microRNA information: hsa-miR-1271-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1271-5p | miRbase |
| Accession: | MIMAT0005796 | miRbase |
| Precursor name: | hsa-mir-1271 | miRbase |
| Precursor accession: | MI0003814 | miRbase |
| Symbol: | MIR1271 | HGNC |
| RefSeq ID: | NR_031569 | GenBank |
| Sequence: | CUUGGCACCUAGCAAGCACUCA |
Reported expression in cancers: hsa-miR-1271-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-1271-5p | gastric cancer | downregulation | "miR-1271 was significantly down-regulated in gastr ......" | 24875127 | |
| hsa-miR-1271-5p | gastric cancer | downregulation | "The transwell assay was used to examine the cell i ......" | 26159618 | |
| hsa-miR-1271-5p | head and neck cancer | deregulation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | qPCR; Microarray |
| hsa-miR-1271-5p | lung squamous cell cancer | downregulation | "However whether the downregulation of miR-1271 rel ......" | 26692935 | |
| hsa-miR-1271-5p | pancreatic cancer | downregulation | "miR-1271 was identified to be significantly down-r ......" | 26940738 | Microarray |
Reported cancer pathway affected by hsa-miR-1271-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1271-5p | gastric cancer | Apoptosis pathway | "miR 1271 regulates cisplatin resistance of human g ......" | 24875127 | Luciferase |
| hsa-miR-1271-5p | gastric cancer | Epithelial mesenchymal transition pathway | "MiR 1271 Inhibits Cell Proliferation Invasion and ......" | 26159618 | Transwell assay; Luciferase; Western blot |
| hsa-miR-1271-5p | pancreatic cancer | Epithelial mesenchymal transition pathway | "miR 1271 inhibits migration invasion and epithelia ......" | 26940738 | Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-1271-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1271-5p | gastric cancer | drug resistance | "miR 1271 regulates cisplatin resistance of human g ......" | 24875127 | Luciferase |
| hsa-miR-1271-5p | gastric cancer | staging; metastasis; tumor size; malignant trasformation | "MiR 1271 Inhibits Cell Proliferation Invasion and ......" | 26159618 | Transwell assay; Luciferase; Western blot |
| hsa-miR-1271-5p | head and neck cancer | malignant trasformation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | |
| hsa-miR-1271-5p | lung squamous cell cancer | cell migration | "miR 1271 promotes non small cell lung cancer cell ......" | 25686496 | Western blot; Luciferase |
| hsa-miR-1271-5p | lung squamous cell cancer | tumorigenesis | "Specifically miR-1271 has been shown to downregula ......" | 26692935 | Luciferase; MTT assay |
| hsa-miR-1271-5p | ovarian cancer | poor survival; worse prognosis | "MiR 1271 Inhibits Ovarian Cancer Growth by Targeti ......" | 26477861 | MTT assay; Luciferase; Western blot |
| hsa-miR-1271-5p | pancreatic cancer | metastasis | "miR 1271 inhibits migration invasion and epithelia ......" | 26940738 | Western blot; Luciferase |
Reported gene related to hsa-miR-1271-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1271-5p | ovarian cancer | CCNG1 | "MiR 1271 Inhibits Ovarian Cancer Growth by Targeti ......" | 26477861 |
| hsa-miR-1271-5p | gastric cancer | FOXQ1 | "MiR 1271 Inhibits Cell Proliferation Invasion and ......" | 26159618 |
| hsa-miR-1271-5p | liver cancer | GPC1 | "A functional screening identifies five microRNAs c ......" | 22865282 |
| hsa-miR-1271-5p | liver cancer | GPC3 | "We report that miR-1271 expression is down-regulat ......" | 22865282 |
| hsa-miR-1271-5p | lung squamous cell cancer | HOXA5 | "miR 1271 promotes non small cell lung cancer cell ......" | 25686496 |
| hsa-miR-1271-5p | lung squamous cell cancer | MTOR | "Here we analyzed the levels of miR-1271 and mTor i ......" | 26692935 |
| hsa-miR-1271-5p | ovarian cancer | PCNA | "MiR 1271 Inhibits Ovarian Cancer Growth by Targeti ......" | 26477861 |
| hsa-miR-1271-5p | pancreatic cancer | TWIST1 | "miR 1271 inhibits migration invasion and epithelia ......" | 26940738 |
| hsa-miR-1271-5p | pancreatic cancer | ZEB1 | "miR 1271 inhibits migration invasion and epithelia ......" | 26940738 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-1271-5p | MYRIP | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PRAD; SARC | MirTarget | TCGA BLCA -0.351; TCGA BRCA -0.122; TCGA CESC -0.457; TCGA ESCA -0.774; TCGA HNSC -0.248; TCGA KIRC -0.279; TCGA LUSC -0.532; TCGA PRAD -0.129; TCGA SARC -0.397 |
hsa-miR-1271-5p | ARHGEF12 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; THCA; STAD | MirTarget | TCGA BLCA -0.126; TCGA CESC -0.078; TCGA COAD -0.072; TCGA ESCA -0.12; TCGA HNSC -0.065; TCGA KIRC -0.055; TCGA LUAD -0.089; TCGA LUSC -0.063; TCGA THCA -0.07; TCGA STAD -0.103 |
hsa-miR-1271-5p | CD164 | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.084; TCGA COAD -0.11; TCGA ESCA -0.226; TCGA KIRC -0.089; TCGA KIRP -0.085; TCGA PRAD -0.085; TCGA THCA -0.058; TCGA STAD -0.071; TCGA UCEC -0.098 |
hsa-miR-1271-5p | ATG16L1 | 9 cancers: BLCA; BRCA; ESCA; KIRP; OV; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.055; TCGA BRCA -0.127; TCGA ESCA -0.115; TCGA KIRP -0.063; TCGA OV -0.08; TCGA PAAD -0.127; TCGA PRAD -0.05; TCGA SARC -0.096; TCGA STAD -0.06 |
hsa-miR-1271-5p | SORT1 | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.108; TCGA CESC -0.254; TCGA ESCA -0.266; TCGA HNSC -0.114; TCGA KIRC -0.131; TCGA LUSC -0.134; TCGA OV -0.111; TCGA SARC -0.196; TCGA THCA -0.106; TCGA STAD -0.09; TCGA UCEC -0.107 |
hsa-miR-1271-5p | QSOX1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; UCEC | mirMAP | TCGA BLCA -0.113; TCGA BRCA -0.118; TCGA CESC -0.154; TCGA ESCA -0.3; TCGA HNSC -0.087; TCGA KIRP -0.101; TCGA LGG -0.069; TCGA LUAD -0.076; TCGA LUSC -0.205; TCGA UCEC -0.2 |
hsa-miR-1271-5p | PIK3R3 | 9 cancers: BLCA; BRCA; CESC; ESCA; LIHC; OV; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.151; TCGA BRCA -0.051; TCGA CESC -0.152; TCGA ESCA -0.198; TCGA LIHC -0.086; TCGA OV -0.203; TCGA THCA -0.11; TCGA STAD -0.088; TCGA UCEC -0.252 |
hsa-miR-1271-5p | C15orf52 | 9 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.373; TCGA CESC -0.181; TCGA ESCA -0.34; TCGA KIRC -0.188; TCGA LGG -0.085; TCGA LUSC -0.286; TCGA PAAD -0.343; TCGA SARC -0.535; TCGA STAD -0.209 |
hsa-miR-1271-5p | PDE8B | 9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; THCA; STAD | MirTarget | TCGA CESC -0.269; TCGA COAD -0.192; TCGA ESCA -0.321; TCGA HNSC -0.121; TCGA KIRC -0.189; TCGA LUSC -0.336; TCGA PRAD -0.195; TCGA THCA -0.207; TCGA STAD -0.167 |
hsa-miR-1271-5p | CCNG1 | 9 cancers: COAD; ESCA; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA COAD -0.088; TCGA ESCA -0.179; TCGA LIHC -0.087; TCGA LUAD -0.067; TCGA LUSC -0.117; TCGA PRAD -0.057; TCGA THCA -0.093; TCGA STAD -0.09; TCGA UCEC -0.062 |
Enriched cancer pathways of putative targets