microRNA information: hsa-miR-129-2-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-129-2-3p | miRbase |
| Accession: | MIMAT0004605 | miRbase |
| Precursor name: | hsa-mir-129-2 | miRbase |
| Precursor accession: | MI0000473 | miRbase |
| Symbol: | MIR129-2 | HGNC |
| RefSeq ID: | NR_029697 | GenBank |
| Sequence: | AAGCCCUUACCCCAAAAAGCAU |
Reported expression in cancers: hsa-miR-129-2-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-129-2-3p | breast cancer | deregulation | "Downregulation of miR 129 2 by promoter hypermethy ......" | 26935022 | |
| hsa-miR-129-2-3p | esophageal cancer | downregulation | "Among those dysregulated miRNAs miR-203 miR-34b/c ......" | 21547903 | |
| hsa-miR-129-2-3p | liver cancer | downregulation | "Frequent DNA methylation of MiR 129 2 and its pote ......" | 23580407 | |
| hsa-miR-129-2-3p | retinoblastoma | upregulation | "Identification of miRNAs associated with tumorigen ......" | 18818933 | Microarray; Northern blot; in situ hybridization |
Reported cancer pathway affected by hsa-miR-129-2-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-129-2-3p | breast cancer | Apoptosis pathway | "Downregulation of miR 129 2 by promoter hypermethy ......" | 26935022 | Luciferase |
| hsa-miR-129-2-3p | gastric cancer | Apoptosis pathway | "Epigenetic repression of microRNA 129 2 leads to o ......" | 20331975 |
Reported cancer prognosis affected by hsa-miR-129-2-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-129-2-3p | breast cancer | progression | "Downregulation of miR 129 2 by promoter hypermethy ......" | 26935022 | Luciferase |
| hsa-miR-129-2-3p | endometrial cancer | poor survival | "Epigenetic repression of microRNA 129 2 leads to o ......" | 19887623 | |
| hsa-miR-129-2-3p | endometrial cancer | progression; tumorigenesis | "Finally hypermethylation of miRNAs stratified 49 e ......" | 25767621 | |
| hsa-miR-129-2-3p | liver cancer | staging; metastasis; poor survival; cell migration | "Methylation mediated repression of microRNA 129 2 ......" | 27191994 | |
| hsa-miR-129-2-3p | retinoblastoma | tumorigenesis | "Identification of miRNAs associated with tumorigen ......" | 18818933 |
Reported gene related to hsa-miR-129-2-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-129-2-3p | endometrial cancer | SOX4 | "Epigenetic repression of microRNA 129 2 leads to o ......" | 19887623 |
| hsa-miR-129-2-3p | endometrial cancer | SOX4 | "Aberrant expression of SOX4 in endometrial cancer ......" | 24530564 |
| hsa-miR-129-2-3p | esophageal cancer | SOX4 | "miR 129 2 suppresses proliferation and migration o ......" | 23677061 |
| hsa-miR-129-2-3p | gastric cancer | SOX4 | "Epigenetic repression of microRNA 129 2 leads to o ......" | 20331975 |
| hsa-miR-129-2-3p | breast cancer | BCL2L2 | "In addition a luciferase reporter assay revealed t ......" | 26935022 |
| hsa-miR-129-2-3p | ovarian cancer | GPX1 | "We first revealed a negative correlation between t ......" | 26519551 |
| hsa-miR-129-2-3p | liver cancer | HMGB1 | "Furthermore we confirmed that high mobility group ......" | 27191994 |
| hsa-miR-129-2-3p | breast cancer | IBSP | "Moreover bisulfite DNA sequencing PCR BSP analysis ......" | 26935022 |
| hsa-miR-129-2-3p | endometrial cancer | LITAF | "Finally hypermethylation of miRNAs stratified 49 e ......" | 25767621 |
| hsa-miR-129-2-3p | endometrial cancer | MLH1 | "Further analysis found a significant correlation o ......" | 19887623 |
| hsa-miR-129-2-3p | ovarian cancer | RASSF1 | "We first revealed a negative correlation between t ......" | 26519551 |
| hsa-miR-129-2-3p | ovarian cancer | SEMA3B | "We first demonstrated a high hypermethylation freq ......" | 26519551 |