microRNA information: hsa-miR-135a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-135a-5p | miRbase |
Accession: | MIMAT0000428 | miRbase |
Precursor name: | hsa-mir-135a-1 | miRbase |
Precursor accession: | MI0000452 | miRbase |
Symbol: | MIR135A1 | HGNC |
RefSeq ID: | NR_029677 | GenBank |
Sequence: | UAUGGCUUUUUAUUCCUAUGUGA |
Reported expression in cancers: hsa-miR-135a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-135a-5p | acute myeloid leukemia | upregulation | "This paper evaluated the association between micro ......" | 25646775 | RNA-Seq |
hsa-miR-135a-5p | breast cancer | upregulation | "Although miR-135a has been implicated in several o ......" | 22439757 | |
hsa-miR-135a-5p | colorectal cancer | upregulation | "Expression of target miRs in micro-dissected paraf ......" | 22120473 | qPCR |
hsa-miR-135a-5p | gastric cancer | downregulation | "MiR-135a has been shown to play a role in Hodgkin ......" | 22310976 | qPCR |
hsa-miR-135a-5p | gastric cancer | downregulation | "Evaluation of miR 29c miR 124 miR 135a and miR 148 ......" | 26885198 | Reverse transcription PCR; qPCR |
hsa-miR-135a-5p | gastric cancer | downregulation | "miR-135a was downregulated in the majority of huma ......" | 27366092 | |
hsa-miR-135a-5p | kidney renal cell cancer | deregulation | "Exploring the miRNA mRNA regulatory network in cle ......" | 24977165 | RNA-Seq |
hsa-miR-135a-5p | liver cancer | upregulation | "We investigated the expression of miR-135a in HCC ......" | 27486383 | |
hsa-miR-135a-5p | lung squamous cell cancer | downregulation | "Abnormal expression of microRNA-135a miR-135a is c ......" | 27525941 | qPCR |
hsa-miR-135a-5p | melanoma | upregulation | "Our study showed that miR-135a is upregulated in m ......" | 26261511 | qPCR |
hsa-miR-135a-5p | ovarian cancer | deregulation | "MiR-135a expression in EOC tissues and controls wa ......" | 24607788 | qPCR |
Reported cancer pathway affected by hsa-miR-135a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-135a-5p | bladder cancer | cell cycle pathway | "Mir 135a enhances cellular proliferation through p ......" | 25888950 | Colony formation; MTT assay; Flow cytometry; Western blot; Luciferase |
hsa-miR-135a-5p | gastric cancer | cell cycle pathway; Apoptosis pathway | "Six of them were randomly selected and miRNA micro ......" | 23328512 | Flow cytometry |
hsa-miR-135a-5p | gastric cancer | Apoptosis pathway | "miR 135a acts as a tumor suppressor in gastric can ......" | 27366092 | Western blot |
hsa-miR-135a-5p | gastric cancer | Apoptosis pathway | "miR 135a promotes gastric cancer progression and r ......" | 27683111 | |
hsa-miR-135a-5p | kidney renal cell cancer | cell cycle pathway | "In a previous study miRNA expression signatures fr ......" | 23176581 | Luciferase |
hsa-miR-135a-5p | lymphoma | Apoptosis pathway | "Patients with low miR-135a expression had a higher ......" | 19666866 | |
hsa-miR-135a-5p | melanoma | cell cycle pathway | "MiR 135 post transcriptionally regulates FOXO1 exp ......" | 26261511 | |
hsa-miR-135a-5p | ovarian cancer | Apoptosis pathway | "Effects of miR 135a on HOXA10 expression prolifera ......" | 24016480 | Western blot; Luciferase; MTT assay |
hsa-miR-135a-5p | ovarian cancer | Apoptosis pathway | "MiR 135a functions as a tumor suppressor in epithe ......" | 24607788 | |
hsa-miR-135a-5p | prostate cancer | cell cycle pathway | "hsa miR 135a 1 inhibits prostate cancer cell growt ......" | 27524492 |
Reported cancer prognosis affected by hsa-miR-135a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-135a-5p | acute myeloid leukemia | poor survival | "High levels of miR-196b and miR-644 were independe ......" | 24072101 | |
hsa-miR-135a-5p | bladder cancer | progression | "Mir 135a enhances cellular proliferation through p ......" | 25888950 | Colony formation; MTT assay; Flow cytometry; Western blot; Luciferase |
hsa-miR-135a-5p | breast cancer | cell migration; metastasis | "Although miR-135a has been implicated in several o ......" | 22439757 | Western blot; Luciferase |
hsa-miR-135a-5p | breast cancer | progression; metastasis | "Targeting of Runx2 by miR 135 and miR 203 Impairs ......" | 25634212 | |
hsa-miR-135a-5p | cervical and endocervical cancer | malignant trasformation | "miR 135a leads to cervical cancer cell transformat ......" | 24503442 | |
hsa-miR-135a-5p | colorectal cancer | metastasis; progression | "Expression of target miRs in micro-dissected paraf ......" | 22120473 | |
hsa-miR-135a-5p | colorectal cancer | metastasis; drug resistance | "MiR 135a promotes growth and invasion of colorecta ......" | 23017832 | Western blot; Transwell assay; Luciferase |
hsa-miR-135a-5p | gastric cancer | malignant trasformation; differentiation | "MiR 135a targets JAK2 and inhibits gastric cancer ......" | 22310976 | Colony formation |
hsa-miR-135a-5p | gastric cancer | staging; metastasis | "Evaluation of miR 29c miR 124 miR 135a and miR 148 ......" | 26885198 | |
hsa-miR-135a-5p | gastric cancer | progression; drug resistance; metastasis; differentiation; poor survival; recurrence | "miR 135a promotes gastric cancer progression and r ......" | 27683111 | |
hsa-miR-135a-5p | liver cancer | tumorigenesis; staging; worse prognosis; poor survival; metastasis | "This study aimed to elucidate the role of miR-135a ......" | 21888875 | |
hsa-miR-135a-5p | lung squamous cell cancer | worse prognosis; staging; metastasis; poor survival | "Abnormal expression of microRNA-135a miR-135a is c ......" | 27525941 | |
hsa-miR-135a-5p | lymphoma | poor survival; worse prognosis | "Patients with low miR-135a expression had a higher ......" | 19666866 | |
hsa-miR-135a-5p | melanoma | malignant trasformation; progression | "MiR 135 post transcriptionally regulates FOXO1 exp ......" | 26261511 | |
hsa-miR-135a-5p | ovarian cancer | poor survival; progression; tumorigenesis; worse prognosis | "MiR 135a functions as a tumor suppressor in epithe ......" | 24607788 | |
hsa-miR-135a-5p | prostate cancer | progression; cell migration | "hsa miR 135a 1 inhibits prostate cancer cell growt ......" | 27524492 |
Reported gene related to hsa-miR-135a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-135a-5p | bladder cancer | FOXO1 | "Mir 135a enhances cellular proliferation through p ......" | 25888950 |
hsa-miR-135a-5p | liver cancer | FOXO1 | "Tumor suppressor FOXO1 was the direct target for m ......" | 27486383 |
hsa-miR-135a-5p | melanoma | FOXO1 | "MiR 135 post transcriptionally regulates FOXO1 exp ......" | 26261511 |
hsa-miR-135a-5p | breast cancer | HOXA10 | "GFP and luciferase reporter plasmids were construc ......" | 22439757 |
hsa-miR-135a-5p | ovarian cancer | HOXA10 | "Effects of miR 135a on HOXA10 expression prolifera ......" | 24016480 |
hsa-miR-135a-5p | ovarian cancer | HOXA10 | "MiR 135a functions as a tumor suppressor in epithe ......" | 24607788 |
hsa-miR-135a-5p | gastric cancer | JAK2 | "MiR 135a targets JAK2 and inhibits gastric cancer ......" | 22310976 |
hsa-miR-135a-5p | lymphoma | JAK2 | "Target analysis showed a direct regulation by miR- ......" | 19666866 |
hsa-miR-135a-5p | colorectal cancer | APC | "Regulation of the adenomatous polyposis coli gene ......" | 18632633 |
hsa-miR-135a-5p | prostate cancer | AR | "We also identified robust induction of miR-135a by ......" | 26364608 |
hsa-miR-135a-5p | ovarian cancer | BCL2 | "After miR-135a mimics transfection the level of bc ......" | 24016480 |
hsa-miR-135a-5p | ovarian cancer | CASP3 | "However after miR-135a inhibitor transfection the ......" | 24016480 |
hsa-miR-135a-5p | cervical and endocervical cancer | CDC37 | "The observed effects were due to the inhibitory ac ......" | 24503442 |
hsa-miR-135a-5p | lung cancer | CDH1 | "In addition the EMT marker E-cadherin or vimentin ......" | 26235874 |
hsa-miR-135a-5p | colorectal cancer | CEACAM5 | "There was no significant correlation between the r ......" | 27126269 |
hsa-miR-135a-5p | lymphoma | CHRDL1 | "Functional analysis of cHL cell lines showed that ......" | 19666866 |
hsa-miR-135a-5p | gastric cancer | E2F1 | "The mechanism whereby miR-135a promotes GC pathoge ......" | 27683111 |
hsa-miR-135a-5p | ovarian cancer | HEY | "Functional analysis of three EOC-derived cell line ......" | 24607788 |
hsa-miR-135a-5p | gastric cancer | KIFC1 | "miR 135a acts as a tumor suppressor in gastric can ......" | 27366092 |
hsa-miR-135a-5p | lung cancer | KLF8 | "MiR 135a inhibits migration and invasion and regul ......" | 26235874 |
hsa-miR-135a-5p | colorectal cancer | MTSS1 | "MiR 135a promotes growth and invasion of colorecta ......" | 23017832 |
hsa-miR-135a-5p | kidney renal cell cancer | MYC | "Moreover based on the results of this analysis we ......" | 23176581 |
hsa-miR-135a-5p | bladder cancer | PHLPP2 | "Mir 135a enhances cellular proliferation through p ......" | 25888950 |
hsa-miR-135a-5p | prostate cancer | ROCK1 | "Through in vitro wound-healing migration and invas ......" | 25065599 |
hsa-miR-135a-5p | prostate cancer | ROCK2 | "Through in vitro wound-healing migration and invas ......" | 25065599 |
hsa-miR-135a-5p | breast cancer | RUNX2 | "Targeting of Runx2 by miR 135 and miR 203 Impairs ......" | 25634212 |
hsa-miR-135a-5p | cervical and endocervical cancer | SIAH1 | "miR 135a leads to cervical cancer cell transformat ......" | 24503442 |
hsa-miR-135a-5p | ovarian cancer | TUBA1B | "These findings suggest that ubiquitous loss of miR ......" | 24607788 |
hsa-miR-135a-5p | lymphoma | TXK | "Target analysis showed a direct regulation by miR- ......" | 19666866 |
hsa-miR-135a-5p | lung cancer | VIM | "In addition the EMT marker E-cadherin or vimentin ......" | 26235874 |
hsa-miR-135a-5p | bladder cancer | VLDLR | "Moreover very low density lipoprotein receptor VLD ......" | 24903309 |
Expression profile in cancer corhorts: