microRNA information: hsa-miR-136-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-136-3p | miRbase |
| Accession: | MIMAT0004606 | miRbase |
| Precursor name: | hsa-mir-136 | miRbase |
| Precursor accession: | MI0000475 | miRbase |
| Symbol: | MIR136 | HGNC |
| RefSeq ID: | NR_029699 | GenBank |
| Sequence: | CAUCAUCGUCUCAAAUGAGUCU |
Reported expression in cancers: hsa-miR-136-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-136-3p | breast cancer | downregulation | "Herein we demonstrate that miR-136 is an anti-inva ......" | 27108696 | |
| hsa-miR-136-3p | lung squamous cell cancer | upregulation | "However the roles of miR-136 in NSCLC are still la ......" | 23959478 | |
| hsa-miR-136-3p | ovarian cancer | downregulation | "Expression of miR 136 is associated with the prima ......" | 25482209 |
Reported cancer pathway affected by hsa-miR-136-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-136-3p | ovarian cancer | Apoptosis pathway | "Expression of miR 136 is associated with the prima ......" | 25482209 |
Reported cancer prognosis affected by hsa-miR-136-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-136-3p | breast cancer | metastasis | "miR 136 suppresses tumor invasion and metastasis b ......" | 27108696 | |
| hsa-miR-136-3p | lung cancer | malignant trasformation | "Here we sought to comprehensively identify the miR ......" | 20237410 | |
| hsa-miR-136-3p | lung cancer | metastasis; malignant trasformation | "Targeting Smad2 and Smad3 by miR 136 suppresses me ......" | 25198664 | |
| hsa-miR-136-3p | ovarian cancer | drug resistance; poor survival | "Expression of miR 136 is associated with the prima ......" | 25482209 |
Reported gene related to hsa-miR-136-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-136-3p | thyroid cancer | ADAM9 | "Of these 14 genes SLC7A5 and ADAM9 were confirmed ......" | 26244545 |
| hsa-miR-136-3p | ovarian cancer | CLDN11 | "Furthermore the levels of adducts corrected with t ......" | 25482209 |
| hsa-miR-136-3p | lung squamous cell cancer | PPP2R2A | "Upregulation of miR 136 in human non small cell lu ......" | 23959478 |
| hsa-miR-136-3p | breast cancer | RASAL2 | "miR 136 suppresses tumor invasion and metastasis b ......" | 27108696 |
| hsa-miR-136-3p | thyroid cancer | SLC7A5 | "Of these 14 genes SLC7A5 and ADAM9 were confirmed ......" | 26244545 |
| hsa-miR-136-3p | ovarian cancer | ST8 | "We found that miR-136 expression was significantly ......" | 25482209 |
| hsa-miR-136-3p | ovarian cancer | SUPT20H | "However in the platinum-resistant C13 cell line th ......" | 25482209 |
Expression profile in cancer corhorts:
