microRNA information: hsa-miR-1287-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-1287-5p | miRbase |
Accession: | MIMAT0005878 | miRbase |
Precursor name: | hsa-mir-1287 | miRbase |
Precursor accession: | MI0006349 | miRbase |
Symbol: | MIR1287 | HGNC |
RefSeq ID: | NR_031619 | GenBank |
Sequence: | UGCUGGAUCAGUGGUUCGAGUC |
Reported expression in cancers: hsa-miR-1287-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-1287-5p | colorectal cancer | upregulation | "Diagnostic and Prognostic Value of miR 1287 in Col ......" | 27251300 | Reverse transcription PCR; qPCR |
Reported cancer pathway affected by hsa-miR-1287-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-1287-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-1287-5p | colorectal cancer | tumorigenesis | "Diagnostic and Prognostic Value of miR 1287 in Col ......" | 27251300 |
Reported gene related to hsa-miR-1287-5p
miRNA | cancer | gene | reporting | PUBMED |
---|
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-1287-5p | RAP1GDS1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; OV; SARC; THCA | MirTarget | TCGA BLCA -0.12; TCGA CESC -0.094; TCGA COAD -0.113; TCGA ESCA -0.105; TCGA HNSC -0.102; TCGA KIRC -0.105; TCGA KIRP -0.148; TCGA OV -0.085; TCGA SARC -0.072; TCGA THCA -0.163 |
hsa-miR-1287-5p | RHOG | 9 cancers: BLCA; CESC; HNSC; LUAD; LUSC; OV; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.195; TCGA CESC -0.085; TCGA HNSC -0.198; TCGA LUAD -0.1; TCGA LUSC -0.07; TCGA OV -0.07; TCGA PRAD -0.092; TCGA THCA -0.282; TCGA STAD -0.083 |
hsa-miR-1287-5p | CDHR1 | 9 cancers: CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA CESC -0.507; TCGA COAD -1.042; TCGA ESCA -0.981; TCGA HNSC -0.226; TCGA LGG -0.314; TCGA LUAD -0.234; TCGA LUSC -0.513; TCGA PRAD -0.251; TCGA STAD -0.671 |
Enriched cancer pathways of putative targets