microRNA information: hsa-miR-1294
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-1294 | miRbase |
Accession: | MIMAT0005884 | miRbase |
Precursor name: | hsa-mir-1294 | miRbase |
Precursor accession: | MI0006356 | miRbase |
Symbol: | MIR1294 | HGNC |
RefSeq ID: | NR_031626 | GenBank |
Sequence: | UGUGAGGUUGGCAUUGUUGUCU |
Reported expression in cancers: hsa-miR-1294
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-1294 | esophageal cancer | downregulation | "This study aimed to investigate the expression of ......" | 25925090 | Reverse transcription PCR; qPCR |
Reported cancer pathway affected by hsa-miR-1294
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-1294
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-1294 | esophageal cancer | worse prognosis; cell migration | "Down Regulation of MiR 1294 is Related to Dismal P ......" | 25925090 | Transwell assay |
Reported gene related to hsa-miR-1294
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-1294 | esophageal cancer | MYC | "Down Regulation of MiR 1294 is Related to Dismal P ......" | 25925090 |