microRNA information: hsa-miR-1269a
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-1269a | miRbase |
Accession: | MIMAT0005923 | miRbase |
Precursor name: | hsa-mir-1269a | miRbase |
Precursor accession: | MI0006406 | miRbase |
Symbol: | NA | HGNC |
RefSeq ID: | NA | GenBank |
Sequence: | CUGGACUGAGCCGUGCUACUGG |
Reported expression in cancers: hsa-miR-1269a
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-1269a | NA | NA | "NA ......" | NA | NA |
hsa-miR-1269a | " ......" |
Reported cancer pathway affected by hsa-miR-1269a
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-1269a | liver cancer | cell cycle pathway | "The aim of the current study was to elucidate the ......" | 25472505 | Colony formation; Flow cytometry; Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-1269a
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-1269a | liver cancer | progression | "The aim of the current study was to elucidate the ......" | 25472505 | Colony formation; Flow cytometry; Western blot; Luciferase |
hsa-miR-1269a | liver cancer | tumor size | "Hsa mir 1269 genetic variant contributes to hepato ......" | 26692953 | Luciferase |
Reported gene related to hsa-miR-1269a
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-1269a | liver cancer | FOXO1 | "Luciferase assay was used to determine whether FOX ......" | 25472505 |
hsa-miR-1269a | liver cancer | SOX6 | "Hsa mir 1269 genetic variant contributes to hepato ......" | 26692953 |
Expression profile in cancer corhorts: