microRNA information: hsa-miR-126-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-126-3p | miRbase |
Accession: | MIMAT0000445 | miRbase |
Precursor name: | hsa-mir-126 | miRbase |
Precursor accession: | MI0000471 | miRbase |
Symbol: | MIR126 | HGNC |
RefSeq ID: | NR_029695 | GenBank |
Sequence: | UCGUACCGUGAGUAAUAAUGCG |
Reported expression in cancers: hsa-miR-126-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-126-3p | acute myeloid leukemia | upregulation | "In this manner we identified multiple differential ......" | 24477595 | |
hsa-miR-126-3p | breast cancer | downregulation | "Expression of spliced exon7-8 and excised mature m ......" | 21249429 | Northern blot |
hsa-miR-126-3p | breast cancer | downregulation | "MiR-126 expression was investigated in forty cases ......" | 26261534 | qPCR |
hsa-miR-126-3p | cervical and endocervical cancer | downregulation | "miR-126 is an endothelial-specific microRNA essent ......" | 24037526 | |
hsa-miR-126-3p | cervical and endocervical cancer | downregulation | "In cervical cancer one of the most common malignan ......" | 24377569 | qPCR |
hsa-miR-126-3p | colon cancer | downregulation | "Additionally using reporter constructs we show tha ......" | 18663744 | |
hsa-miR-126-3p | colon cancer | downregulation | "However the underlying mechanisms of miR-126 in co ......" | 27517626 | |
hsa-miR-126-3p | colorectal cancer | downregulation | "Epigenetic silencing of miR 126 contributes to tum ......" | 23900443 | qPCR |
hsa-miR-126-3p | colorectal cancer | downregulation | "MiR-126 has been shown to be down-regulated in CRC ......" | 24312276 | |
hsa-miR-126-3p | esophageal cancer | downregulation | "Using next-generation sequencing NGS-based miRNA p ......" | 25512445 | RNA-Seq; in situ hybridization |
hsa-miR-126-3p | esophageal cancer | downregulation | "MicroRNA 126 is down regulated in human esophageal ......" | 26191164 | |
hsa-miR-126-3p | gastric cancer | downregulation | "miR 126 functions as a tumour suppressor in human ......" | 20619534 | |
hsa-miR-126-3p | gastric cancer | downregulation | "MiR-126 expression was investigated in GC tissue s ......" | 25027343 | qPCR |
hsa-miR-126-3p | kidney renal cell cancer | downregulation | "Low expression of miR 126 is a prognostic marker f ......" | 25572155 | |
hsa-miR-126-3p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-126-3p | liver cancer | downregulation | "Decreased expression of miR 126 correlates with me ......" | 23378255 | Microarray; qPCR |
hsa-miR-126-3p | liver cancer | downregulation | "MiR-126-3p has been reported to be associated with ......" | 25240815 | |
hsa-miR-126-3p | lung cancer | downregulation | "In the consistently reported down-regulated microR ......" | 22672859 | |
hsa-miR-126-3p | lung cancer | downregulation | "let 7b and miR 126 are down regulated in tumor tis ......" | 23029111 | qPCR |
hsa-miR-126-3p | lung cancer | downregulation | "miR 126 3p and miR 451a correlate with clinicopath ......" | 27277197 | Microarray; Reverse transcription PCR |
hsa-miR-126-3p | lung squamous cell cancer | downregulation | "Down regulation of microRNA 126 and microRNA 133b ......" | 26823832 | qPCR |
hsa-miR-126-3p | lymphoma | downregulation | "Clinical and epidemiological data suggest that chr ......" | 22307176 | Reverse transcription PCR; in situ hybridization |
hsa-miR-126-3p | pancreatic cancer | downregulation | "Loss of miR 126 is crucial to pancreatic cancer pr ......" | 22845403 | |
hsa-miR-126-3p | prostate cancer | downregulation | "Association of microRNA 126 expression with clinic ......" | 24350576 | Reverse transcription PCR; qPCR |
hsa-miR-126-3p | sarcoma | upregulation | "The discovery of microRNAs miRNAs provides a new a ......" | 24384842 | |
hsa-miR-126-3p | sarcoma | upregulation | "We performed a miRNA microarray analysis by detect ......" | 25266797 | Microarray; Reverse transcription PCR; qPCR |
hsa-miR-126-3p | thyroid cancer | downregulation | "microRNA-126 miR-126 has been reported to play tum ......" | 26239517 | |
hsa-miR-126-3p | thyroid cancer | downregulation | "The objectives of this study are to investigate th ......" | 26384552 | |
