microRNA information: hsa-miR-1303
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1303 | miRbase |
| Accession: | MIMAT0005891 | miRbase |
| Precursor name: | hsa-mir-1303 | miRbase |
| Precursor accession: | MI0006370 | miRbase |
| Symbol: | MIR1303 | HGNC |
| RefSeq ID: | NR_031638 | GenBank |
| Sequence: | UUUAGAGACGGGGUCUUGCUCU |
Reported expression in cancers: hsa-miR-1303
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-1303
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1303
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1303 | breast cancer | staging | "Quantitative RT-PCR was used to determine expressi ......" | 23526361 | |
| hsa-miR-1303 | colorectal cancer | tumorigenesis | "The second group contained three genes i.e hsa-mir ......" | 22348132 | |
| hsa-miR-1303 | gastric cancer | tumorigenesis; staging; metastasis; tumor size | "miR 1303 targets claudin 18 gene to modulate proli ......" | 24647998 | Western blot; Colony formation; Wound Healing Assay; Luciferase |
Reported gene related to hsa-miR-1303
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1303 | gastric cancer | CLDN18 | "miR 1303 targets claudin 18 gene to modulate proli ......" | 24647998 |