microRNA information: hsa-miR-1283

SectionIDlink
Mature name: hsa-miR-1283miRbase
Accession: MIMAT0005799miRbase
Precursor name: hsa-mir-1283-1 miRbase
Precursor accession: MI0003832miRbase
Symbol: MIR1283-1HGNC
RefSeq ID: NR_031573GenBank
Sequence: UCUACAAAGGAAAGCGCUUUCU



Reported expression in cancers: hsa-miR-1283

miRNAcancerregulationreportingPUBMEDmethod



Reported cancer pathway affected by hsa-miR-1283

miRNAcancerpathwayreportingPUBMEDfunctional study



Reported cancer prognosis affected by hsa-miR-1283

miRNAcancerprognosisreportingPUBMEDfunctional study



Reported gene related to hsa-miR-1283

miRNAcancergenereportingPUBMED