hsa-miR-126-3p | thyroid cancer | downregulation | "MicroRNA-126 miR-126 has previously been reported ......" | 27175968 | qPCR |
Reported cancer pathway affected by hsa-miR-126-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-126-3p | acute myeloid leukemia | Apoptosis pathway | "Attenuation of microRNA 126 expression that drives ......" | 24477595 | |
hsa-miR-126-3p | bladder cancer | PI3K/Akt signaling pathway; cell cycle pathway; Apoptosis pathway | "MiR 126 regulates proliferation and invasion in th ......" | 27578985 | Luciferase; Western blot; Flow cytometry; Colony formation; Transwell assay |
hsa-miR-126-3p | breast cancer | PI3K/Akt signaling pathway | "Endothelial specific intron derived miR 126 is dow ......" | 21249429 | Western blot; Luciferase |
hsa-miR-126-3p | colon cancer | PI3K/Akt signaling pathway | "The noncoding RNA miR 126 suppresses the growth of ......" | 18663744 | |
hsa-miR-126-3p | colon cancer | cell cycle pathway | "MiR 126 suppresses colon cancer cell proliferation ......" | 23615712 | |
hsa-miR-126-3p | colon cancer | Apoptosis pathway | "miR 126 inhibits colon cancer proliferation and in ......" | 23981989 | |
hsa-miR-126-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 126 functions as a tumor suppressor in co ......" | 24189753 | Transwell assay; Western blot; Luciferase |
hsa-miR-126-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "Down regulation of miR 126 is associated with colo ......" | 24312276 | Luciferase |
hsa-miR-126-3p | colorectal cancer | Apoptosis pathway | "Deregulation of miR 126 expression in colorectal c ......" | 26455548 | |
hsa-miR-126-3p | esophageal cancer | PI3K/Akt signaling pathway | "Using next-generation sequencing NGS-based miRNA p ......" | 25512445 | RNAi |
hsa-miR-126-3p | esophageal cancer | PI3K/Akt signaling pathway | "MicroRNA 126 is down regulated in human esophageal ......" | 26191164 | Luciferase |
hsa-miR-126-3p | gastric cancer | cell cycle pathway | "miR 126 functions as a tumour suppressor in human ......" | 20619534 | |
hsa-miR-126-3p | gastric cancer | cell cycle pathway | "MicroRNA 126 inhibits cell proliferation in gastri ......" | 26054677 | |
hsa-miR-126-3p | kidney renal cell cancer | Apoptosis pathway | "Low expression of miR 126 is a prognostic marker f ......" | 25572155 | |
hsa-miR-126-3p | liver cancer | Apoptosis pathway; cell cycle pathway | "miR 126 inhibits cell proliferation and induces ce ......" | 25585946 | Luciferase |
hsa-miR-126-3p | lung cancer | cell cycle pathway | "MiR 126 restoration down regulate VEGF and inhibit ......" | 19223090 | Luciferase; Flow cytometry |
hsa-miR-126-3p | lung cancer | Apoptosis pathway | "miR 126 3p and miR 451a correlate with clinicopath ......" | 27277197 | |
hsa-miR-126-3p | lung squamous cell cancer | Apoptosis pathway | "Expression profile of miRNA in these two groups wa ......" | 20728239 | |
hsa-miR-126-3p | lung squamous cell cancer | cell cycle pathway | "miR 126 inhibits proliferation of small cell lung ......" | 21439283 | |
hsa-miR-126-3p | lung squamous cell cancer | PI3K/Akt signaling pathway | "miR 126 enhances the sensitivity of non small cell ......" | 22510476 | |
hsa-miR-126-3p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "Matrine induces cell cycle arrest and apoptosis wi ......" | 27665734 | Western blot |
hsa-miR-126-3p | prostate cancer | Apoptosis pathway | "The effects of AX2 on mTOR PTEN PI3K and Akt at th ......" | 26645890 | Western blot; Luciferase; Flow cytometry |
hsa-miR-126-3p | sarcoma | Apoptosis pathway | "miR 126 functions as a tumor suppressor in osteosa ......" | 24384842 | Luciferase |
hsa-miR-126-3p | sarcoma | Apoptosis pathway; cell cycle pathway | "Overexpression of miR 126 sensitizes osteosarcoma ......" | 25510179 | Flow cytometry; MTT assay |
hsa-miR-126-3p | sarcoma | cell cycle pathway | "MicroRNA 126 Overexpression Inhibits Proliferation ......" | 26319109 | Transwell assay; Wound Healing Assay |
hsa-miR-126-3p | thyroid cancer | cell cycle pathway; Apoptosis pathway | "miR 126 inhibits papillary thyroid carcinoma growt ......" | 26239517 | Colony formation |
hsa-miR-126-3p | thyroid cancer | cell cycle pathway; Apoptosis pathway | "Interactive role of miR 126 on VEGF A and progress ......" | 27067785 | Western blot |
Reported cancer prognosis affected by hsa-miR-126-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-126-3p | T cell leukemia | progression; worse prognosis; staging | "Impact of miR 155 and miR 126 as novel biomarkers ......" | 22884882 | |
hsa-miR-126-3p | acute myeloid leukemia | differentiation | "We studied miRNA expression of leukemic blasts of ......" | 20425795 | |
hsa-miR-126-3p | acute myeloid leukemia | poor survival | "Attenuation of microRNA 126 expression that drives ......" | 24477595 | |
hsa-miR-126-3p | bladder cancer | progression | "MicroRNA 126 inhibits invasion in bladder cancer v ......" | 24823697 | |
hsa-miR-126-3p | bladder cancer | cell migration | "MiR 126 regulates proliferation and invasion in th ......" | 27578985 | Luciferase; Western blot; Flow cytometry; Colony formation; Transwell assay |
hsa-miR-126-3p | breast cancer | metastasis; poor survival | "Of these microRNAs miR-126 restoration reduces ove ......" | 18185580 | |
hsa-miR-126-3p | breast cancer | metastasis | "The third identifies miR-335 miR-206 and miR-126 a ......" | 18373886 | |
hsa-miR-126-3p | breast cancer | metastasis | "Genetic variants within miR 126 and miR 335 are no ......" | 21046227 | |
hsa-miR-126-3p | breast cancer | drug resistance | "MiRNA microarray analysis identified 299 and 226 m ......" | 21399894 | |
hsa-miR-126-3p | breast cancer | drug resistance | "The inhibition of cell proliferation was measured ......" | 21563499 | MTT assay |
hsa-miR-126-3p | breast cancer | drug resistance | "Expression levels of miR-210 miR-21 miR-29a and mi ......" | 22370716 | |
hsa-miR-126-3p | breast cancer | metastasis | "Real Time RT-PCR was performed to identify the miR ......" | 22524830 | |
hsa-miR-126-3p | breast cancer | metastasis | "miR 126 and miR 126* repress recruitment of mesenc ......" | 23396050 | |
hsa-miR-126-3p | breast cancer | poor survival | "Increased expression of miR 126 and miR 10a predic ......" | 23968733 | |
hsa-miR-126-3p | breast cancer | malignant trasformation | "In support of these findings in vitro functional s ......" | 24104550 | |
hsa-miR-126-3p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
hsa-miR-126-3p | cervical and endocervical cancer | tumorigenesis; progression; staging | "Repression of miR 126 and upregulation of adrenome ......" | 24037526 | |
hsa-miR-126-3p | cervical and endocervical cancer | malignant trasformation | "miR 126 Suppresses the proliferation of cervical c ......" | 24377569 | MTT assay |
hsa-miR-126-3p | cervical and endocervical cancer | worse prognosis; poor survival; staging; metastasis | "Decreased expression of microRNA 126 is associated ......" | 25551621 | |
hsa-miR-126-3p | colon cancer | poor survival; staging | "We studied the impact of the expression of miR-17- ......" | 18521848 | |
hsa-miR-126-3p | colon cancer | tumorigenesis | "The noncoding RNA miR 126 suppresses the growth of ......" | 18663744 | |
hsa-miR-126-3p | colon cancer | metastasis; progression | "MiR 126 suppresses colon cancer cell proliferation ......" | 23615712 | |
hsa-miR-126-3p | colon cancer | cell migration | "Expression of miR 126 suppresses migration and inv ......" | 23744532 | MTT assay; Western blot; Luciferase |
hsa-miR-126-3p | colon cancer | metastasis; worse prognosis | "miR 126 inhibits colon cancer proliferation and in ......" | 23981989 | |
hsa-miR-126-3p | colon cancer | staging | "The prognostic value of microRNA 126 and microvess ......" | 25199818 | |
hsa-miR-126-3p | colon cancer | metastasis; poor survival | "Recently increasing studies have demonstrated that ......" | 26893826 | |
hsa-miR-126-3p | colon cancer | metastasis; staging; worse prognosis | "MicroRNA 126 inhibits colon cancer cell proliferat ......" | 27517626 | |
hsa-miR-126-3p | colorectal cancer | malignant trasformation; tumorigenesis | "Down regulation of miR 126 expression in colorecta ......" | 20680522 | |
hsa-miR-126-3p | colorectal cancer | progression | "Epigenetic silencing of miR 126 contributes to tum ......" | 23900443 | Luciferase |
hsa-miR-126-3p | colorectal cancer | progression | "MicroRNA 126 functions as a tumor suppressor in co ......" | 24189753 | Transwell assay; Western blot; Luciferase |
hsa-miR-126-3p | colorectal cancer | worse prognosis; poor survival; staging; metastasis | "Low expression of microRNA 126 is associated with ......" | 24532280 | Western blot |
hsa-miR-126-3p | colorectal cancer | metastasis; staging | "Differential expression of serum miR 126 miR 141 a ......" | 24653631 | |
hsa-miR-126-3p | colorectal cancer | tumorigenesis | "Underexpression of miR 126 and miR 20b in heredita ......" | 24994098 | |
hsa-miR-126-3p | colorectal cancer | drug resistance | "Changes in circulating microRNA 126 during treatme ......" | 25584492 | |
hsa-miR-126-3p | colorectal cancer | metastasis; staging | "Intra tumoural vessel area estimated by expression ......" | 25592646 | |
hsa-miR-126-3p | colorectal cancer | staging; poor survival; metastasis | "Deregulation of miR 126 expression in colorectal c ......" | 26455548 | |
hsa-miR-126-3p | colorectal cancer | staging; worse prognosis | "Serological under expression of microRNA 21 microR ......" | 27142899 | |
hsa-miR-126-3p | colorectal cancer | progression | "Of these 3 upregulated let-7b miR-1290 and miR-126 ......" | 27698796 | |
hsa-miR-126-3p | endometrial cancer | cell migration; metastasis | "MicroRNA 126 inhibits the migration and invasion o ......" | 26893720 | Transwell assay; Western blot; Luciferase |
hsa-miR-126-3p | esophageal cancer | staging; metastasis; differentiation | "In this study we selected 10 miRNAs and analyzed t ......" | 20309880 | |
hsa-miR-126-3p | esophageal cancer | worse prognosis; progression | "Using next-generation sequencing NGS-based miRNA p ......" | 25512445 | RNAi |
hsa-miR-126-3p | esophageal cancer | progression | "MicroRNA 126 is down regulated in human esophageal ......" | 26191164 | Luciferase |
hsa-miR-126-3p | gastric cancer | poor survival | "Several microarray studies have reported microRNA ......" | 19951901 | |
hsa-miR-126-3p | gastric cancer | staging; metastasis | "miR 126 functions as a tumour suppressor in human ......" | 20619534 | |
hsa-miR-126-3p | gastric cancer | malignant trasformation | "MiR 126 inhibits the invasion of gastric cancer ce ......" | 25027343 | Transwell assay; Western blot |
hsa-miR-126-3p | gastric cancer | staging | "MicroRNA 126 regulates migration and invasion of g ......" | 26464628 | Luciferase |
hsa-miR-126-3p | gastric cancer | drug resistance | "MicroRNA 126 increases chemosensitivity in drug re ......" | 27622325 | |
hsa-miR-126-3p | gastric cancer | worse prognosis | "Regulator of G protein signaling 3 targeted by miR ......" | 27754994 | Western blot; Luciferase |
hsa-miR-126-3p | kidney renal cell cancer | poor survival | "Global miRNA expression profiles were obtained by ......" | 22492545 | |
hsa-miR-126-3p | kidney renal cell cancer | poor survival; worse prognosis | "Combination of expression levels of miR 21 and miR ......" | 24428907 | |
hsa-miR-126-3p | kidney renal cell cancer | poor survival | "Impact of miR 21 miR 126 and miR 221 as prognostic ......" | 25279769 | |
hsa-miR-126-3p | kidney renal cell cancer | staging; poor survival; tumorigenesis | "Low expression of miR 126 is a prognostic marker f ......" | 25572155 | |
hsa-miR-126-3p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-126-3p | kidney renal cell cancer | metastasis | "MicroRNA 126 inhibits tumor cell invasion and meta ......" | 27108693 | Luciferase; Western blot |
hsa-miR-126-3p | liver cancer | recurrence | "18 miRNAs including 6 up-regulated and 12 down-reg ......" | 22552153 | |
hsa-miR-126-3p | liver cancer | recurrence; worse prognosis; metastasis; poor survival | "Decreased expression of miR 126 correlates with me ......" | 23378255 | Colony formation |
hsa-miR-126-3p | liver cancer | metastasis; worse prognosis | "MiR 126 3p suppresses tumor metastasis and angioge ......" | 25240815 | Transwell assay; Luciferase; Western blot |
hsa-miR-126-3p | liver cancer | progression | "miR 126 inhibits cell proliferation and induces ce ......" | 25585946 | Luciferase |
hsa-miR-126-3p | lung cancer | poor survival | "let 7b and miR 126 are down regulated in tumor tis ......" | 23029111 | |
hsa-miR-126-3p | lung cancer | staging | "The study contained 2 phases: first preliminary ma ......" | 25639977 | |
hsa-miR-126-3p | lung cancer | staging; metastasis | "miR 126 3p and miR 451a correlate with clinicopath ......" | 27277197 | |
hsa-miR-126-3p | lung squamous cell cancer | cell migration; drug resistance | "miR 126 inhibits non small cell lung cancer cells ......" | 20034472 | Western blot; Flow cytometry |
hsa-miR-126-3p | lung squamous cell cancer | poor survival; staging | "Independent and tissue specific prognostic impact ......" | 21264844 | |
hsa-miR-126-3p | lung squamous cell cancer | staging | "There was statistical difference in the serum leve ......" | 22009180 | |
hsa-miR-126-3p | lung squamous cell cancer | metastasis | "The miRs were quantified by microarray hybridizati ......" | 22295063 | |
hsa-miR-126-3p | lung squamous cell cancer | poor survival; drug resistance | "miR 126 enhances the sensitivity of non small cell ......" | 22510476 | |
hsa-miR-126-3p | lung squamous cell cancer | poor survival; worse prognosis; staging; malignant trasformation | "MicroRNA 126 inhibits tumor cell growth and its ex ......" | 22900072 | Luciferase |
hsa-miR-126-3p | lung squamous cell cancer | worse prognosis; poor survival; tumor size | "Expression of microRNA miR 126 and miR 200c is ass ......" | 25124149 | |
hsa-miR-126-3p | lung squamous cell cancer | tumor size; staging | "Here we analyzed expression of miR-15a/16 miR-21 m ......" | 25384507 | |
hsa-miR-126-3p | lung squamous cell cancer | poor survival; staging | "Prognostic value of the MicroRNA regulators Dicer ......" | 25525410 | |
hsa-miR-126-3p | lung squamous cell cancer | metastasis; progression; worse prognosis; staging; poor survival | "Down regulation of microRNA 126 and microRNA 133b ......" | 26823832 | |
hsa-miR-126-3p | lung squamous cell cancer | staging | "Diagnostic Value of Serum miR 182 miR 183 miR 210 ......" | 27093275 | |
hsa-miR-126-3p | lymphoma | malignant trasformation | "Expression of miR 155 and miR 126 in situ in cutan ......" | 24033365 | |
hsa-miR-126-3p | pancreatic cancer | progression; metastasis | "Loss of miR 126 is crucial to pancreatic cancer pr ......" | 22845403 | |
hsa-miR-126-3p | prostate cancer | recurrence; malignant trasformation; worse prognosis; staging; metastasis; poor survival; progression | "Association of microRNA 126 expression with clinic ......" | 24350576 | |
hsa-miR-126-3p | prostate cancer | metastasis | "Osteoblast derived WNT induced secreted protein 1 ......" | 25277191 | |
hsa-miR-126-3p | prostate cancer | drug resistance | "Syndecan 1 responsive microRNA 126 and 149 regulat ......" | 25462564 | Cell Proliferation Assay |
hsa-miR-126-3p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
hsa-miR-126-3p | sarcoma | progression | "miR 126 functions as a tumor suppressor in osteosa ......" | 24384842 | Luciferase |
hsa-miR-126-3p | sarcoma | motility | "Naringin suppress chondrosarcoma migration through ......" | 24975661 | |
hsa-miR-126-3p | sarcoma | staging; metastasis | "miR 126 inhibits cell growth invasion and migratio ......" | 25213697 | Luciferase |
hsa-miR-126-3p | sarcoma | drug resistance | "Overexpression of miR 126 sensitizes osteosarcoma ......" | 25510179 | Flow cytometry; MTT assay |
hsa-miR-126-3p | sarcoma | staging; metastasis; poor survival; worse prognosis | "Tissue microRNA 126 expression level predicts outc ......" | 26194657 | |
hsa-miR-126-3p | sarcoma | cell migration | "MicroRNA 126 Overexpression Inhibits Proliferation ......" | 26319109 | Transwell assay; Wound Healing Assay |
hsa-miR-126-3p | thyroid cancer | staging; metastasis; tumor size | "miR 126 inhibits papillary thyroid carcinoma growt ......" | 26239517 | Colony formation |
hsa-miR-126-3p | thyroid cancer | metastasis | "miR 126 3p Inhibits Thyroid Cancer Cell Growth and ......" | 26244545 | Colony formation |
hsa-miR-126-3p | thyroid cancer | poor survival | "MicroRNA 126 suppresses proliferation of undiffere ......" | 26384552 | Colony formation; Western blot |
hsa-miR-126-3p | thyroid cancer | progression | "Interactive role of miR 126 on VEGF A and progress ......" | 27067785 | Western blot |
Reported gene related to hsa-miR-126-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-126-3p | breast cancer | VEGFA | "Endothelial specific intron derived miR 126 is dow ......" | 21249429 |
hsa-miR-126-3p | colorectal cancer | VEGFA | "Using both in silico prediction and immunoblotting ......" | 23900443 |
hsa-miR-126-3p | gastric cancer | VEGFA | "Reduced miR 126 expression facilitates angiogenesi ......" | 25428912 |
hsa-miR-126-3p | kidney renal cell cancer | VEGFA | "In addition we found a negative correlation of exp ......" | 22086373 |
hsa-miR-126-3p | lung cancer | VEGFA | "In A549 cell line overexpression of microRNA-126 i ......" | 25902169 |
hsa-miR-126-3p | lung cancer | VEGFA | "MiR 126 restoration down regulate VEGF and inhibit ......" | 19223090 |
hsa-miR-126-3p | lung squamous cell cancer | VEGFA | "miR-126 has been related to tumor angiogenesis and ......" | 21264844 |
hsa-miR-126-3p | thyroid cancer | VEGFA | "Interactive role of miR 126 on VEGF A and progress ......" | 27067785 |
hsa-miR-126-3p | thyroid cancer | VEGFA | "Mechanistically ectopic overexpression of miR-126- ......" | 26244545 |
hsa-miR-126-3p | bladder cancer | ADAM9 | "MicroRNA 126 inhibits invasion in bladder cancer v ......" | 24823697 |
hsa-miR-126-3p | breast cancer | ADAM9 | "MiR 126 regulated breast cancer cell invasion by t ......" | 26261534 |
hsa-miR-126-3p | esophageal cancer | ADAM9 | "ADAM9 was identified as a key target of miR-126; E ......" | 25512445 |
hsa-miR-126-3p | pancreatic cancer | ADAM9 | "ADAM9 is overexpressed in PDAC and also a direct t ......" | 22845403 |
hsa-miR-126-3p | pancreatic cancer | ADAM9 | "MiR 126 acts as a tumor suppressor in pancreatic c ......" | 22064652 |
hsa-miR-126-3p | sarcoma | ADAM9 | "miR 126 inhibits cell growth invasion and migratio ......" | 25213697 |
hsa-miR-126-3p | sarcoma | ADAM9 | "Cells overexpressing microRNA-126 exhibited reduce ......" | 26319109 |
hsa-miR-126-3p | thyroid cancer | ADAM9 | "Of these 14 genes SLC7A5 and ADAM9 were confirmed ......" | 26244545 |
hsa-miR-126-3p | breast cancer | EGFL7 | "Using Northern blot and real-time PCR we confirmed ......" | 21249429 |
hsa-miR-126-3p | colon cancer | EGFL7 | "No correlation was found between miR-126 expressio ......" | 18521848 |
hsa-miR-126-3p | colorectal cancer | EGFL7 | "The aim of the present descriptive study was to an ......" | 25592646 |
hsa-miR-126-3p | colorectal cancer | EGFL7 | "Mechanistically we found that the silencing of miR ......" | 23900443 |
hsa-miR-126-3p | esophageal cancer | EGFL7 | "Downregulation of miR-126 was due to promoter hype ......" | 25512445 |
hsa-miR-126-3p | lung squamous cell cancer | EGFL7 | "Mir-34b was silenced by the DNA methylation of its ......" | 21702040 |
hsa-miR-126-3p | lung squamous cell cancer | EGFL7 | "miR 126 inhibits non small cell lung cancer cells ......" | 20034472 |
hsa-miR-126-3p | gastric cancer | CRK | "MiR 126 inhibits the invasion of gastric cancer ce ......" | 25027343 |
hsa-miR-126-3p | gastric cancer | CRK | "Mechanistically we identified the adaptor protein ......" | 20619534 |
hsa-miR-126-3p | lung squamous cell cancer | CRK | "The overexpression of mir-34b and mir-126 decrease ......" | 21702040 |
hsa-miR-126-3p | lung squamous cell cancer | CRK | "Crk is a predicted putative target gene for miR-12 ......" | 18602365 |
hsa-miR-126-3p | pancreatic cancer | CRK | "miR-126 is also known to target other crucial onco ......" | 22845403 |
hsa-miR-126-3p | bladder cancer | PIK3R2 | "MiR 126 regulates proliferation and invasion in th ......" | 27578985 |
hsa-miR-126-3p | breast cancer | PIK3R2 | "Endothelial specific intron derived miR 126 is dow ......" | 21249429 |
hsa-miR-126-3p | esophageal cancer | PIK3R2 | "Restoration of miR-126 in EC109 cells induced a re ......" | 26191164 |
hsa-miR-126-3p | liver cancer | PIK3R2 | "MiR 126 3p suppresses tumor metastasis and angioge ......" | 25240815 |
hsa-miR-126-3p | thyroid cancer | PIK3R2 | "MicroRNA 126 suppresses proliferation of undiffere ......" | 26384552 |
hsa-miR-126-3p | colon cancer | CXCR4 | "Expression of miR 126 suppresses migration and inv ......" | 23744532 |
hsa-miR-126-3p | colon cancer | CXCR4 | "Moreover we verified that miR-126 negatively regul ......" | 27517626 |
hsa-miR-126-3p | colorectal cancer | CXCR4 | "MicroRNA-126 miR-126 has been reported to be a tum ......" | 24532280 |
hsa-miR-126-3p | colorectal cancer | CXCR4 | "MicroRNA 126 functions as a tumor suppressor in co ......" | 24189753 |
hsa-miR-126-3p | colorectal cancer | EGF | "MicroRNA 126 and epidermal growth factor like doma ......" | 23922111 |
hsa-miR-126-3p | colorectal cancer | EGF | "Intra tumoural vessel area estimated by expression ......" | 25592646 |
hsa-miR-126-3p | esophageal cancer | EGF | "Ectopic expression of miR-126 or silencing of ADAM ......" | 25512445 |
hsa-miR-126-3p | colon cancer | IRS1 | "It has been shown that IRS1 SLC75A and TOM1 were t ......" | 23981989 |
hsa-miR-126-3p | colorectal cancer | IRS1 | "Down regulation of miR 126 is associated with colo ......" | 24312276 |
hsa-miR-126-3p | endometrial cancer | IRS1 | "Molecular mechanism investigation established that ......" | 26893720 |
hsa-miR-126-3p | colon cancer | MVD | "We analysed the prognostic value of two angiogenes ......" | 25199818 |
hsa-miR-126-3p | gastric cancer | MVD | "Down-regulation of miR-126 was found to inversely ......" | 25428912 |
hsa-miR-126-3p | lung cancer | MVD | "We demonstrated significantly higher MVD and decre ......" | 23029111 |
hsa-miR-126-3p | liver cancer | SOX2 | "miR 126 inhibits cell proliferation and induces ce ......" | 25585946 |
hsa-miR-126-3p | prostate cancer | SOX2 | "The expression levels of SOX2 NANOG Oct4 miR-126 a ......" | 25462564 |
hsa-miR-126-3p | sarcoma | SOX2 | "miR 126 functions as a tumor suppressor in osteosa ......" | 24384842 |
hsa-miR-126-3p | colorectal cancer | INSR | "In this study we identified the potential effects ......" | 24312276 |
hsa-miR-126-3p | endometrial cancer | INSR | "MicroRNA 126 inhibits the migration and invasion o ......" | 26893720 |
hsa-miR-126-3p | liver cancer | LRP6 | "MiR 126 3p suppresses tumor metastasis and angioge ......" | 25240815 |
hsa-miR-126-3p | thyroid cancer | LRP6 | "miR 126 inhibits papillary thyroid carcinoma growt ......" | 26239517 |
hsa-miR-126-3p | lung squamous cell cancer | SLC7A5 | "miR 126 inhibits proliferation of small cell lung ......" | 21439283 |
hsa-miR-126-3p | thyroid cancer | SLC7A5 | "Of these 14 genes SLC7A5 and ADAM9 were confirmed ......" | 26244545 |
hsa-miR-126-3p | prostate cancer | VCAM1 | "Osteoblast derived WNT induced secreted protein 1 ......" | 25277191 |
hsa-miR-126-3p | sarcoma | VCAM1 | "We also observed that naringin enhancing miR-126 e ......" | 24975661 |
hsa-miR-126-3p | cervical and endocervical cancer | ADM | "Repression of miR 126 and upregulation of adrenome ......" | 24037526 |
hsa-miR-126-3p | liver cancer | AFP | "Interestingly triple combination of markers miR-12 ......" | 26756996 |
hsa-miR-126-3p | gastric cancer | AKR1B1 | "Ectopic expression of miR-126 increased sensitivit ......" | 27622325 |
hsa-miR-126-3p | acute myeloid leukemia | ARHGEF1 | "Therefore we hypothesized that miR-126 contributes ......" | 26055302 |
hsa-miR-126-3p | cervical and endocervical cancer | BLM | "The viability of Siha cervical cancer cells was fu ......" | 24377569 |
hsa-miR-126-3p | gastric cancer | CADM1 | "MicroRNA 126 regulates migration and invasion of g ......" | 26464628 |
hsa-miR-126-3p | thyroid cancer | CD79A | "miR-126 expression of undifferentiated thyroid car ......" | 26384552 |
hsa-miR-126-3p | colon cancer | CDC37 | "MicroRNA 126 inhibits colon cancer cell proliferat ......" | 27517626 |
hsa-miR-126-3p | pancreatic cancer | CDH1 | "Reexpression of miR-126 and siRNA-based knockdown ......" | 22064652 |
hsa-miR-126-3p | gastric cancer | CRKL | "CRKL promotes cell proliferation in gastric cancer ......" | 24055140 |
hsa-miR-126-3p | kidney renal cell cancer | CRS | "A factor derived from the z-score resulting from t ......" | 24428907 |
hsa-miR-126-3p | lung squamous cell cancer | DICER1 | "We have investigated the prognostic impact of Dice ......" | 25525410 |
hsa-miR-126-3p | esophageal cancer | DNMT1 | "Intriguingly DNMT1 was suppressed by overexpressio ......" | 25512445 |
hsa-miR-126-3p | lung squamous cell cancer | DROSHA | "We have investigated the prognostic impact of Dice ......" | 25525410 |
hsa-miR-126-3p | gastric cancer | EZH2 | "MicroRNA 126 increases chemosensitivity in drug re ......" | 27622325 |
hsa-miR-126-3p | colorectal cancer | FAP | "We analyzed the expressions of miR-126 and miR-20b ......" | 24994098 |
hsa-miR-126-3p | gastric cancer | GNB2 | "Regulator of G protein signaling 3 targeted by miR ......" | 27754994 |
hsa-miR-126-3p | colorectal cancer | IARS | "Down regulation of miR 126 is associated with colo ......" | 24312276 |
hsa-miR-126-3p | pancreatic cancer | IDUA | "Along with higher expression of miR-21 which has b ......" | 22064652 |
hsa-miR-126-3p | pancreatic cancer | KRAS | "miR-126 is also known to target other crucial onco ......" | 22845403 |
hsa-miR-126-3p | gastric cancer | LAT | "MicroRNA 126 inhibits cell proliferation in gastri ......" | 26054677 |
hsa-miR-126-3p | lung squamous cell cancer | MAX | "Moreover forced expression of miRNAs contributed t ......" | 20097187 |
hsa-miR-126-3p | lung squamous cell cancer | MET | "The overexpression of mir-34b and mir-126 decrease ......" | 21702040 |
hsa-miR-126-3p | gastric cancer | MTOR | "In addition the restoration of miR-126 expression ......" | 25428912 |
hsa-miR-126-3p | prostate cancer | NANOG | "The expression levels of SOX2 NANOG Oct4 miR-126 a ......" | 25462564 |
hsa-miR-126-3p | bladder cancer | NMI | "We first profiled the expression of miRNAs and mRN ......" | 24823697 |
hsa-miR-126-3p | ovarian cancer | PAK4 | "microRNA 126 suppresses PAK4 expression in ovarian ......" | 26137045 |
hsa-miR-126-3p | colon cancer | PIK3CD | "The noncoding RNA miR 126 suppresses the growth of ......" | 18663744 |
hsa-miR-126-3p | lung cancer | PLXNB2 | "For miR-126-3p 154 target genes were predicted e.g ......" | 27277197 |
hsa-miR-126-3p | bladder cancer | RFXANK | "MiR 126 regulates proliferation and invasion in th ......" | 27578985 |
hsa-miR-126-3p | gastric cancer | RGS3 | "Interestingly our pathways analysis and the follow ......" | 27754994 |
hsa-miR-126-3p | colon cancer | RHOA | "Moreover we verified that miR-126 negatively regul ......" | 27517626 |
hsa-miR-126-3p | kidney renal cell cancer | ROCK1 | "MicroRNA 126 inhibits tumor cell invasion and meta ......" | 27108693 |
hsa-miR-126-3p | lung squamous cell cancer | SCLC1 | "Since miR-126 is under-expressed in the majority o ......" | 21439283 |
hsa-miR-126-3p | prostate cancer | SDC1 | "Syndecan 1 responsive microRNA 126 and 149 regulat ......" | 25462564 |
hsa-miR-126-3p | sarcoma | SIRT1 | "MicroRNA 126 inhibits osteosarcoma cells prolifera ......" | 23877372 |
hsa-miR-126-3p | cervical and endocervical cancer | TBATA | "This study investigated the temporal and spatial e ......" | 24037526 |
hsa-miR-126-3p | colon cancer | TOM1 | "It has been shown that IRS1 SLC75A and TOM1 were t ......" | 23981989 |
hsa-miR-126-3p | lung cancer | TSC1 | "Ten genes were co-regulated by miR-126-3p and miR- ......" | 27277197 |
hsa-miR-126-3p | colon cancer | TUBA1B | "In the current study using microRNA arrays we foun ......" | 18663744 |
hsa-miR-126-3p | prostate cancer | WISP1 | "Osteoblast-derived WISP-1 inhibited miR-126 expres ......" | 25277191 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-126-3p | IRS1 | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC; STAD | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.288; TCGA COAD -0.231; TCGA ESCA -0.222; TCGA HNSC -0.191; TCGA KIRC -0.164; TCGA LUAD -0.185; TCGA OV -0.183; TCGA PAAD -0.327; TCGA PRAD -0.281; TCGA SARC -0.285; TCGA STAD -0.123 |
hsa-miR-126-3p | DIP2C | 9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.206; TCGA COAD -0.271; TCGA ESCA -0.347; TCGA HNSC -0.157; TCGA LGG -0.065; TCGA LUAD -0.063; TCGA PRAD -0.137; TCGA SARC -0.233; TCGA STAD -0.306 |
hsa-miR-126-3p | MMP7 | 9 cancers: COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; THCA | miRNAWalker2 validate | TCGA COAD -0.723; TCGA HNSC -0.58; TCGA KIRC -0.735; TCGA KIRP -0.532; TCGA LGG -0.35; TCGA LUSC -0.205; TCGA PAAD -0.986; TCGA PRAD -0.417; TCGA THCA -2 |
Enriched cancer pathways of putative targets