microRNA information: hsa-miR-1253

SectionIDlink
Mature name: hsa-miR-1253miRbase
Accession: MIMAT0005904miRbase
Precursor name: hsa-mir-1253 miRbase
Precursor accession: MI0006387miRbase
Symbol: MIR1253HGNC
RefSeq ID: NR_031654GenBank
Sequence: AGAGAAGAAGAUCAGCCUGCA



Reported expression in cancers: hsa-miR-1253

miRNAcancerregulationreportingPUBMEDmethod



Reported cancer pathway affected by hsa-miR-1253

miRNAcancerpathwayreportingPUBMEDfunctional study



Reported cancer prognosis affected by hsa-miR-1253

miRNAcancerprognosisreportingPUBMEDfunctional study



Reported gene related to hsa-miR-1253

miRNAcancergenereportingPUBMED