microRNA information: hsa-miR-1323
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1323 | miRbase |
| Accession: | MIMAT0005795 | miRbase |
| Precursor name: | hsa-mir-1323 | miRbase |
| Precursor accession: | MI0003786 | miRbase |
| Symbol: | MIR1323 | HGNC |
| RefSeq ID: | NR_031568 | GenBank |
| Sequence: | UCAAAACUGAGGGGCAUUUUCU |
Reported expression in cancers: hsa-miR-1323
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-1323
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1323
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1323 | lung cancer | poor survival; drug resistance | "Knockdown of microRNA 1323 restores sensitivity to ......" | 25823795 | Luciferase; Western blot; Colony formation |
Reported gene related to hsa-miR-1323
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1323 | lung cancer | PRKDC | "Knockdown of microRNA 1323 restores sensitivity to ......" | 25823795 |