microRNA information: hsa-miR-135b-5p

SectionIDlink
Mature name: hsa-miR-135b-5pmiRbase
Accession: MIMAT0000758miRbase
Precursor name: hsa-mir-135b miRbase
Precursor accession: MI0000810miRbase
Symbol: MIR135BHGNC
RefSeq ID: NR_029893GenBank
Sequence: UAUGGCUUUUCAUUCCUAUGUGA



Reported expression in cancers: hsa-miR-135b-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-135b-5p

breast cancerupregulation"Quantitative reverse transcription polymerase chai ......"26934863Reverse transcription PCR; qPCR
hsa-miR-135b-5p

colon cancerdownregulation"Among the miRNAs demonstrating the largest fold up ......"21694772
hsa-miR-135b-5p

colon cancerupregulation"MicroRNA 135b promotes cancer progression by actin ......"24735923
hsa-miR-135b-5p

colorectal cancerupregulation"Expression of miR 21 miR 31 miR 96 and miR 135b is ......"22844381qPCR
hsa-miR-135b-5p

colorectal cancerupregulation"MiR-135b has been shown to be upregulated in CRC. ......"24343340
hsa-miR-135b-5p

colorectal cancerupregulation"Identification of microRNA 135b in stool as a pote ......"24691020
hsa-miR-135b-5p

endometrial cancerderegulation"A set of EEC-associated miRNAs in tissue and plasm ......"24491411RNA-Seq
hsa-miR-135b-5p

gastric cancerupregulation"Clinicopathological significance and function of m ......"23328512Microarray; qPCR
hsa-miR-135b-5p

gastric cancerupregulation"MicroRNA microarray was applied to assess the miRN ......"24054006Microarray
hsa-miR-135b-5p

glioblastomadownregulation"Notably the average expression level of miR-135b w ......"26437223
hsa-miR-135b-5p

liver cancerupregulation"In this study we screened for the aberrant and fun ......"25537516
hsa-miR-135b-5p

prostate cancerupregulation"A trend of increased expression >40% of miR-135b a ......"18949015qPCR
hsa-miR-135b-5p

prostate cancerdownregulation"In the present study significant downregulation of ......"26870245qPCR
hsa-miR-135b-5p

sarcomaupregulation"Here we demonstrated that compared with noncancero ......"25416447



Reported cancer pathway affected by hsa-miR-135b-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-135b-5p

breast cancercell cycle pathway"miR 135b upregulated in breast cancer promotes cel ......"26934863Colony formation; Cell migration assay; MTT assay; Western blot; Luciferase
hsa-miR-135b-5p

cervical and endocervical cancercell cycle pathway"Down regulation of microRNA 135b inhibited growth ......"26617737MTT assay; Flow cytometry; Western blot; Luciferase
hsa-miR-135b-5p

colon cancerApoptosis pathway"MicroRNA 135b promotes cancer progression by actin ......"24735923
hsa-miR-135b-5p

colorectal cancerApoptosis pathway"miR 135b Promotes Cancer Progression by Targeting ......"26061281
hsa-miR-135b-5p

colorectal cancerApoptosis pathway"MicroRNA 135b regulates apoptosis and chemoresista ......"26101704
hsa-miR-135b-5p

gastric cancercell cycle pathway; Apoptosis pathway"Clinicopathological significance and function of m ......"23328512Flow cytometry; Western blot
hsa-miR-135b-5p

retinoblastomacell cycle pathway"To investigate differential expression of microRNA ......"21941147



Reported cancer prognosis affected by hsa-miR-135b-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-135b-5p

breast cancerprogression; metastasis"Targeting of Runx2 by miR 135 and miR 203 Impairs ......"25634212
hsa-miR-135b-5p

breast cancercell migration; malignant trasformation"miR 135b upregulated in breast cancer promotes cel ......"26934863Colony formation; Cell migration assay; MTT assay; Western blot; Luciferase
hsa-miR-135b-5p

breast cancerpoor survival"In this multicenter study a 10-miRNA classifier in ......"27566954
hsa-miR-135b-5p

colon cancerprogression; staging"MicroRNA 135b promotes cancer progression by actin ......"24735923
hsa-miR-135b-5p

colon cancerstaging"We assessed by qRT-PCR expression of 754 microRNAs ......"27485175
hsa-miR-135b-5p

colorectal cancerstaging; metastasis; progression"Expression of miR 21 miR 31 miR 96 and miR 135b is ......"22844381
hsa-miR-135b-5p

colorectal cancerstaging"Genome-wide microarray analysis of miRNA expressio ......"23673725
hsa-miR-135b-5p

colorectal cancermetastasis; cell migration; progression"MicroRNA 135b regulates metastasis suppressor 1 ex ......"24343340Western blot; Luciferase
hsa-miR-135b-5p

colorectal cancerstaging"Identification of microRNA 135b in stool as a pote ......"24691020
hsa-miR-135b-5p

colorectal cancermetastasis"Expression of miR-15b and miR-135b was significant ......"25557290
hsa-miR-135b-5p

colorectal cancerprogression"miR 135b Promotes Cancer Progression by Targeting ......"26061281
hsa-miR-135b-5p

colorectal cancerdrug resistance"MicroRNA 135b regulates apoptosis and chemoresista ......"26101704
hsa-miR-135b-5p

colorectal cancerworse prognosis"Screening miRNAs for early diagnosis of colorectal ......"27022275
hsa-miR-135b-5p

esophageal cancerpoor survival"miRNAs were labeled and hybridized to the Illumina ......"22939244
hsa-miR-135b-5p

esophageal cancerpoor survival"A large number of miRNAs were differentially expre ......"23477513
hsa-miR-135b-5p

gastric cancerstaging; metastasis; differentiation"Clinicopathological significance and function of m ......"23328512Flow cytometry; Western blot
hsa-miR-135b-5p

gastric cancerworse prognosis"Whole mRNA expression levels were acquired from mi ......"24222951
hsa-miR-135b-5p

gastric cancerpoor survival"Then we further investigated these GC specific miR ......"27173517
hsa-miR-135b-5p

glioblastomadrug resistance"miR 135b contributes to the radioresistance by tar ......"25265336
hsa-miR-135b-5p

glioblastomatumorigenesis; poor survival"miR 135b suppresses tumorigenesis in glioblastoma ......"26437223
hsa-miR-135b-5p

head and neck cancerpoor survival"MicroRNA 135b acts as a tumor promoter by targetin ......"23340180Colony formation
hsa-miR-135b-5p

liver cancerstaging"Gα12gep oncogene inhibits FOXO1 in hepatocellular ......"24631529
hsa-miR-135b-5p

liver cancermetastasis; cell migration; motility"MicroRNA 135b a HSF1 target promotes tumor invasio ......"25537516
hsa-miR-135b-5p

liver cancermetastasis"miR 135b promotes the invasion and metastasis of h ......"26429530Western blot; Luciferase
hsa-miR-135b-5p

lung cancermetastasis"MicroRNA 135b promotes lung cancer metastasis by r ......"23695671
hsa-miR-135b-5p

lung squamous cell cancerdrug resistance"miR 135b reverses chemoresistance of non small cel ......"27643554Luciferase
hsa-miR-135b-5p

lymphomadrug resistance"miR 135b mediates NPM ALK driven oncogenicity and ......"22042699
hsa-miR-135b-5p

melanomamalignant trasformation"MiR 135 post transcriptionally regulates FOXO1 exp ......"26261511
hsa-miR-135b-5p

prostate cancermetastasis; staging"miR 135b inhibits tumour metastasis in prostate ca ......"26870245Western blot; Luciferase
hsa-miR-135b-5p

sarcomamalignant trasformation"MicroRNA 135b promotes proliferation invasion and ......"25190111
hsa-miR-135b-5p

sarcomaworse prognosis; metastasis; staging"miR 135b a key regulator of malignancy is linked t ......"27157622
hsa-miR-135b-5p

thyroid cancertumor size"To detect the levels of miRNA expression in fresh ......"23569392



Reported gene related to hsa-miR-135b-5p

miRNAcancergenereportingPUBMED
hsa-miR-135b-5p

cervical and endocervical cancerFOXO1"Down regulation of microRNA 135b inhibited growth ......"26617737
hsa-miR-135b-5p

endometrial cancerFOXO1"MiR 135b promotes proliferation of endometrial car ......"27222184
hsa-miR-135b-5p

liver cancerFOXO1"Gα12gep oncogene inhibits FOXO1 in hepatocellular ......"24631529
hsa-miR-135b-5p

lymphomaFOXO1"In turn elevated miR-135b targeted FOXO1 in ALCL c ......"22042699
hsa-miR-135b-5p

melanomaFOXO1"MiR 135 post transcriptionally regulates FOXO1 exp ......"26261511
hsa-miR-135b-5p

sarcomaFOXO1"MiR 135b promotes proliferation and invasion of os ......"25416447
hsa-miR-135b-5p

colon cancerAPC"We show that miR-135b overexpression is triggered ......"24735923
hsa-miR-135b-5p

colorectal cancerAPC"Regulation of the adenomatous polyposis coli gene ......"18632633
hsa-miR-135b-5p

gastric cancerAPC"Real-time quantitative PCR and Western blot were u ......"23328512
hsa-miR-135b-5p

breast cancerLATS2"miR 135b upregulated in breast cancer promotes cel ......"26934863
hsa-miR-135b-5p

colorectal cancerLATS2"In elucidating the molecular mechanism by which mi ......"26101704
hsa-miR-135b-5p

colorectal cancerACAD8"In stool samples level of miR-135b was significant ......"24691020
hsa-miR-135b-5p

glioblastomaADAM12"We identified ADAM12 and confirmed SMAD5 and GSK3 ......"26437223
hsa-miR-135b-5p

prostate cancerAR"MicroRNA 135b regulates ERα AR and HIF1AN and aff ......"25907805
hsa-miR-135b-5p

colorectal cancerCASR"miR 135b and miR 146b dependent silencing of calci ......"26178670
hsa-miR-135b-5p

cervical and endocervical cancerCCND1"Besides miR-135b inhibition significantly increase ......"26617737
hsa-miR-135b-5p

prostate cancerESR1"We wanted to further explore the relationship of m ......"25907805
hsa-miR-135b-5p

liver cancerEVI5"The reversion-inducing-cysteine-rich protein with ......"25537516
hsa-miR-135b-5p

lung squamous cell cancerFZD1"miR 135b reverses chemoresistance of non small cel ......"27643554
hsa-miR-135b-5p

glioblastomaGK"MicroRNA 135b exerts oncogenic activity in gliobla ......"25936394
hsa-miR-135b-5p

glioblastomaGK5"It was revealed that GK5 is a target of miR-135b i ......"25936394
hsa-miR-135b-5p

glioblastomaGSC"More importantly miR-135b restoration was able to ......"26437223
hsa-miR-135b-5p

sarcomaHCCS"The expression levels of miR-135b and THBS2 signif ......"27157622
hsa-miR-135b-5p

prostate cancerHIF1AN"MicroRNA 135b regulates ERα AR and HIF1AN and aff ......"25907805
hsa-miR-135b-5p

liver cancerHNF1A"Furthermore we observed that heat shock transcript ......"25537516
hsa-miR-135b-5p

liver cancerHSF1"Furthermore we observed that heat shock transcript ......"25537516
hsa-miR-135b-5p

glioblastomaINSR"In addition clinical data indicated that the expre ......"25265336
hsa-miR-135b-5p

liver cancerJUNB"Gα12QL increased the primary form of miR-135b by ......"24631529
hsa-miR-135b-5p

lymphomaLEMD1"NPM-ALK oncogene strongly promoted the expression ......"22042699
hsa-miR-135b-5p

lung cancerLZTS1"MicroRNA 135b promotes lung cancer metastasis by r ......"23695671
hsa-miR-135b-5p

colorectal cancerMTSS1"MicroRNA 135b regulates metastasis suppressor 1 ex ......"24343340
hsa-miR-135b-5p

colorectal cancerMTUS1"Accordingly some of the overexpressed miRNAs espec ......"26643896
hsa-miR-135b-5p

sarcomaMYOCD"MicroRNA 135b promotes proliferation invasion and ......"25190111
hsa-miR-135b-5p

cervical and endocervical cancerPCNA"Besides miR-135b inhibition significantly increase ......"26617737
hsa-miR-135b-5p

liver cancerRECK"The reversion-inducing-cysteine-rich protein with ......"25537516
hsa-miR-135b-5p

breast cancerRUNX2"Targeting of Runx2 by miR 135 and miR 203 Impairs ......"25634212
hsa-miR-135b-5p

glioblastomaSMAD5"We identified ADAM12 and confirmed SMAD5 and GSK3 ......"26437223
hsa-miR-135b-5p

lymphomaSOAT1"NPM-ALK oncogene strongly promoted the expression ......"22042699
hsa-miR-135b-5p

colon cancerSRC"We show that miR-135b overexpression is triggered ......"24735923
hsa-miR-135b-5p

prostate cancerSTAT6"miR 135b inhibits tumour metastasis in prostate ca ......"26870245
hsa-miR-135b-5p

colorectal cancerTGFBR2"miR 135b Promotes Cancer Progression by Targeting ......"26061281
hsa-miR-135b-5p

sarcomaTHBS2"The expression levels of miR-135b and THBS2 signif ......"27157622



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-135b-5p
NBEA
10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.14; TCGA COAD -0.424; TCGA ESCA -0.344; TCGA HNSC -0.351; TCGA KIRP -0.218; TCGA LUSC -0.094; TCGA PAAD -0.412; TCGA THCA -0.253; TCGA STAD -0.463; TCGA UCEC -0.219
hsa-miR-135b-5p
THRB
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUSC; OV; STAD; UCEC
MirTarget
TCGA BLCA -0.119; TCGA COAD -0.276; TCGA ESCA -0.194; TCGA HNSC -0.302; TCGA KIRP -0.178; TCGA LUSC -0.101; TCGA OV -0.133; TCGA STAD -0.25; TCGA UCEC -0.227
hsa-miR-135b-5p
ZNF135
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.195; TCGA CESC -0.239; TCGA COAD -0.289; TCGA ESCA -0.367; TCGA HNSC -0.343; TCGA KIRC -0.076; TCGA KIRP -0.14; TCGA LUAD -0.112; TCGA PAAD -0.287; TCGA STAD -0.35; TCGA UCEC -0.11
hsa-miR-135b-5p
ANGPTL2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; STAD; UCEC
MirTarget
TCGA BLCA -0.137; TCGA CESC -0.165; TCGA COAD -0.276; TCGA ESCA -0.126; TCGA HNSC -0.236; TCGA KIRC -0.127; TCGA KIRP -0.276; TCGA LUAD -0.095; TCGA OV -0.094; TCGA STAD -0.192; TCGA UCEC -0.071
hsa-miR-135b-5p
NAP1L2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.145; TCGA CESC -0.321; TCGA COAD -0.49; TCGA ESCA -0.551; TCGA HNSC -0.308; TCGA KIRP -0.247; TCGA PAAD -0.572; TCGA THCA -0.113; TCGA STAD -0.541; TCGA UCEC -0.312
hsa-miR-135b-5p
BHLHB9
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.053; TCGA CESC -0.13; TCGA ESCA -0.064; TCGA HNSC -0.114; TCGA KIRP -0.211; TCGA PAAD -0.181; TCGA THCA -0.077; TCGA STAD -0.082; TCGA UCEC -0.079
hsa-miR-135b-5p
JAKMIP2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.174; TCGA CESC -0.155; TCGA COAD -0.329; TCGA ESCA -0.287; TCGA HNSC -0.29; TCGA LUAD -0.141; TCGA LUSC -0.408; TCGA PAAD -0.438; TCGA STAD -0.373; TCGA UCEC -0.084
hsa-miR-135b-5p
ZCCHC24
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.202; TCGA CESC -0.088; TCGA COAD -0.206; TCGA ESCA -0.274; TCGA HNSC -0.324; TCGA KIRP -0.149; TCGA LUSC -0.091; TCGA OV -0.091; TCGA PAAD -0.087; TCGA THCA -0.063; TCGA STAD -0.305; TCGA UCEC -0.26
hsa-miR-135b-5p
RGL1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.113; TCGA CESC -0.179; TCGA COAD -0.17; TCGA ESCA -0.139; TCGA HNSC -0.123; TCGA KIRC -0.126; TCGA KIRP -0.196; TCGA LUSC -0.068; TCGA PAAD -0.279; TCGA STAD -0.19; TCGA UCEC -0.109
hsa-miR-135b-5p
SLC9A9
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.13; TCGA CESC -0.354; TCGA COAD -0.389; TCGA ESCA -0.358; TCGA HNSC -0.153; TCGA LUSC -0.141; TCGA PAAD -0.317; TCGA THCA -0.215; TCGA STAD -0.302; TCGA UCEC -0.218
hsa-miR-135b-5p
PDE8B
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.118; TCGA CESC -0.139; TCGA COAD -0.286; TCGA ESCA -0.135; TCGA HNSC -0.148; TCGA KIRP -0.269; TCGA LUSC -0.102; TCGA PAAD -0.308; TCGA THCA -0.346; TCGA STAD -0.273; TCGA UCEC -0.287
hsa-miR-135b-5p
PKHD1L1
10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.263; TCGA COAD -0.513; TCGA ESCA -0.356; TCGA HNSC -0.368; TCGA LUAD -0.215; TCGA LUSC -0.371; TCGA PAAD -0.602; TCGA THCA -1.324; TCGA STAD -0.475; TCGA UCEC -0.407
hsa-miR-135b-5p
GRK5
10 cancers: BLCA; CESC; KIRC; KIRP; LUAD; LUSC; OV; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.083; TCGA CESC -0.097; TCGA KIRC -0.12; TCGA KIRP -0.112; TCGA LUAD -0.143; TCGA LUSC -0.131; TCGA OV -0.113; TCGA THCA -0.21; TCGA STAD -0.088; TCGA UCEC -0.219
hsa-miR-135b-5p
ARHGEF6
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.087; TCGA CESC -0.14; TCGA COAD -0.358; TCGA ESCA -0.202; TCGA HNSC -0.269; TCGA KIRC -0.076; TCGA KIRP -0.188; TCGA LUSC -0.169; TCGA PAAD -0.243; TCGA THCA -0.177; TCGA STAD -0.229; TCGA UCEC -0.202
hsa-miR-135b-5p
ZNF385B
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.141; TCGA CESC -0.324; TCGA COAD -0.485; TCGA ESCA -0.527; TCGA HNSC -0.4; TCGA KIRC -0.188; TCGA KIRP -0.366; TCGA OV -0.269; TCGA PAAD -0.214; TCGA STAD -0.395; TCGA UCEC -0.139
hsa-miR-135b-5p
DLG2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.288; TCGA CESC -0.427; TCGA COAD -0.407; TCGA ESCA -0.43; TCGA HNSC -0.458; TCGA KIRP -0.212; TCGA LUAD -0.098; TCGA PAAD -0.471; TCGA THCA -0.481; TCGA STAD -0.458; TCGA UCEC -0.312
hsa-miR-135b-5p
SLC8A1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.187; TCGA CESC -0.121; TCGA COAD -0.262; TCGA ESCA -0.18; TCGA HNSC -0.204; TCGA KIRP -0.341; TCGA LUAD -0.083; TCGA PAAD -0.398; TCGA THCA -0.119; TCGA STAD -0.267; TCGA UCEC -0.159
hsa-miR-135b-5p
ARHGAP6
10 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.125; TCGA CESC -0.168; TCGA COAD -0.151; TCGA HNSC -0.389; TCGA KIRP -0.191; TCGA LUAD -0.073; TCGA LUSC -0.193; TCGA THCA -0.214; TCGA STAD -0.202; TCGA UCEC -0.293
hsa-miR-135b-5p
MAPRE2
10 cancers: BLCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.086; TCGA HNSC -0.185; TCGA KIRC -0.142; TCGA KIRP -0.263; TCGA LUSC -0.085; TCGA OV -0.096; TCGA PAAD -0.144; TCGA THCA -0.295; TCGA STAD -0.055; TCGA UCEC -0.068
hsa-miR-135b-5p
WSCD2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.235; TCGA CESC -0.297; TCGA COAD -0.504; TCGA ESCA -0.712; TCGA HNSC -0.561; TCGA KIRP -0.375; TCGA OV -0.319; TCGA PAAD -0.217; TCGA THCA -1.291; TCGA STAD -0.593; TCGA UCEC -0.325
hsa-miR-135b-5p
GPR155
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.129; TCGA CESC -0.153; TCGA ESCA -0.374; TCGA HNSC -0.156; TCGA KIRP -0.379; TCGA LUAD -0.079; TCGA LUSC -0.066; TCGA PAAD -0.256; TCGA THCA -0.378; TCGA STAD -0.282
hsa-miR-135b-5p
DIP2C
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.084; TCGA COAD -0.199; TCGA ESCA -0.104; TCGA HNSC -0.164; TCGA KIRC -0.16; TCGA KIRP -0.213; TCGA PAAD -0.122; TCGA THCA -0.321; TCGA STAD -0.195; TCGA UCEC -0.084
hsa-miR-135b-5p
MYOCD
9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.414; TCGA CESC -0.341; TCGA COAD -0.54; TCGA ESCA -0.451; TCGA KIRP -0.408; TCGA LUSC -0.321; TCGA PAAD -0.299; TCGA STAD -0.517; TCGA UCEC -0.599
hsa-miR-135b-5p
BSN
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD
MirTarget
TCGA BLCA -0.112; TCGA COAD -0.139; TCGA ESCA -0.145; TCGA HNSC -0.167; TCGA KIRP -0.112; TCGA LUAD -0.106; TCGA LUSC -0.143; TCGA PAAD -0.508; TCGA STAD -0.145
hsa-miR-135b-5p
KCNQ5
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.242; TCGA CESC -0.393; TCGA COAD -0.368; TCGA ESCA -0.525; TCGA KIRC -0.218; TCGA OV -0.307; TCGA PAAD -0.322; TCGA THCA -0.287; TCGA STAD -0.427; TCGA UCEC -0.172
hsa-miR-135b-5p
PSIP1
11 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.071; TCGA CESC -0.079; TCGA COAD -0.061; TCGA ESCA -0.106; TCGA KIRP -0.067; TCGA LUAD -0.133; TCGA LUSC -0.119; TCGA OV -0.078; TCGA PAAD -0.238; TCGA STAD -0.09; TCGA UCEC -0.074
hsa-miR-135b-5p
MEF2C
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.181; TCGA CESC -0.175; TCGA COAD -0.283; TCGA ESCA -0.159; TCGA HNSC -0.444; TCGA KIRC -0.112; TCGA KIRP -0.134; TCGA LUSC -0.153; TCGA PAAD -0.238; TCGA THCA -0.168; TCGA STAD -0.232; TCGA UCEC -0.23
hsa-miR-135b-5p
ADCYAP1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.326; TCGA CESC -0.184; TCGA COAD -0.5; TCGA ESCA -0.369; TCGA HNSC -0.183; TCGA KIRP -0.196; TCGA PAAD -0.596; TCGA STAD -0.522; TCGA UCEC -0.252
hsa-miR-135b-5p
MAN1A1
11 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.184; TCGA COAD -0.193; TCGA HNSC -0.247; TCGA KIRP -0.334; TCGA LUAD -0.131; TCGA LUSC -0.092; TCGA OV -0.175; TCGA PAAD -0.388; TCGA THCA -0.169; TCGA STAD -0.101; TCGA UCEC -0.154
hsa-miR-135b-5p
SH2D3C
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.104; TCGA CESC -0.131; TCGA COAD -0.224; TCGA ESCA -0.149; TCGA KIRC -0.146; TCGA KIRP -0.139; TCGA LUSC -0.156; TCGA PAAD -0.25; TCGA THCA -0.161; TCGA STAD -0.105; TCGA UCEC -0.148
hsa-miR-135b-5p
RAB33B
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.056; TCGA CESC -0.07; TCGA ESCA -0.053; TCGA HNSC -0.057; TCGA KIRP -0.056; TCGA LUSC -0.122; TCGA PAAD -0.066; TCGA STAD -0.066; TCGA UCEC -0.132
hsa-miR-135b-5p
FOXN3
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.097; TCGA CESC -0.154; TCGA COAD -0.172; TCGA ESCA -0.186; TCGA HNSC -0.192; TCGA KIRC -0.105; TCGA KIRP -0.207; TCGA LUSC -0.119; TCGA OV -0.114; TCGA PAAD -0.15; TCGA THCA -0.068; TCGA STAD -0.203; TCGA UCEC -0.211
hsa-miR-135b-5p
FGFR1
10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.256; TCGA COAD -0.283; TCGA ESCA -0.24; TCGA HNSC -0.282; TCGA LUAD -0.142; TCGA LUSC -0.118; TCGA PAAD -0.24; TCGA THCA -0.085; TCGA STAD -0.245; TCGA UCEC -0.072
hsa-miR-135b-5p
TNS1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.259; TCGA CESC -0.111; TCGA COAD -0.372; TCGA ESCA -0.392; TCGA HNSC -0.367; TCGA KIRC -0.151; TCGA KIRP -0.239; TCGA LUSC -0.215; TCGA PAAD -0.143; TCGA THCA -0.201; TCGA STAD -0.395; TCGA UCEC -0.212
hsa-miR-135b-5p
FKBP5
9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.117; TCGA CESC -0.1; TCGA COAD -0.196; TCGA ESCA -0.271; TCGA KIRP -0.165; TCGA LUAD -0.112; TCGA PAAD -0.295; TCGA STAD -0.25; TCGA UCEC -0.084
hsa-miR-135b-5p
TBL1X
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.063; TCGA CESC -0.08; TCGA ESCA -0.088; TCGA HNSC -0.105; TCGA KIRC -0.06; TCGA KIRP -0.165; TCGA LUSC -0.07; TCGA PAAD -0.176; TCGA THCA -0.064; TCGA STAD -0.065; TCGA UCEC -0.137
hsa-miR-135b-5p
ASPA
10 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.297; TCGA COAD -0.474; TCGA ESCA -0.494; TCGA KIRC -0.198; TCGA KIRP -0.27; TCGA LUSC -0.175; TCGA PAAD -0.33; TCGA THCA -0.384; TCGA STAD -0.384; TCGA UCEC -0.4
hsa-miR-135b-5p
SLC1A2
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.182; TCGA COAD -0.211; TCGA ESCA -0.229; TCGA HNSC -0.127; TCGA KIRP -0.169; TCGA PAAD -0.369; TCGA THCA -0.481; TCGA STAD -0.219; TCGA UCEC -0.083
hsa-miR-135b-5p
IGFBP5
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; STAD; UCEC
mirMAP
TCGA BLCA -0.161; TCGA CESC -0.306; TCGA COAD -0.345; TCGA ESCA -0.261; TCGA HNSC -0.451; TCGA KIRP -0.347; TCGA LUAD -0.118; TCGA STAD -0.253; TCGA UCEC -0.258
hsa-miR-135b-5p
AKAP12
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.26; TCGA COAD -0.272; TCGA ESCA -0.242; TCGA HNSC -0.428; TCGA LUAD -0.267; TCGA LUSC -0.178; TCGA PAAD -0.15; TCGA THCA -0.332; TCGA STAD -0.345
hsa-miR-135b-5p
ENTPD1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.111; TCGA CESC -0.085; TCGA COAD -0.191; TCGA ESCA -0.064; TCGA HNSC -0.086; TCGA KIRC -0.079; TCGA LUSC -0.072; TCGA PAAD -0.088; TCGA STAD -0.115; TCGA UCEC -0.091
hsa-miR-135b-5p
ACVRL1
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.108; TCGA COAD -0.096; TCGA ESCA -0.08; TCGA HNSC -0.205; TCGA KIRC -0.076; TCGA LUAD -0.099; TCGA LUSC -0.166; TCGA PAAD -0.127; TCGA THCA -0.205; TCGA STAD -0.067; TCGA UCEC -0.111
hsa-miR-135b-5p
NTRK3
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.382; TCGA CESC -0.317; TCGA COAD -0.416; TCGA ESCA -0.379; TCGA HNSC -0.453; TCGA KIRP -0.216; TCGA PAAD -0.231; TCGA STAD -0.463; TCGA UCEC -0.324
hsa-miR-135b-5p
NFIC
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.06; TCGA CESC -0.157; TCGA COAD -0.188; TCGA ESCA -0.185; TCGA HNSC -0.259; TCGA KIRC -0.063; TCGA KIRP -0.282; TCGA LUSC -0.095; TCGA PAAD -0.132; TCGA STAD -0.145; TCGA UCEC -0.127
hsa-miR-135b-5p
GFRA1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.298; TCGA CESC -0.326; TCGA COAD -0.541; TCGA ESCA -0.435; TCGA HNSC -0.615; TCGA LUSC -0.219; TCGA PAAD -0.354; TCGA THCA -0.598; TCGA STAD -0.597
hsa-miR-135b-5p
MMP16
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.092; TCGA CESC -0.159; TCGA COAD -0.306; TCGA HNSC -0.33; TCGA KIRC -0.148; TCGA OV -0.147; TCGA PAAD -0.233; TCGA STAD -0.222; TCGA UCEC -0.122
hsa-miR-135b-5p
PTCHD1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.544; TCGA CESC -0.2; TCGA COAD -0.416; TCGA ESCA -0.396; TCGA HNSC -0.292; TCGA LUSC -0.221; TCGA OV -0.311; TCGA PAAD -0.219; TCGA STAD -0.623; TCGA UCEC -0.223
hsa-miR-135b-5p
FAT3
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.35; TCGA CESC -0.289; TCGA COAD -0.302; TCGA ESCA -0.493; TCGA HNSC -0.229; TCGA KIRP -0.483; TCGA LUAD -0.235; TCGA PAAD -0.136; TCGA STAD -0.535; TCGA UCEC -0.142
hsa-miR-135b-5p
TUB
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.207; TCGA CESC -0.365; TCGA COAD -0.311; TCGA ESCA -0.52; TCGA HNSC -0.352; TCGA KIRC -0.205; TCGA KIRP -0.335; TCGA LUSC -0.147; TCGA PAAD -0.335; TCGA THCA -0.135; TCGA STAD -0.365; TCGA UCEC -0.312
hsa-miR-135b-5p
PRTG
10 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.283; TCGA COAD -0.38; TCGA HNSC -0.322; TCGA KIRP -0.184; TCGA LUAD -0.143; TCGA LUSC -0.165; TCGA PAAD -0.15; TCGA THCA -0.357; TCGA STAD -0.241; TCGA UCEC -0.121
hsa-miR-135b-5p
SHE
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.176; TCGA COAD -0.36; TCGA ESCA -0.204; TCGA HNSC -0.283; TCGA KIRC -0.11; TCGA KIRP -0.262; TCGA LUSC -0.202; TCGA PAAD -0.317; TCGA STAD -0.225; TCGA UCEC -0.25
hsa-miR-135b-5p
SIK2
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.053; TCGA ESCA -0.093; TCGA HNSC -0.109; TCGA KIRC -0.062; TCGA KIRP -0.168; TCGA LUAD -0.086; TCGA LUSC -0.055; TCGA PAAD -0.109; TCGA THCA -0.062; TCGA STAD -0.08
hsa-miR-135b-5p
LONRF2
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.442; TCGA COAD -0.539; TCGA ESCA -0.385; TCGA HNSC -0.562; TCGA KIRP -0.179; TCGA LUSC -0.178; TCGA PAAD -0.266; TCGA STAD -0.401; TCGA UCEC -0.223
hsa-miR-135b-5p
GJC1
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; OV; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.099; TCGA CESC -0.197; TCGA COAD -0.239; TCGA ESCA -0.129; TCGA KIRC -0.199; TCGA LUAD -0.125; TCGA OV -0.187; TCGA PAAD -0.168; TCGA THCA -0.195; TCGA STAD -0.232; TCGA UCEC -0.258
hsa-miR-135b-5p
SLIT3
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.259; TCGA CESC -0.176; TCGA COAD -0.415; TCGA ESCA -0.317; TCGA HNSC -0.308; TCGA KIRP -0.277; TCGA LUSC -0.168; TCGA PAAD -0.342; TCGA STAD -0.29; TCGA UCEC -0.07
hsa-miR-135b-5p
VGLL3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.239; TCGA CESC -0.177; TCGA COAD -0.338; TCGA ESCA -0.216; TCGA HNSC -0.354; TCGA LUAD -0.163; TCGA LUSC -0.144; TCGA OV -0.222; TCGA THCA -0.206; TCGA STAD -0.225; TCGA UCEC -0.371
hsa-miR-135b-5p
C17orf51
9 cancers: BLCA; ESCA; KIRP; LUAD; OV; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.091; TCGA ESCA -0.124; TCGA KIRP -0.101; TCGA LUAD -0.091; TCGA OV -0.072; TCGA PAAD -0.339; TCGA THCA -0.208; TCGA STAD -0.171; TCGA UCEC -0.131
hsa-miR-135b-5p
PLEKHO2
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD
mirMAP
TCGA BLCA -0.081; TCGA CESC -0.054; TCGA COAD -0.189; TCGA ESCA -0.121; TCGA HNSC -0.077; TCGA KIRC -0.071; TCGA LUAD -0.08; TCGA PAAD -0.061; TCGA STAD -0.123
hsa-miR-135b-5p
PTPRD
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.288; TCGA CESC -0.181; TCGA COAD -0.353; TCGA ESCA -0.266; TCGA HNSC -0.419; TCGA LUSC -0.249; TCGA PAAD -0.287; TCGA STAD -0.232; TCGA UCEC -0.244
hsa-miR-135b-5p
SETBP1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.078; TCGA CESC -0.141; TCGA COAD -0.371; TCGA ESCA -0.349; TCGA HNSC -0.118; TCGA KIRP -0.142; TCGA PAAD -0.382; TCGA THCA -0.123; TCGA STAD -0.374; TCGA UCEC -0.158
hsa-miR-135b-5p
MRAS
11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.18; TCGA COAD -0.273; TCGA ESCA -0.207; TCGA HNSC -0.302; TCGA LUAD -0.127; TCGA LUSC -0.093; TCGA OV -0.146; TCGA PAAD -0.121; TCGA THCA -0.087; TCGA STAD -0.212; TCGA UCEC -0.084
hsa-miR-135b-5p
PCYT1B
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.158; TCGA CESC -0.324; TCGA COAD -0.207; TCGA ESCA -0.413; TCGA HNSC -0.294; TCGA LUAD -0.147; TCGA LUSC -0.171; TCGA PAAD -0.243; TCGA STAD -0.288; TCGA UCEC -0.128
hsa-miR-135b-5p
ROR1
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.104; TCGA CESC -0.179; TCGA COAD -0.277; TCGA HNSC -0.353; TCGA KIRC -0.135; TCGA KIRP -0.317; TCGA LUAD -0.081; TCGA LUSC -0.142; TCGA PAAD -0.166; TCGA STAD -0.165; TCGA UCEC -0.202
hsa-miR-135b-5p
MAFB
9 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; THCA; STAD
miRNAWalker2 validate
TCGA CESC -0.206; TCGA COAD -0.287; TCGA ESCA -0.195; TCGA HNSC -0.089; TCGA KIRP -0.115; TCGA LUAD -0.069; TCGA PAAD -0.348; TCGA THCA -0.284; TCGA STAD -0.127
hsa-miR-135b-5p
APC
9 cancers: CESC; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
miRTarBase; MirTarget
TCGA CESC -0.069; TCGA HNSC -0.101; TCGA KIRC -0.069; TCGA KIRP -0.216; TCGA LUSC -0.086; TCGA PAAD -0.153; TCGA THCA -0.154; TCGA STAD -0.098; TCGA UCEC -0.066
hsa-miR-135b-5p
STX12
9 cancers: CESC; ESCA; HNSC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.073; TCGA ESCA -0.081; TCGA HNSC -0.059; TCGA KIRP -0.088; TCGA LUSC -0.087; TCGA PAAD -0.088; TCGA THCA -0.083; TCGA STAD -0.059; TCGA UCEC -0.096
hsa-miR-135b-5p
SETD7
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget; mirMAP
TCGA CESC -0.062; TCGA COAD -0.063; TCGA ESCA -0.068; TCGA HNSC -0.182; TCGA KIRC -0.071; TCGA KIRP -0.137; TCGA LUSC -0.106; TCGA PAAD -0.077; TCGA THCA -0.118; TCGA STAD -0.153; TCGA UCEC -0.218
hsa-miR-135b-5p
PPM1F
10 cancers: CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.089; TCGA COAD -0.083; TCGA ESCA -0.06; TCGA KIRC -0.139; TCGA KIRP -0.076; TCGA LUAD -0.086; TCGA PAAD -0.087; TCGA THCA -0.065; TCGA STAD -0.072; TCGA UCEC -0.096
hsa-miR-135b-5p
LANCL1
9 cancers: CESC; ESCA; HNSC; KIRP; LUAD; PAAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.093; TCGA ESCA -0.091; TCGA HNSC -0.083; TCGA KIRP -0.158; TCGA LUAD -0.092; TCGA PAAD -0.053; TCGA THCA -0.088; TCGA STAD -0.057; TCGA UCEC -0.073
hsa-miR-135b-5p
VLDLR
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA CESC -0.224; TCGA COAD -0.299; TCGA ESCA -0.179; TCGA HNSC -0.103; TCGA KIRC -0.143; TCGA KIRP -0.173; TCGA LUAD -0.07; TCGA LUSC -0.083; TCGA PAAD -0.255; TCGA THCA -0.437; TCGA STAD -0.307
hsa-miR-135b-5p
FOXO1
10 cancers: CESC; COAD; ESCA; HNSC; KIRP; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.085; TCGA COAD -0.074; TCGA ESCA -0.066; TCGA HNSC -0.138; TCGA KIRP -0.107; TCGA OV -0.08; TCGA PAAD -0.147; TCGA THCA -0.144; TCGA STAD -0.075; TCGA UCEC -0.088
hsa-miR-135b-5p
SCN2A
9 cancers: CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA CESC -0.32; TCGA ESCA -0.277; TCGA HNSC -0.272; TCGA KIRP -0.195; TCGA LUAD -0.16; TCGA LUSC -0.228; TCGA PAAD -0.157; TCGA STAD -0.148; TCGA UCEC -0.209
hsa-miR-135b-5p
MTSS1
9 cancers: CESC; COAD; ESCA; KIRC; KIRP; PAAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.241; TCGA COAD -0.102; TCGA ESCA -0.21; TCGA KIRC -0.068; TCGA KIRP -0.238; TCGA PAAD -0.148; TCGA THCA -0.157; TCGA STAD -0.174; TCGA UCEC -0.06
hsa-miR-135b-5p
SNX29
10 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; THCA; STAD; UCEC
mirMAP
TCGA CESC -0.057; TCGA COAD -0.072; TCGA ESCA -0.106; TCGA HNSC -0.059; TCGA KIRC -0.104; TCGA KIRP -0.099; TCGA PAAD -0.167; TCGA THCA -0.2; TCGA STAD -0.144; TCGA UCEC -0.062
hsa-miR-135b-5p
NDST1
10 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; THCA; STAD
mirMAP
TCGA CESC -0.09; TCGA COAD -0.089; TCGA ESCA -0.088; TCGA HNSC -0.08; TCGA KIRC -0.081; TCGA KIRP -0.153; TCGA LUAD -0.06; TCGA PAAD -0.226; TCGA THCA -0.083; TCGA STAD -0.059
hsa-miR-135b-5p
KATNAL1
10 cancers: CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA CESC -0.073; TCGA COAD -0.091; TCGA ESCA -0.161; TCGA HNSC -0.083; TCGA LUAD -0.078; TCGA LUSC -0.057; TCGA OV -0.108; TCGA PAAD -0.199; TCGA STAD -0.215; TCGA UCEC -0.129
hsa-miR-135b-5p
RAPGEF1
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA CESC -0.053; TCGA COAD -0.089; TCGA ESCA -0.083; TCGA HNSC -0.079; TCGA KIRC -0.134; TCGA KIRP -0.111; TCGA LUAD -0.088; TCGA LUSC -0.079; TCGA PAAD -0.105; TCGA THCA -0.117; TCGA STAD -0.067
hsa-miR-135b-5p
MDGA1
9 cancers: CESC; COAD; ESCA; KIRP; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA CESC -0.205; TCGA COAD -0.291; TCGA ESCA -0.397; TCGA KIRP -0.176; TCGA LUSC -0.256; TCGA PAAD -0.24; TCGA THCA -0.192; TCGA STAD -0.224; TCGA UCEC -0.141
hsa-miR-135b-5p
ZHX3
10 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA CESC -0.088; TCGA COAD -0.107; TCGA ESCA -0.139; TCGA HNSC -0.131; TCGA KIRP -0.076; TCGA LUAD -0.062; TCGA LUSC -0.072; TCGA PAAD -0.247; TCGA THCA -0.099; TCGA STAD -0.145
hsa-miR-135b-5p
ROCK1
10 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA COAD -0.085; TCGA ESCA -0.077; TCGA HNSC -0.089; TCGA KIRC -0.051; TCGA KIRP -0.136; TCGA LUAD -0.104; TCGA LUSC -0.119; TCGA PAAD -0.057; TCGA STAD -0.077; TCGA UCEC -0.068
hsa-miR-135b-5p
SLC31A2
9 cancers: COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; UCEC
MirTarget
TCGA COAD -0.171; TCGA ESCA -0.089; TCGA KIRC -0.11; TCGA KIRP -0.136; TCGA LUAD -0.121; TCGA LUSC -0.071; TCGA PAAD -0.152; TCGA THCA -0.146; TCGA UCEC -0.056
hsa-miR-135b-5p
SNTA1
10 cancers: COAD; ESCA; HNSC; KIRC; KIRP; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA COAD -0.139; TCGA ESCA -0.166; TCGA HNSC -0.141; TCGA KIRC -0.127; TCGA KIRP -0.274; TCGA OV -0.163; TCGA PAAD -0.145; TCGA THCA -0.318; TCGA STAD -0.217; TCGA UCEC -0.092
hsa-miR-135b-5p
DPP8
9 cancers: COAD; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA COAD -0.091; TCGA HNSC -0.15; TCGA KIRP -0.242; TCGA LUAD -0.082; TCGA LUSC -0.06; TCGA PAAD -0.099; TCGA THCA -0.171; TCGA STAD -0.055; TCGA UCEC -0.071
hsa-miR-135b-5p
IL6ST
9 cancers: COAD; ESCA; HNSC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA COAD -0.272; TCGA ESCA -0.115; TCGA HNSC -0.34; TCGA KIRP -0.475; TCGA LUSC -0.155; TCGA PAAD -0.288; TCGA THCA -0.213; TCGA STAD -0.169; TCGA UCEC -0.196





Enriched cancer pathways of putative targets