microRNA information: hsa-miR-1254
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1254 | miRbase |
| Accession: | MIMAT0005905 | miRbase |
| Precursor name: | hsa-mir-1254-1 | miRbase |
| Precursor accession: | MI0006388 | miRbase |
| Symbol: | NA | HGNC |
| RefSeq ID: | NA | GenBank |
| Sequence: | AGCCUGGAAGCUGGAGCCUGCAGU |
Reported expression in cancers: hsa-miR-1254
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-1254
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1254
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1254 | lung squamous cell cancer | staging | "miR 1254 and miR 574 5p: serum based microRNA biom ......" | 21258252 |
Reported gene related to hsa-miR-1254
| miRNA | cancer | gene | reporting | PUBMED |
|---|
Expression profile in cancer corhorts:
