microRNA information: hsa-miR-130a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-130a-5p | miRbase |
Accession: | MIMAT0004593 | miRbase |
Precursor name: | hsa-mir-130a | miRbase |
Precursor accession: | MI0000448 | miRbase |
Symbol: | MIR130A | HGNC |
RefSeq ID: | NR_029673 | GenBank |
Sequence: | UUCACAUUGUGCUACUGUCUGC |
Reported expression in cancers: hsa-miR-130a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-130a-5p | bladder cancer | upregulation | "We focused on the miR-130 family miR-130b miR-301a ......" | 26837847 | |
hsa-miR-130a-5p | breast cancer | downregulation | "MiR-130a has been demonstrated to play important r ......" | 25755726 | |
hsa-miR-130a-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
hsa-miR-130a-5p | gastric cancer | upregulation | "The high expression of miR-20a miR-25 miR-93 miR-1 ......" | 22996433 | |
hsa-miR-130a-5p | head and neck cancer | deregulation | "Real-time polymerase chain reaction PCR analysis c ......" | 21560177 | qPCR |
hsa-miR-130a-5p | liver cancer | downregulation | "MicroRNA 130a is down regulated in hepatocellular ......" | 25218269 | qPCR |
hsa-miR-130a-5p | lung cancer | deregulation | "Microarray studies revealed alterations in the exp ......" | 19748927 | Microarray; Reverse transcription PCR |
hsa-miR-130a-5p | lung squamous cell cancer | downregulation | "miR 130a regulates macrophage polarization and is ......" | 26398698 | qPCR |
hsa-miR-130a-5p | melanoma | downregulation | "Among the miRNAs that were commonly and significan ......" | 27149382 | |
hsa-miR-130a-5p | prostate cancer | downregulation | "MiR 130a miR 203 and miR 205 jointly repress key o ......" | 22391564 | |
hsa-miR-130a-5p | prostate cancer | downregulation | "Microarray analysis of mRNA expression was also co ......" | 26074357 | Microarray |
hsa-miR-130a-5p | thyroid cancer | deregulation | "Deregulated miRNAs were confirmed by quantitative ......" | 24127332 | qPCR; in situ hybridization |
Reported cancer pathway affected by hsa-miR-130a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-130a-5p | chronic myeloid leukemia | Apoptosis pathway | "Functional studies of miR 130a on the inhibitory p ......" | 26494558 | Western blot; Luciferase |
hsa-miR-130a-5p | gastric cancer | Apoptosis pathway | "Targeting of RUNX3 by miR 130a and miR 495 coopera ......" | 26375442 | Luciferase |
hsa-miR-130a-5p | lung squamous cell cancer | Apoptosis pathway | "MiR 130a overcomes gefitinib resistance by targeti ......" | 24606471 | |
hsa-miR-130a-5p | ovarian cancer | Apoptosis pathway | "Downregulation of miR 130a contributes to cisplati ......" | 24145606 | Flow cytometry; MTT assay |
hsa-miR-130a-5p | ovarian cancer | PI3K/Akt signaling pathway; Apoptosis pathway | "Expression of MiR 130a in Serum Samples of Patient ......" | 27062783 | |
hsa-miR-130a-5p | sarcoma | Epithelial mesenchymal transition pathway | "MicroRNA 130a promotes the metastasis and epitheli ......" | 27035216 |
Reported cancer prognosis affected by hsa-miR-130a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-130a-5p | B cell lymphoma | drug resistance; progression; recurrence | "Circulating microRNA 125b and microRNA 130a expres ......" | 26870228 | |
hsa-miR-130a-5p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
hsa-miR-130a-5p | bladder cancer | cell migration; malignant trasformation; progression | "The miR 130 family promotes cell migration and inv ......" | 26837847 | |
hsa-miR-130a-5p | breast cancer | drug resistance | "The drug resistance of MCF-7/ADR cells was evaluat ......" | 18971180 | Flow cytometry; MTT assay |
