microRNA information: hsa-miR-132-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-132-5p | miRbase |
Accession: | MIMAT0004594 | miRbase |
Precursor name: | hsa-mir-132 | miRbase |
Precursor accession: | MI0000449 | miRbase |
Symbol: | MIR132 | HGNC |
RefSeq ID: | NR_029674 | GenBank |
Sequence: | ACCGUGGCUUUCGAUUGUUACU |
Reported expression in cancers: hsa-miR-132-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-132-5p | breast cancer | downregulation | "This study aims to investigate the role and the un ......" | 25450365 | |
hsa-miR-132-5p | breast cancer | downregulation | "Aberrant Expression of Breast Development Related ......" | 27382390 | qPCR |
hsa-miR-132-5p | cervical and endocervical cancer | downregulation | "In this study we found that miR-212 and miR-132 fr ......" | 25988335 | |
hsa-miR-132-5p | colorectal cancer | downregulation | "To investigate the biological role and underlying ......" | 24914372 | qPCR |
hsa-miR-132-5p | colorectal cancer | downregulation | "Downregulation of microRNA 132 by DNA hypermethyla ......" | 26675712 | qPCR |
hsa-miR-132-5p | colorectal cancer | downregulation | "Down Regulation of microRNA 132 is Associated with ......" | 26868958 | qPCR |
hsa-miR-132-5p | liver cancer | downregulation | "Epigenetic repression of miR 132 expression by the ......" | 23376496 | qPCR |
hsa-miR-132-5p | liver cancer | downregulation | "To observe the biological role and underlying mech ......" | 25676267 | qPCR |
hsa-miR-132-5p | liver cancer | downregulation | "Downregulation of microRNA 132 indicates progressi ......" | 27698698 | qPCR |
hsa-miR-132-5p | ovarian cancer | downregulation | "The aim of this study was to find specific profile ......" | 23542579 | Microarray; qPCR |
hsa-miR-132-5p | pancreatic cancer | downregulation | "Downregulation of miR 132 by promoter methylation ......" | 21665894 | Microarray |
hsa-miR-132-5p | prostate cancer | downregulation | "DNA methylation silences miR 132 in prostate cance ......" | 22310291 |
Reported cancer pathway affected by hsa-miR-132-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-132-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "miR 132 inhibits colorectal cancer invasion and me ......" | 24914372 | Transwell assay; Western blot; Luciferase |
hsa-miR-132-5p | liver cancer | PI3K/Akt signaling pathway | "Epigenetic repression of miR 132 expression by the ......" | 23376496 | Colony formation |
hsa-miR-132-5p | liver cancer | Apoptosis pathway | "Effects of MicroRNA 132 transfection on the prolif ......" | 25676267 | Flow cytometry; Western blot |
hsa-miR-132-5p | liver cancer | Apoptosis pathway | "MiR 132 inhibits cell proliferation invasion and m ......" | 26252738 | Colony formation; Luciferase; Western blot |
hsa-miR-132-5p | liver cancer | Apoptosis pathway | "An Encapsulation of Gene Signatures for Hepatocell ......" | 27467251 | |
hsa-miR-132-5p | liver cancer | Apoptosis pathway | "Effect of co transfection of miR 520c 3p and miR 1 ......" | 27633306 | Western blot; Flow cytometry |
hsa-miR-132-5p | lung cancer | cell cycle pathway | "Furthermore miR-212/132 overexpression induced cel ......" | 25435090 | |
hsa-miR-132-5p | lung squamous cell cancer | Apoptosis pathway | "Hsa miR 132 regulates apoptosis in non small cell ......" | 24158730 | |
hsa-miR-132-5p | lung squamous cell cancer | Apoptosis pathway | "Decreased microRNA 132 and its function in human n ......" | 25607827 | Cell migration assay; MTT assay |
hsa-miR-132-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MicroRNA 132 inhibits migration invasion and epith ......" | 27735039 | Wound Healing Assay; Western blot |
hsa-miR-132-5p | pancreatic cancer | PI3K/Akt signaling pathway | "Downregulation of miR 132 by promoter methylation ......" | 21665894 | Colony formation |
hsa-miR-132-5p | sarcoma | cell cycle pathway | "miR 132 targeting cyclin E1 suppresses cell prolif ......" | 24449507 |
Reported cancer prognosis affected by hsa-miR-132-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-132-5p | breast cancer | malignant trasformation | "In support of these findings in vitro functional s ......" | 24104550 | |
hsa-miR-132-5p | breast cancer | motility | "Here we have defined novel epithelial as well as s ......" | 25122196 | |
hsa-miR-132-5p | breast cancer | metastasis | "MiR 132 prohibits proliferation invasion migration ......" | 25450365 | |
hsa-miR-132-5p | colorectal cancer | metastasis; progression; staging; tumor size; poor survival | "miR 132 inhibits colorectal cancer invasion and me ......" | 24914372 | Transwell assay; Western blot; Luciferase |
hsa-miR-132-5p | colorectal cancer | worse prognosis | "Downregulation of microRNA 132 by DNA hypermethyla ......" | 26675712 | |
hsa-miR-132-5p | colorectal cancer | worse prognosis; metastasis; poor survival | "Down Regulation of microRNA 132 is Associated with ......" | 26868958 | Luciferase |
hsa-miR-132-5p | colorectal cancer | poor survival | "The expression levels of miR-206 miR-219 miR-192 m ......" | 27666868 | |
hsa-miR-132-5p | endometrial cancer | tumorigenesis | "Hypermethylation of miR-345 and miR-132 associated ......" | 25767621 | |
hsa-miR-132-5p | gastric cancer | worse prognosis; staging; metastasis; poor survival | "The expression and clinical significance of miR 13 ......" | 24621117 | |
hsa-miR-132-5p | gastric cancer | tumorigenesis | "miR 132 upregulation promotes gastric cancer cell ......" | 26298723 | Luciferase |
hsa-miR-132-5p | glioblastoma | poor survival; worse prognosis | "Correlation of MicroRNA 132 Up regulation with an ......" | 24466377 | |
hsa-miR-132-5p | liver cancer | tumorigenesis | "Epigenetic repression of miR 132 expression by the ......" | 23376496 | Colony formation |
hsa-miR-132-5p | liver cancer | worse prognosis | "An Encapsulation of Gene Signatures for Hepatocell ......" | 27467251 | |
hsa-miR-132-5p | liver cancer | progression; recurrence; staging; metastasis | "Downregulation of microRNA 132 indicates progressi ......" | 27698698 | |
hsa-miR-132-5p | lung cancer | cell migration; progression | "miR 132 inhibits lung cancer cell migration and in ......" | 26543603 | Transwell assay; Wound Healing Assay; Western blot; Luciferase |
hsa-miR-132-5p | lung squamous cell cancer | tumorigenesis | "Hsa miR 132 regulates apoptosis in non small cell ......" | 24158730 | |
hsa-miR-132-5p | lung squamous cell cancer | metastasis | "MicroRNA 132 inhibits migration invasion and epith ......" | 27735039 | Wound Healing Assay; Western blot |
hsa-miR-132-5p | ovarian cancer | progression | "miR 132 targeting E2F5 suppresses cell proliferati ......" | 27186275 | Colony formation |
hsa-miR-132-5p | ovarian cancer | worse prognosis; drug resistance | "MicroRNAs such as miR-26a and miR-132 have been in ......" | 27673409 | |
hsa-miR-132-5p | prostate cancer | drug resistance; staging; poor survival | "DNA methylation silences miR 132 in prostate cance ......" | 22310291 | |
hsa-miR-132-5p | sarcoma | worse prognosis; poor survival; staging; metastasis; drug resistance; progression | "Loss of microRNA 132 predicts poor prognosis in pa ......" | 23801049 | |
hsa-miR-132-5p | sarcoma | metastasis | "MicroRNA 132 inhibits cell growth and metastasis i ......" | 26352673 | Western blot; Luciferase |
Reported gene related to hsa-miR-132-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-132-5p | lung cancer | SOX4 | "miR 132 inhibits lung cancer cell migration and in ......" | 26543603 |
hsa-miR-132-5p | prostate cancer | SOX4 | "Immunohistochemistry IHC was used to detect the ex ......" | 27527117 |
hsa-miR-132-5p | sarcoma | SOX4 | "MicroRNA 132 inhibits cell growth and metastasis i ......" | 26352673 |
hsa-miR-132-5p | colorectal cancer | ZEB2 | "miR 132 inhibits colorectal cancer invasion and me ......" | 24914372 |
hsa-miR-132-5p | lung cancer | ZEB2 | "MiR 132 suppresses the migration and invasion of l ......" | 24626466 |
hsa-miR-132-5p | colorectal cancer | ANO1 | "The luciferase reporter assay revealed that anocta ......" | 26868958 |
hsa-miR-132-5p | liver cancer | CASP3 | "After miR-132 transfectionthe expression of Caspas ......" | 25676267 |
hsa-miR-132-5p | sarcoma | CCNE1 | "Of significance contrary to CCNE1 expression level ......" | 24449507 |
hsa-miR-132-5p | ovarian cancer | E2F5 | "miR 132 targeting E2F5 suppresses cell proliferati ......" | 27186275 |
hsa-miR-132-5p | prostate cancer | EGF | "Two pro-survival proteins-heparin-binding epiderma ......" | 22310291 |
hsa-miR-132-5p | gastric cancer | FOXO1 | "miR 132 upregulation promotes gastric cancer cell ......" | 26298723 |
hsa-miR-132-5p | breast cancer | HN1 | "MiR 132 prohibits proliferation invasion migration ......" | 25450365 |
hsa-miR-132-5p | glioblastoma | MGMT | "miR-132 was a stronger prognostic indicator than E ......" | 24466377 |
hsa-miR-132-5p | liver cancer | NINL | "Various assays were performed to explore the role ......" | 27467251 |
hsa-miR-132-5p | liver cancer | NME1 | "Spearman correlation analysis demonstrated that mi ......" | 27698698 |
hsa-miR-132-5p | liver cancer | PIK3R3 | "MiR 132 inhibits cell proliferation invasion and m ......" | 26252738 |
hsa-miR-132-5p | colorectal cancer | PXN | "Bioinformatics analysis indicated that the mechani ......" | 26675712 |
hsa-miR-132-5p | prostate cancer | SLC2A1 | "miR 132 mediates a metabolic shift in prostate can ......" | 27398313 |
hsa-miR-132-5p | lung squamous cell cancer | SMAD2 | "Moreover expression of EMT-related markers and Sma ......" | 27735039 |
hsa-miR-132-5p | glioblastoma | SNORD44 | "miR-132 levels relative to RNU44 were assessed by ......" | 24466377 |
hsa-miR-132-5p | pancreatic cancer | SP1 | "miR-132 was transcribed by RNA polymerase II and S ......" | 21665894 |
hsa-miR-132-5p | liver cancer | TH | "Th e associations between miR-132 expression level ......" | 27698698 |
Expression profile in cancer corhorts: