751 |
hsa-miR-124-3p | lung cancer | ADC | "However the role of miR-124 in lung adenocarcinoma ......" | 26935152 |
hsa-miR-124-3p | gastric cancer | AKT1 | "The expression of phosphatidylinositol 3-kinase PI ......" | 26109806 |
hsa-miR-124-3p | cervical and endocervical cancer | AMOTL1 | "MiR 124 represses vasculogenic mimicry and cell mo ......" | 25218344 |
hsa-miR-124-3p | B cell lymphoma | BCL2 | "Here we identify microRNA-124 miR-124 as a negativ ......" | 25915824 |
hsa-miR-124-3p | breast cancer | BECN1 | "Decreased miR 124 3p Expression Prompted Breast Ca ......" | 27468577 |
hsa-miR-124-3p | glioblastoma | C6 | "Here we demonstrate that gap junctions mediate an ......" | 25753094 |
hsa-miR-124-3p | liver cancer | CASC3 | "Methylation regulated miR 124 1 suppresses tumorig ......" | 27029030 |
hsa-miR-124-3p | kidney renal cell cancer | CAV1 | "We compared transcriptome profiling before and aft ......" | 26002553 |
hsa-miR-124-3p | breast cancer | CD151 | "A luciferase reporter assay was used to determine ......" | 23816858 |
hsa-miR-124-3p | lung squamous cell cancer | CD164 | "Two endogenous miR-124 targeting sites in the 3'UT ......" | 27376157 |
hsa-miR-124-3p | sarcoma | CD276 | "On the basis of bioinformatics and the preliminary ......" | 27644254 |
hsa-miR-124-3p | lung cancer | CDH1 | "In in-vitro study overexpression of miR-124 in A54 ......" | 27251409 |
hsa-miR-124-3p | lung squamous cell cancer | CDH2 | "However the association between miR-124 and CDH2 h ......" | 27073840 |
hsa-miR-124-3p | gastric cancer | CDK6 | "To investigate the DNA methylation status of the p ......" | 21365509 |
hsa-miR-124-3p | prostate cancer | CTBP1 | "MiR-124 in turn is negatively regulated by transcr ......" | 25115393 |
hsa-miR-124-3p | colon cancer | DDX6 | "Here we showed that DDX6 was overexpressed in colo ......" | 26144048 |
hsa-miR-124-3p | colorectal cancer | DNMT1 | "miR 124 and miR 506 inhibit colorectal cancer prog ......" | 26497367 |
hsa-miR-124-3p | lung squamous cell cancer | DNMT3A | "Moreover activation of TGF-β pathway may enhance ......" | 26818357 |
hsa-miR-124-3p | colorectal cancer | DNMT3B | "miR 124 and miR 506 inhibit colorectal cancer prog ......" | 26497367 |
hsa-miR-124-3p | head and neck cancer | EGFR | "Overexpression of miR-124 decreased ESX and EGFR l ......" | 26227488 |
hsa-miR-124-3p | head and neck cancer | ELF3 | "Delivery of miR-124 inhibited the 3'UTR ESX-driven ......" | 26227488 |
hsa-miR-124-3p | breast cancer | ETS1 | "We also showed E26 transformation specific-1 Ets-1 ......" | 25085587 |
hsa-miR-124-3p | breast cancer | FN1 | "Ectopic expression of miR-124 in MDA-MB-231 cells ......" | 22085528 |
hsa-miR-124-3p | prostate cancer | FURIN | "It was significantly found that miR-124 was presen ......" | 24913567 |
hsa-miR-124-3p | kidney renal cell cancer | FZD5 | "miR 124 represses FZD5 to attenuate P glycoprotein ......" | 25861751 |
hsa-miR-124-3p | glioblastoma | GJA1 | "In conclusion our results indicate that the "bysta ......" | 25753094 |
hsa-miR-124-3p | cervical and endocervical cancer | GRB2 | "In addition we also verified a direct interaction ......" | 26242259 |
hsa-miR-124-3p | cervical and endocervical cancer | IGFBP7 | "In HPV-immortalised keratinocytes increased methyl ......" | 20579385 |
hsa-miR-124-3p | colorectal cancer | INSR | "In this study we found that miR-124 was significan ......" | 24705396 |
hsa-miR-124-3p | glioblastoma | LOC100128922 | "In conclusion our results indicate that the "bysta ......" | 25753094 |
hsa-miR-124-3p | prostate cancer | MMP1 | "The miR 124 prolyl hydroxylase P4HA1 MMP1 axis pla ......" | 25115393 |
hsa-miR-124-3p | cervical and endocervical cancer | MTDH | "In conclusion these findings suggested that miR-12 ......" | 27571703 |
hsa-miR-124-3p | lung squamous cell cancer | MYO10 | "NF κB mediated miR 124 suppresses metastasis of n ......" | 25749519 |
hsa-miR-124-3p | endometrial cancer | NDC80 | "miR 124 functions as a tumor suppressor in the end ......" | 24287565 |
hsa-miR-124-3p | lung squamous cell cancer | NFASC | "NF κB mediated miR 124 suppresses metastasis of n ......" | 25749519 |
hsa-miR-124-3p | gastric cancer | NOTCH1 | "miR 124 interacts with the Notch1 signalling pathw ......" | 26612211 |
hsa-miR-124-3p | prostate cancer | OSR1 | "It was significantly found that miR-124 was presen ......" | 24913567 |
hsa-miR-124-3p | prostate cancer | P4HA1 | "The miR 124 prolyl hydroxylase P4HA1 MMP1 axis pla ......" | 25115393 |
hsa-miR-124-3p | prostate cancer | PCSK6 | "miR 124 exhibits antiproliferative and antiaggress ......" | 24913567 |
hsa-miR-124-3p | B cell lymphoma | PDE4B | "Here we show that miR-124 influences GC-induced ap ......" | 25576220 |
hsa-miR-124-3p | liver cancer | PIK3CA | "MiR 124 suppresses cell proliferation in hepatocel ......" | 22940133 |
hsa-miR-124-3p | gastric cancer | PIK3CD | "The expression of phosphatidylinositol 3-kinase PI ......" | 26109806 |
hsa-miR-124-3p | prostate cancer | PKM | "MiR 124 suppresses the proliferation of human pros ......" | 25029852 |
hsa-miR-124-3p | melanoma | RALBP1 | "Upregulation of miR 124 by physcion 8 O β glucopy ......" | 27657824 |
hsa-miR-124-3p | liver cancer | ROCK2 | "Further studies showed that miR-124 could directly ......" | 21672940 |
hsa-miR-124-3p | sarcoma | ROR2 | "Furthermore we found that ROR2 was significantly u ......" | 26259653 |
hsa-miR-124-3p | melanoma | RP1 | "Upregulation of miR 124 by physcion 8 O β glucopy ......" | 27657824 |
hsa-miR-124-3p | lung squamous cell cancer | SCLC1 | "These findings suggest that miR-16 and miR-124 mig ......" | 26273338 |
hsa-miR-124-3p | glioblastoma | SERP1 | "miR-124 exerts this phenotype in part by directly ......" | 24954504 |
hsa-miR-124-3p | lung squamous cell cancer | SMAD4 | "Mechanistic analyses show that Smad4 a cobinding p ......" | 26818357 |
hsa-miR-124-3p | gastric cancer | SMOX | "Epigenetic silencing of miR 124 prevents spermine ......" | 27041578 |
hsa-miR-124-3p | breast cancer | SNAI1 | "Furthermore we used several algorithms to identify ......" | 27748910 |
hsa-miR-124-3p | glioblastoma | SOS1 | "MiR 124 inhibits the growth of glioblastoma throug ......" | 23817964 |
hsa-miR-124-3p | lung cancer | SOX9 | "MiR 124 inhibits cell proliferation migration and ......" | 26935152 |
hsa-miR-124-3p | glioblastoma | TEAD1 | "miR-124 exerts this phenotype in part by directly ......" | 24954504 |
hsa-miR-124-3p | kidney renal cell cancer | TECRL | "miR 124 represses FZD5 to attenuate P glycoprotein ......" | 25861751 |
hsa-miR-124-3p | prostate cancer | TLN1 | "MiR 124 suppresses cell motility and adhesion by t ......" | 25969668 |
hsa-miR-124-3p | sarcoma | TRBV24OR9-2 | "We further conducted bioinformatic analysis and a ......" | 26259653 |
hsa-miR-124-3p | head and neck cancer | TXK | "Restoration of miR-124 in SCC15 cells enhanced the ......" | 26227488 |
hsa-miR-124-3p | bladder cancer | UHRF1 | "MiR 124 exerts tumor suppressive functions on the ......" | 26310391 |
hsa-miR-124-3p | lung cancer | VIM | "In in-vitro study overexpression of miR-124 in A54 ......" | 27251409 |
hsa-miR-124-3p | lung cancer | ZEB1 | "Luciferase reporter assay and RT-PCR were performe ......" | 27251409 |