hsa-miR-130a-5p | breast cancer | metastasis; progression | "Aberrant plasma levels of circulating miR 16 miR 1 ......" | 26033453 | |
hsa-miR-130a-5p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
hsa-miR-130a-5p | cervical and endocervical cancer | poor survival | "Prognostic significance of low DICER expression re ......" | 24787017 | Luciferase |
hsa-miR-130a-5p | chronic myeloid leukemia | drug resistance; poor survival; worse prognosis | "Functional studies of miR 130a on the inhibitory p ......" | 26494558 | Western blot; Luciferase |
hsa-miR-130a-5p | gastric cancer | metastasis; poor survival | "The high expression of miR-20a miR-25 miR-93 miR-1 ......" | 22996433 | |
hsa-miR-130a-5p | gastric cancer | tumorigenesis; worse prognosis | "miR 130a acts as a potential diagnostic biomarker ......" | 26134263 | Luciferase; Transwell assay |
hsa-miR-130a-5p | gastric cancer | progression | "Targeting of RUNX3 by miR 130a and miR 495 coopera ......" | 26375442 | Luciferase |
hsa-miR-130a-5p | glioblastoma | poor survival; recurrence | "Moreover miR-326 miR-130a miR-155 miR-210 and 4 mi ......" | 23302469 | |
hsa-miR-130a-5p | glioblastoma | drug resistance | "miR 130a can predict response to temozolomide in p ......" | 25890369 | |
hsa-miR-130a-5p | liver cancer | worse prognosis; staging; metastasis; tumor size; poor survival | "MicroRNA 130a is down regulated in hepatocellular ......" | 25218269 | |
hsa-miR-130a-5p | liver cancer | progression | "This study investigated the potential of serum mic ......" | 26352740 | |
hsa-miR-130a-5p | lung squamous cell cancer | drug resistance | "MiR 130a overcomes gefitinib resistance by targeti ......" | 24606471 | |
hsa-miR-130a-5p | lung squamous cell cancer | worse prognosis; drug resistance; staging; metastasis | "miR 130a regulates macrophage polarization and is ......" | 26398698 | Western blot; Luciferase |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "High-throughput analysis of the miRNA profile in a ......" | 18823650 | |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "Furthermore we discuss several other microRNAs tha ......" | 20083225 | |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "Expression of miR 130a in cisplatin resistant cell ......" | 22455133 | MTT assay |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "Altered microRNA expression in cisplatin resistant ......" | 22614869 | Western blot; MTT assay |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "Downregulation of miR 130a contributes to cisplati ......" | 24145606 | Flow cytometry; MTT assay |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "Regulatory effects and associated mechanisms of mi ......" | 24490491 | MTT assay; Western blot |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "MiR 130a and MiR 374a Function as Novel Regulators ......" | 26043084 | Western blot |
hsa-miR-130a-5p | ovarian cancer | drug resistance | "NRP1 is targeted by miR 130a and miR 130b and is a ......" | 26573160 | |
hsa-miR-130a-5p | ovarian cancer | drug resistance; metastasis | "Expression of MiR 130a in Serum Samples of Patient ......" | 27062783 | |
hsa-miR-130a-5p | prostate cancer | drug resistance | "miR 130a activates apoptotic signaling through act ......" | 26074357 | Luciferase |
hsa-miR-130a-5p | sarcoma | metastasis; worse prognosis | "MicroRNA 130a promotes the metastasis and epitheli ......" | 27035216 |
Reported gene related to hsa-miR-130a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-130a-5p | bladder cancer | PTEN | "The miR 130 family promotes cell migration and inv ......" | 26837847 |
hsa-miR-130a-5p | cervical and endocervical cancer | PTEN | "In addition by targeting PTEN 3' untranslated regi ......" | 27040383 |
hsa-miR-130a-5p | ovarian cancer | PTEN | "Down-regulated miR-130a did not affect cell prolif ......" | 24490491 |
hsa-miR-130a-5p | ovarian cancer | PTEN | "Platinum-resistant patients had significantly high ......" | 27062783 |
hsa-miR-130a-5p | ovarian cancer | PTEN | "We found that miR-130a was upregulated in SKOV3/CI ......" | 22614869 |
hsa-miR-130a-5p | ovarian cancer | PTEN | "This role of miR-130a may be achieved by regulatin ......" | 26043084 |
hsa-miR-130a-5p | sarcoma | PTEN | "MicroRNA 130a promotes the metastasis and epitheli ......" | 27035216 |
hsa-miR-130a-5p | ovarian cancer | ABCB1 | "Over-expressions of miR-130a had no effect on cell ......" | 24490491 |
hsa-miR-130a-5p | ovarian cancer | ABCB1 | "Moreover downregulation of miR-130a could inhibit ......" | 22614869 |
hsa-miR-130a-5p | gastric cancer | RUNX3 | "miR 130a acts as a potential diagnostic biomarker ......" | 26134263 |
hsa-miR-130a-5p | gastric cancer | RUNX3 | "Targeting of RUNX3 by miR 130a and miR 495 coopera ......" | 26375442 |
hsa-miR-130a-5p | ovarian cancer | ABCB6 | "Moreover downregulation of miR-130a could inhibit ......" | 22614869 |
hsa-miR-130a-5p | cervical and endocervical cancer | AKT1 | "In addition by targeting PTEN 3' untranslated regi ......" | 27040383 |
hsa-miR-130a-5p | glioblastoma | APEX1 | "GSEA and GO analysis indicated that lower miR-130a ......" | 25890369 |
hsa-miR-130a-5p | ovarian cancer | BCL2 | "Platinum-resistant patients had significantly high ......" | 27062783 |
hsa-miR-130a-5p | gastric cancer | BCL2L11 | "Combination of miR-130a and miR-495 significantly ......" | 26375442 |
hsa-miR-130a-5p | prostate cancer | CASP8 | "miR 130a activates apoptotic signaling through act ......" | 26074357 |
hsa-miR-130a-5p | ovarian cancer | CSF1 | "Finally downstream target validation was proven fo ......" | 18823650 |
hsa-miR-130a-5p | B cell lymphoma | DDIT3 | "Circulating microRNA 125b and microRNA 130a expres ......" | 26870228 |
hsa-miR-130a-5p | cervical and endocervical cancer | DICER1 | "Prognostic significance of low DICER expression re ......" | 24787017 |
hsa-miR-130a-5p | glioblastoma | IGKV1D-35 | "miR 130a can predict response to temozolomide in p ......" | 25890369 |
hsa-miR-130a-5p | glioblastoma | MGMT | "miR 130a can predict response to temozolomide in p ......" | 25890369 |
hsa-miR-130a-5p | cervical and endocervical cancer | NFASC | "NF κB modulated miR 130a targets TNF α in cervic ......" | 24885472 |
hsa-miR-130a-5p | ovarian cancer | NOL3 | "MTT assay and flow cytometry FCM results showed th ......" | 24145606 |
hsa-miR-130a-5p | ovarian cancer | NRP1 | "NRP1 is targeted by miR 130a and miR 130b and is a ......" | 26573160 |
hsa-miR-130a-5p | bladder cancer | PTK2 | "The miR 130 family promotes cell migration and inv ......" | 26837847 |
hsa-miR-130a-5p | breast cancer | RAB5A | "MicroRNA 130a inhibits cell proliferation invasion ......" | 25755726 |
hsa-miR-130a-5p | prostate cancer | SLAIN1 | "Based on mRNA microarray analysis and luciferase r ......" | 26074357 |
hsa-miR-130a-5p | ovarian cancer | TECRL | "Altered microRNA expression in cisplatin resistant ......" | 22614869 |
hsa-miR-130a-5p | cervical and endocervical cancer | TNF | "NF κB modulated miR 130a targets TNF α in cervic ......" | 24885472 |
hsa-miR-130a-5p | chronic myeloid leukemia | TP53 | "We in this study aimed to investigate the function ......" | 26494558 |
hsa-miR-130a-5p | ovarian cancer | XIAP | "Downregulation of miR 130a contributes to cisplati ......" | 24145606 |
Expression profile in cancer corhorts: