microRNA information: hsa-miR-1244
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-1244 | miRbase |
Accession: | MIMAT0005896 | miRbase |
Precursor name: | hsa-mir-1244-1 | miRbase |
Precursor accession: | MI0006379 | miRbase |
Symbol: | NA | HGNC |
RefSeq ID: | NA | GenBank |
Sequence: | AAGUAGUUGGUUUGUAUGAGAUGGUU |
Reported expression in cancers: hsa-miR-1244
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-1244 | lung squamous cell cancer | downregulation | "MiR 1244 sensitizes the resistance of non small ce ......" | 27073334 | qPCR |
Reported cancer pathway affected by hsa-miR-1244
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-1244 | lung squamous cell cancer | Apoptosis pathway | "MiR 1244 sensitizes the resistance of non small ce ......" | 27073334 | Flow cytometry; Wound Healing Assay |
Reported cancer prognosis affected by hsa-miR-1244
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-1244 | lung cancer | poor survival; malignant trasformation; progression | "miR-1244 was underexpressed in lung carcinoma by 4 ......" | 26355845 | |
hsa-miR-1244 | lung squamous cell cancer | drug resistance; progression | "MiR 1244 sensitizes the resistance of non small ce ......" | 27073334 | Flow cytometry; Wound Healing Assay |
Reported gene related to hsa-miR-1244
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-1244 | lung cancer | MEF2D | "miR-1244 was then verified to negatively regulate ......" | 26355845 |