microRNA information: hsa-miR-1251-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1251-5p | miRbase |
| Accession: | MIMAT0005903 | miRbase |
| Precursor name: | hsa-mir-1251 | miRbase |
| Precursor accession: | MI0006386 | miRbase |
| Symbol: | MIR1251 | HGNC |
| RefSeq ID: | NR_031653 | GenBank |
| Sequence: | ACUCUAGCUGCCAAAGGCGCU |
Reported expression in cancers: hsa-miR-1251-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-1251-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1251-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-1251-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1251-5p | head and neck cancer | IGF1 | "The target gene of miR-1251 IGF1 was associated wi ......" | 27035560 |