microRNA information: hsa-miR-1247-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1247-5p | miRbase |
| Accession: | MIMAT0005899 | miRbase |
| Precursor name: | hsa-mir-1247 | miRbase |
| Precursor accession: | MI0006382 | miRbase |
| Symbol: | MIR1247 | HGNC |
| RefSeq ID: | NR_031649 | GenBank |
| Sequence: | ACCCGUCCCGUUCGUCCCCGGA |
Reported expression in cancers: hsa-miR-1247-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-1247-5p | pancreatic cancer | downregulation | "miR 1247 is correlated with prognosis of pancreati ......" | 24588767 | Microarray; in situ hybridization |
| hsa-miR-1247-5p | prostate cancer | upregulation | "Here we report an expression analysis of miR-1247- ......" | 25731699 |
Reported cancer pathway affected by hsa-miR-1247-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1247-5p | pancreatic cancer | cell cycle pathway | "miR 1247 is correlated with prognosis of pancreati ......" | 24588767 | Colony formation; Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-1247-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1247-5p | pancreatic cancer | worse prognosis; poor survival; recurrence; differentiation | "miR 1247 is correlated with prognosis of pancreati ......" | 24588767 | Colony formation; Western blot; Luciferase |
| hsa-miR-1247-5p | pancreatic cancer | worse prognosis | "This study performed profiling of microRNAs miRNAs ......" | 25258651 | |
| hsa-miR-1247-5p | prostate cancer | malignant trasformation | "MiR 1247 5p is overexpressed in castration resista ......" | 25731699 | Western blot; Luciferase |
| hsa-miR-1247-5p | sarcoma | progression | "MiRNA profile of osteosarcoma with CD117 and stro ......" | 25973030 |
Reported gene related to hsa-miR-1247-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1247-5p | sarcoma | MAP3K9 | "The significant down-regulated miR-1247 was confir ......" | 25973030 |
| hsa-miR-1247-5p | prostate cancer | MYCBP2 | "MiR 1247 5p is overexpressed in castration resista ......" | 25731699 |
| hsa-miR-1247-5p | pancreatic cancer | NRP1 | "Moreover we confirmed that neuropilin1 NRP1 and ne ......" | 24588767 |
| hsa-miR-1247-5p | pancreatic cancer | NRP2 | "Moreover we confirmed that neuropilin1 NRP1 and ne ......" | 24588767 |
Expression profile in cancer corhorts:
