microRNA information: hsa-miR-1267
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-1267 | miRbase |
Accession: | MIMAT0005921 | miRbase |
Precursor name: | hsa-mir-1267 | miRbase |
Precursor accession: | MI0006404 | miRbase |
Symbol: | MIR1267 | HGNC |
RefSeq ID: | NR_031671 | GenBank |
Sequence: | CCUGUUGAAGUGUAAUCCCCA |
Reported expression in cancers: hsa-miR-1267
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-1267 | breast cancer | downregulation | "Then from the list of predicted miRNAs we chose tw ......" | 27293058 | qPCR |
Reported cancer pathway affected by hsa-miR-1267
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-1267
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-1267 | breast cancer | staging; metastasis; progression | "Decreased Expression of Bioinformatically Predicte ......" | 27293058 |
Reported gene related to hsa-miR-1267
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-1267 | breast cancer | PIWIL2 | "Decreased Expression of Bioinformatically Predicte ......" | 27293058 |