microRNA information: hsa-miR-136-5p

SectionIDlink
Mature name: hsa-miR-136-5pmiRbase
Accession: MIMAT0000448miRbase
Precursor name: hsa-mir-136 miRbase
Precursor accession: MI0000475miRbase
Symbol: MIR136HGNC
RefSeq ID: NR_029699GenBank
Sequence: ACUCCAUUUGUUUUGAUGAUGGA



Reported expression in cancers: hsa-miR-136-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-136-5p

breast cancerdownregulation"Herein we demonstrate that miR-136 is an anti-inva ......"27108696
hsa-miR-136-5p

lung squamous cell cancerupregulation"However the roles of miR-136 in NSCLC are still la ......"23959478
hsa-miR-136-5p

ovarian cancerdownregulation"Expression of miR 136 is associated with the prima ......"25482209



Reported cancer pathway affected by hsa-miR-136-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-136-5p

ovarian cancerApoptosis pathway"Expression of miR 136 is associated with the prima ......"25482209



Reported cancer prognosis affected by hsa-miR-136-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-136-5p

breast cancermetastasis"miR 136 suppresses tumor invasion and metastasis b ......"27108696
hsa-miR-136-5p

lung cancermalignant trasformation"Here we sought to comprehensively identify the miR ......"20237410
hsa-miR-136-5p

lung cancermetastasis; malignant trasformation"Targeting Smad2 and Smad3 by miR 136 suppresses me ......"25198664
hsa-miR-136-5p

ovarian cancerdrug resistance; poor survival"Expression of miR 136 is associated with the prima ......"25482209



Reported gene related to hsa-miR-136-5p

miRNAcancergenereportingPUBMED
hsa-miR-136-5p

ovarian cancerCLDN11"Furthermore the levels of adducts corrected with t ......"25482209
hsa-miR-136-5p

lung squamous cell cancerPPP2R2A"Upregulation of miR 136 in human non small cell lu ......"23959478
hsa-miR-136-5p

breast cancerRASAL2"miR 136 suppresses tumor invasion and metastasis b ......"27108696
hsa-miR-136-5p

ovarian cancerST8"We found that miR-136 expression was significantly ......"25482209
hsa-miR-136-5p

ovarian cancerSUPT20H"However in the platinum-resistant C13 cell line th ......"25482209



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-136-5p
ESYT2
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUSC; PAAD; SARC; STAD
MirTarget
TCGA BLCA -0.051; TCGA CESC -0.054; TCGA COAD -0.066; TCGA KIRC -0.061; TCGA KIRP -0.071; TCGA LUSC -0.077; TCGA PAAD -0.078; TCGA SARC -0.125; TCGA STAD -0.099
hsa-miR-136-5p
PPARGC1A
9 cancers: BLCA; COAD; ESCA; KIRP; LUAD; LUSC; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.322; TCGA COAD -0.222; TCGA ESCA -0.424; TCGA KIRP -0.092; TCGA LUAD -0.183; TCGA LUSC -0.243; TCGA SARC -0.351; TCGA THCA -0.107; TCGA STAD -0.349
hsa-miR-136-5p
DIAPH2
9 cancers: BLCA; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.111; TCGA ESCA -0.129; TCGA KIRC -0.059; TCGA LGG -0.14; TCGA LUAD -0.13; TCGA LUSC -0.175; TCGA PAAD -0.173; TCGA SARC -0.087; TCGA STAD -0.118
hsa-miR-136-5p
CPEB2
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.208; TCGA BRCA -0.091; TCGA COAD -0.102; TCGA KIRC -0.162; TCGA LIHC -0.051; TCGA LUAD -0.055; TCGA PRAD -0.067; TCGA SARC -0.117; TCGA STAD -0.135





Enriched cancer pathways of putative targets