microRNA information: hsa-miR-133b
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-133b | miRbase |
Accession: | MIMAT0000770 | miRbase |
Precursor name: | hsa-mir-133b | miRbase |
Precursor accession: | MI0000822 | miRbase |
Symbol: | MIR133B | HGNC |
RefSeq ID: | NR_029903 | GenBank |
Sequence: | UUUGGUCCCCUUCAACCAGCUA |
Reported expression in cancers: hsa-miR-133b
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-133b | bladder cancer | downregulation | "We identified a subset of 7 miRNAs miR-145 miR-30a ......" | 19378336 | qPCR |
hsa-miR-133b | bladder cancer | downregulation | "Many human malignant tumors demonstrate a low expr ......" | 25414595 | |
hsa-miR-133b | cervical and endocervical cancer | upregulation | "We report that elevated microRNA-133b miR-133b act ......" | 22179829 | |
hsa-miR-133b | colon cancer | downregulation | "TAp63 expression is downregulated in colon cancer ......" | 24594999 | |
hsa-miR-133b | colorectal cancer | downregulation | "In the present study the role of miR-133b was iden ......" | 20505319 | |
hsa-miR-133b | colorectal cancer | downregulation | "A significant downregulation of miR-133b was obser ......" | 24330809 | |
hsa-miR-133b | esophageal cancer | downregulation | "A comparison of miRNA signatures from ESCC and our ......" | 21351259 | |
hsa-miR-133b | esophageal cancer | downregulation | "Combined downregulation of microRNA 133a and micro ......" | 25280517 | qPCR |
hsa-miR-133b | gastric cancer | downregulation | "Intriguingly it has been shown that miR-133b was s ......" | 23296701 | qPCR |
hsa-miR-133b | gastric cancer | downregulation | "Here we examine the role of miR-133b in gastric ca ......" | 24443799 | qPCR |
hsa-miR-133b | gastric cancer | downregulation | "Here we found that miR-145 miR-133a and miR-133b w ......" | 24613927 | |
hsa-miR-133b | gastric cancer | downregulation | "We also found that miR-133 was down-regulated in 1 ......" | 25152372 | |
hsa-miR-133b | gastric cancer | downregulation | "In this study we aimed to investigate the expressi ......" | 25433493 | qPCR |
hsa-miR-133b | gastric cancer | downregulation | "Thus the differential expression of a panel of miR ......" | 26171025 | Microarray; qPCR |
hsa-miR-133b | gastric cancer | downregulation | "Here a heatmap analysis of the miRNomes was perfor ......" | 26276722 | |
hsa-miR-133b | head and neck cancer | deregulation | "MicroRNA alterations that consistently identified ......" | 19753298 | |
hsa-miR-133b | lung squamous cell cancer | downregulation | "Down regulation of microRNA 126 and microRNA 133b ......" | 26823832 | qPCR |
hsa-miR-133b | ovarian cancer | deregulation | "We examined the levels of miR-133b expression in o ......" | 26396496 | |
hsa-miR-133b | prostate cancer | downregulation | "miR 1 and miR 133b are differentially expressed in ......" | 24967583 | Microarray; qPCR |
hsa-miR-133b | sarcoma | deregulation | "Moreover the patients with low miR-133b expression ......" | 25120799 |
Reported cancer pathway affected by hsa-miR-133b
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-133b | bladder cancer | Apoptosis pathway | "MiR 133b regulates bladder cancer cell proliferati ......" | 25414595 | Western blot; Flow cytometry; Luciferase |
hsa-miR-133b | colorectal cancer | Apoptosis pathway | "miR 133b regulates the MET proto oncogene and inhi ......" | 20505319 | Luciferase |
hsa-miR-133b | colorectal cancer | Apoptosis pathway | "miR 133b a muscle specific microRNA is a novel pro ......" | 24330809 | Western blot; Luciferase |
hsa-miR-133b | colorectal cancer | Apoptosis pathway; cell cycle pathway | "DNA methylation is involved in the aberrant expres ......" | 26622593 | |
hsa-miR-133b | gastric cancer | cell cycle pathway | "MiR 145 miR 133a and miR 133b inhibit proliferatio ......" | 24613927 | |
hsa-miR-133b | gastric cancer | Apoptosis pathway | "Impairment of growth of gastric carcinoma by miR 1 ......" | 26076812 | MTT assay; Luciferase |
hsa-miR-133b | glioblastoma | Apoptosis pathway | "Growth of glioblastoma is inhibited by miR 133 med ......" | 26138587 | Flow cytometry; MTT assay; Luciferase |
hsa-miR-133b | liver cancer | cell cycle pathway; Apoptosis pathway | "Protein phosphatase 2A B55δ enhances chemotherapy ......" | 27074866 | Western blot; Cell proliferation assay; Colony formation; Cell Proliferation Assay; Luciferase |
hsa-miR-133b | lung cancer | Apoptosis pathway | "MicroRNA 133B targets pro survival molecules MCL 1 ......" | 19654003 | |
hsa-miR-133b | lung cancer | Epithelial mesenchymal transition pathway | "MicroRNA miR was implicated in the tumorigenesis o ......" | 26858166 | |
hsa-miR-133b | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 133b inhibits the growth of non small cel ......" | 22883469 | Luciferase |
hsa-miR-133b | ovarian cancer | PI3K/Akt signaling pathway | "MicroRNA 133b inhibits proliferation and invasion ......" | 26617770 | Transwell assay; Western blot; Luciferase |
hsa-miR-133b | prostate cancer | cell cycle pathway; Apoptosis pathway | "Identification of miR 133b and RB1CC1 as independe ......" | 24610824 | Western blot |
hsa-miR-133b | sarcoma | cell cycle pathway | "miRNA expression profile in human osteosarcoma: ro ......" | 23229283 | |
hsa-miR-133b | sarcoma | Apoptosis pathway | "MiR 133b is down regulated in human osteosarcoma a ......" | 24391788 |
Reported cancer prognosis affected by hsa-miR-133b
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-133b | bladder cancer | progression | "Here we profiled the expression of 290 unique huma ......" | 19487295 | |
hsa-miR-133b | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
hsa-miR-133b | bladder cancer | cell migration | "MicroRNA-133a miR-133a and microRNA-133b miR-133b ......" | 23206218 | Western blot; Luciferase; Cell migration assay |
hsa-miR-133b | bladder cancer | drug resistance | "To solve the problem we applied miRNA response ele ......" | 23442927 | Luciferase |
hsa-miR-133b | bladder cancer | motility | "A profile of miRNA expression was determined using ......" | 24966896 | |
hsa-miR-133b | bladder cancer | malignant trasformation | "MiR 133b regulates bladder cancer cell proliferati ......" | 25414595 | Western blot; Flow cytometry; Luciferase |
hsa-miR-133b | cervical and endocervical cancer | metastasis; tumorigenesis; staging; progression | "MicroRNA 133b is a key promoter of cervical carcin ......" | 22179829 | Colony formation |
hsa-miR-133b | colon cancer | metastasis; cell migration | "TAp63 suppress metastasis via miR 133b in colon ca ......" | 24594999 | |
hsa-miR-133b | colorectal cancer | metastasis; poor survival | "miR 185 and miR 133b deregulation is associated wi ......" | 21573504 | |
hsa-miR-133b | colorectal cancer | progression; staging | "miR 133b a muscle specific microRNA is a novel pro ......" | 24330809 | Western blot; Luciferase |
hsa-miR-133b | colorectal cancer | poor survival | "DNA methylation is involved in the aberrant expres ......" | 26622593 | |
hsa-miR-133b | esophageal cancer | metastasis; differentiation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
hsa-miR-133b | gastric cancer | metastasis | "MiR 133b is frequently decreased in gastric cancer ......" | 24443799 | Western blot; Luciferase |
hsa-miR-133b | gastric cancer | progression | "MiR 145 miR 133a and miR 133b inhibit proliferatio ......" | 24613927 | |
hsa-miR-133b | gastric cancer | metastasis; tumor size; worse prognosis; poor survival | "miR 133 is a key negative regulator of CDC42 PAK p ......" | 25152372 | |
hsa-miR-133b | gastric cancer | tumorigenesis; cell migration | "The role of microRNA 133b and its target gene FSCN ......" | 25433493 | Western blot; Luciferase |
hsa-miR-133b | gastric cancer | poor survival | "Impairment of growth of gastric carcinoma by miR 1 ......" | 26076812 | MTT assay; Luciferase |
hsa-miR-133b | gastric cancer | staging | "A total of 305 cases of diagnosed gastric adenocar ......" | 26168960 | |
hsa-miR-133b | gastric cancer | staging; metastasis; differentiation | "Thus the differential expression of a panel of miR ......" | 26171025 | |
hsa-miR-133b | glioblastoma | cell migration | "MicroRNA 133b inhibits cell migration and invasion ......" | 26722242 | Wound Healing Assay; Western blot; Luciferase |
hsa-miR-133b | kidney renal cell cancer | cell migration | "microRNA 133b downregulation and inhibition of cel ......" | 24714873 | Western blot; Luciferase; Cell migration assay |
hsa-miR-133b | liver cancer | cell migration | "Protein phosphatase 2A B55δ enhances chemotherapy ......" | 27074866 | Western blot; Cell proliferation assay; Colony formation; Cell Proliferation Assay; Luciferase |
hsa-miR-133b | lung cancer | poor survival | "MicroRNA 133B targets pro survival molecules MCL 1 ......" | 19654003 | |
hsa-miR-133b | lung cancer | poor survival | "Among many lung cancer related miRNAs miR-133b a t ......" | 21648427 | |
hsa-miR-133b | lung cancer | tumorigenesis | "MicroRNA miR was implicated in the tumorigenesis o ......" | 26858166 | |
hsa-miR-133b | lung squamous cell cancer | staging | "MicroRNA 133b inhibits the growth of non small cel ......" | 22883469 | Luciferase |
hsa-miR-133b | lung squamous cell cancer | metastasis; progression; worse prognosis; staging; poor survival | "Down regulation of microRNA 126 and microRNA 133b ......" | 26823832 | |
hsa-miR-133b | lung squamous cell cancer | drug resistance | "Overexpression of microRNA 133b sensitizes non sma ......" | 27073574 | |
hsa-miR-133b | ovarian cancer | drug resistance | "MicroRNA 133b targets glutathione S transferase π ......" | 26396496 | MTT assay; Western blot; Luciferase |
hsa-miR-133b | prostate cancer | differentiation; motility; cell migration | "microRNA-133 miR-133 has long been recognized as a ......" | 22407299 | Western blot; Luciferase |
hsa-miR-133b | prostate cancer | poor survival | "In this study we performed a series of time-course ......" | 23451058 | |
hsa-miR-133b | prostate cancer | recurrence; progression | "Identification of miR 133b and RB1CC1 as independe ......" | 24610824 | Western blot |
hsa-miR-133b | prostate cancer | progression | "miR 1 and miR 133b are differentially expressed in ......" | 24967583 | |
hsa-miR-133b | prostate cancer | progression | "In addition we revealed a role for muscle-specific ......" | 26375444 | |
hsa-miR-133b | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
hsa-miR-133b | sarcoma | motility | "miRNA expression profile in human osteosarcoma: ro ......" | 23229283 | |
hsa-miR-133b | sarcoma | worse prognosis; metastasis; recurrence; poor survival; progression; tumorigenesis | "Serum levels of microRNA 133b and microRNA 206 exp ......" | 25120799 |
Reported gene related to hsa-miR-133b
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-133b | bladder cancer | EGF | "The first evidence was provided that miR-133a and ......" | 23206218 |
hsa-miR-133b | gastric cancer | EGF | "Moreover the 3'-untranslated region 3'UTR of Her-2 ......" | 26076812 |
hsa-miR-133b | glioblastoma | EGF | "Bioinformatic analysis was performed showing that ......" | 26138587 |
hsa-miR-133b | lung squamous cell cancer | EGF | "MicroRNA 133b inhibits the growth of non small cel ......" | 22883469 |
hsa-miR-133b | ovarian cancer | EGF | "MicroRNA 133b inhibits proliferation and invasion ......" | 26617770 |
hsa-miR-133b | gastric cancer | EGFR | "Moreover the 3'-untranslated region 3'UTR of Her-2 ......" | 26076812 |
hsa-miR-133b | glioblastoma | EGFR | "Growth of glioblastoma is inhibited by miR 133 med ......" | 26138587 |
hsa-miR-133b | lung squamous cell cancer | EGFR | "Here miR-133b was found to be associated with tumo ......" | 22883469 |
hsa-miR-133b | ovarian cancer | EGFR | "Meanwhile luciferase assays were performed to vali ......" | 26617770 |
hsa-miR-133b | prostate cancer | EGFR | "We also provide the first evidence that miR-133 ma ......" | 22407299 |
hsa-miR-133b | bladder cancer | AKT1 | "MiR 133b regulates bladder cancer cell proliferati ......" | 25414595 |
hsa-miR-133b | cervical and endocervical cancer | AKT1 | "MicroRNA 133b is a key promoter of cervical carcin ......" | 22179829 |
hsa-miR-133b | bladder cancer | BCL2L2 | "MiR 133b regulates bladder cancer cell proliferati ......" | 25414595 |
hsa-miR-133b | lung cancer | BCL2L2 | "MicroRNA 133B targets pro survival molecules MCL 1 ......" | 19654003 |
hsa-miR-133b | gastric cancer | GLI1 | "Furthermore Gli1 expression was frequently positiv ......" | 23936094 |
hsa-miR-133b | gastric cancer | GLI1 | "Moreover the transcriptional factor Gli1 was ident ......" | 24443799 |
hsa-miR-133b | lung cancer | MCL1 | "Among many lung cancer related miRNAs miR-133b a t ......" | 21648427 |
hsa-miR-133b | lung cancer | MCL1 | "MicroRNA 133B targets pro survival molecules MCL 1 ......" | 19654003 |
hsa-miR-133b | gastric cancer | PKM | "MiR 133b inhibits growth of human gastric cancer c ......" | 27696637 |
hsa-miR-133b | lung squamous cell cancer | PKM | "Additionally it was observed that pyruvate kinase ......" | 27073574 |
hsa-miR-133b | lung cancer | BCL2 | "To our knowledge this represents the first observa ......" | 19654003 |
hsa-miR-133b | gastric cancer | CDC42 | "miR 133 is a key negative regulator of CDC42 PAK p ......" | 25152372 |
hsa-miR-133b | lung cancer | CDH1 | "Further investigation revealed that this inhibitio ......" | 26858166 |
hsa-miR-133b | colorectal cancer | CXCR4 | "miR 133b a muscle specific microRNA is a novel pro ......" | 24330809 |
hsa-miR-133b | gastric cancer | FGFR1 | "miR 133b acts as a tumor suppressor and negatively ......" | 23296701 |
hsa-miR-133b | lung cancer | FOXQ1 | "We have identified miR-133 as a putative regulator ......" | 26858166 |
hsa-miR-133b | gastric cancer | FSCN1 | "The role of microRNA 133b and its target gene FSCN ......" | 25433493 |
hsa-miR-133b | ovarian cancer | HPGDS | "MicroRNA 133b targets glutathione S transferase π ......" | 26396496 |
hsa-miR-133b | lung cancer | LCT | "Further CCK-8 and transwell assays were performed ......" | 27698898 |
hsa-miR-133b | colorectal cancer | MET | "miR 133b regulates the MET proto oncogene and inhi ......" | 20505319 |
hsa-miR-133b | glioblastoma | MMP14 | "MicroRNA 133b inhibits cell migration and invasion ......" | 26722242 |
hsa-miR-133b | liver cancer | PPP2R2D | "Bioinformatics prediction luciferase reporter assa ......" | 27074866 |
hsa-miR-133b | gastric cancer | PTBP1 | "MiR 133b inhibits growth of human gastric cancer c ......" | 27696637 |
hsa-miR-133b | prostate cancer | RB1CC1 | "Identification of miR 133b and RB1CC1 as independe ......" | 24610824 |
hsa-miR-133b | gastric cancer | REM1 | "miR-133b mimics were overexpressed in GC cell line ......" | 25433493 |
hsa-miR-133b | colorectal cancer | RET | "In the CRC cell lines SW-620 and HT-29 ectopic exp ......" | 20505319 |
hsa-miR-133b | colorectal cancer | TBPL1 | "MiR 133b acts as a tumor suppressor and negatively ......" | 24870791 |
hsa-miR-133b | colorectal cancer | TXK | "In the CRC cell lines SW-620 and HT-29 ectopic exp ......" | 20505319 |
hsa-miR-133b | lung cancer | VIM | "Further investigation revealed that this inhibitio ......" | 26858166 |