microRNA information: hsa-miR-137
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-137 | miRbase |
Accession: | MIMAT0000429 | miRbase |
Precursor name: | hsa-mir-137 | miRbase |
Precursor accession: | MI0000454 | miRbase |
Symbol: | MIR137 | HGNC |
RefSeq ID: | NR_029679 | GenBank |
Sequence: | UUAUUGCUUAAGAAUACGCGUAG |
Reported expression in cancers: hsa-miR-137
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-137 | bladder cancer | upregulation | "Previous studies have shown that miR-137 is dysreg ......" | 25330156 | |
hsa-miR-137 | breast cancer | downregulation | "Several miRNAs have been reported to be involved i ......" | 25955714 | qPCR |
hsa-miR-137 | colon cancer | upregulation | "MicroRNA expression was analyzed with Agilent micr ......" | 19659786 | Microarray; qPCR |
hsa-miR-137 | colon cancer | downregulation | "Among the miRNAs demonstrating the largest fold up ......" | 21694772 | |
hsa-miR-137 | colon cancer | deregulation | "Interestingly miRNA-137 miR-137 expression was dow ......" | 26747706 | |
hsa-miR-137 | colorectal cancer | deregulation | "Real time-polymerase chain reaction was used to an ......" | 26867319 | qPCR |
hsa-miR-137 | gastric cancer | downregulation | "Some recent studies show that DNA methylation cont ......" | 21221794 | qPCR |
hsa-miR-137 | gastric cancer | downregulation | "Clinical Significance of MiR 137 Expression in Pat ......" | 26545111 | qPCR |
hsa-miR-137 | gastric cancer | downregulation | "Aberrant expression of miR-137 has been reported i ......" | 27468717 | qPCR |
hsa-miR-137 | glioblastoma | downregulation | "Here we study the expression and function of miR-1 ......" | 23714687 | |
hsa-miR-137 | glioblastoma | downregulation | "Here we showed that miR-137 is downregulated in gl ......" | 25939439 | |
hsa-miR-137 | liver cancer | downregulation | "Here we show that microRNA miR-137 is significantl ......" | 24970808 | |
hsa-miR-137 | lung cancer | downregulation | "Silencing of miR 137 by aberrant promoter hypermet ......" | 26101014 | qPCR; RNA-Seq |
hsa-miR-137 | lung cancer | downregulation | "MicroRNA 137 inhibits tumor growth and sensitizes ......" | 26989074 | |
hsa-miR-137 | lung squamous cell cancer | downregulation | "Currently a large number of miRNAs have been repor ......" | 24243432 | |
hsa-miR-137 | lung squamous cell cancer | downregulation | "More importantly the decreased expression of miR-1 ......" | 25498886 | |
hsa-miR-137 | lung squamous cell cancer | downregulation | "MicroRNA-137 miR-137 was reported to be dysregulat ......" | 26617798 | qPCR |
hsa-miR-137 | ovarian cancer | downregulation | "Several miRNAs have been reported to be involved i ......" | 25955305 | qPCR |
hsa-miR-137 | thyroid cancer | downregulation | "microRNA-137 expression is downregulated in severa ......" | 26695142 | |
hsa-miR-137 | thyroid cancer | downregulation | "microRNA-137 miR-137 has been reported as a tumor ......" | 26847706 | qPCR |
Reported cancer pathway affected by hsa-miR-137
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-137 | breast cancer | Apoptosis pathway | "Several miRNAs have been reported to be involved i ......" | 25955714 | |
hsa-miR-137 | colorectal cancer | cell cycle pathway | "miR 137 targets Cdc42 expression induces cell cycl ......" | 20473940 | Luciferase |
hsa-miR-137 | gastric cancer | cell cycle pathway; Apoptosis pathway | "miR 137 is frequently down regulated in gastric ca ......" | 21221794 | |
hsa-miR-137 | gastric cancer | cell cycle pathway | "MicroRNA library based functional screening identi ......" | 25342326 | Flow cytometry; MTT assay; Luciferase |
hsa-miR-137 | gastric cancer | Apoptosis pathway | "MicroRNA 137 Contributes to Dampened Tumorigenesis ......" | 26102366 | Western blot; Luciferase |
hsa-miR-137 | gastric cancer | Hippo signaling pathway | "Cullin 4A CUL4A a direct target of miR 9 and miR 1 ......" | 26840256 | |
hsa-miR-137 | gastric cancer | cell cycle pathway | "miR 137 plays tumor suppressor roles in gastric ca ......" | 27468717 | Transwell assay; Western blot; Luciferase |
hsa-miR-137 | glioblastoma | cell cycle pathway | "miR 124 and miR 137 inhibit proliferation of gliob ......" | 18577219 | |
hsa-miR-137 | glioblastoma | cell cycle pathway; Apoptosis pathway | "Direct transfection of miR 137 mimics is more effe ......" | 26187071 | |
hsa-miR-137 | head and neck cancer | cell cycle pathway | "MicroRNA 137 promoter methylation in oral rinses f ......" | 20197299 | |
hsa-miR-137 | head and neck cancer | cell cycle pathway | "MicroRNA 137 promoter methylation is associated wi ......" | 21425146 | |
hsa-miR-137 | lung cancer | cell cycle pathway | "miR 137 inhibits the proliferation of lung cancer ......" | 23178712 | |
hsa-miR-137 | lung cancer | cell cycle pathway | "MicroRNA 137 inhibits tumor growth and sensitizes ......" | 26989074 | |
hsa-miR-137 | lung cancer | Apoptosis pathway | "Oncogenic miR 137 contributes to cisplatin resista ......" | 27429846 | Luciferase |
hsa-miR-137 | lung squamous cell cancer | Apoptosis pathway | "miR 137 impairs the proliferative and migratory ca ......" | 24243432 | |
hsa-miR-137 | melanoma | cell cycle pathway | "Epigenetics microRNAs and carcinogenesis: function ......" | 21051724 | Flow cytometry; Cell Proliferation Assay; Luciferase; Western blot |
hsa-miR-137 | melanoma | Apoptosis pathway; Epithelial mesenchymal transition pathway | "MicroRNA 137 targets carboxyl terminal binding pro ......" | 21278922 | Luciferase |
hsa-miR-137 | melanoma | Apoptosis pathway | "miR 137 inhibits the invasion of melanoma cells th ......" | 23151846 | |
hsa-miR-137 | ovarian cancer | Apoptosis pathway | "MicroRNA 137 suppresses tumor growth in epithelial ......" | 25955305 |
Reported cancer prognosis affected by hsa-miR-137
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-137 | bladder cancer | staging | "MicroRNA 137 upregulation increases bladder cancer ......" | 25330156 | |
hsa-miR-137 | breast cancer | progression; poor survival | "Several miRNAs have been reported to be involved i ......" | 25955714 | |
hsa-miR-137 | breast cancer | tumorigenesis | "In the present study we examined the role played b ......" | 26621457 | |
hsa-miR-137 | colorectal cancer | worse prognosis | "miR 124 miR 137 and miR 340 regulate colorectal ca ......" | 22895557 | |
hsa-miR-137 | colorectal cancer | metastasis | "MicroRNA 137 an HMGA1 target suppresses colorectal ......" | 23201162 | Luciferase |
hsa-miR-137 | colorectal cancer | metastasis; progression; worse prognosis | "Overexpression of paxillin induced by miR 137 supp ......" | 23275153 | Luciferase |
hsa-miR-137 | colorectal cancer | progression | "Tumor suppressive microRNA 137 negatively regulate ......" | 25940441 | Luciferase; Colony formation |
hsa-miR-137 | gastric cancer | tumorigenesis | "miR 137 is frequently down regulated in gastric ca ......" | 21221794 | |
hsa-miR-137 | gastric cancer | progression; worse prognosis | "MicroRNA library based functional screening identi ......" | 25342326 | Flow cytometry; MTT assay; Luciferase |
hsa-miR-137 | gastric cancer | tumorigenesis; metastasis | "MicroRNA 137 Contributes to Dampened Tumorigenesis ......" | 26102366 | Western blot; Luciferase |
hsa-miR-137 | gastric cancer | progression; worse prognosis; staging; differentiation; poor survival | "Clinical Significance of MiR 137 Expression in Pat ......" | 26545111 | |
hsa-miR-137 | gastric cancer | cell migration; poor survival; staging | "miR 137 plays tumor suppressor roles in gastric ca ......" | 27468717 | Transwell assay; Western blot; Luciferase |
hsa-miR-137 | glioblastoma | differentiation | "miR 124 and miR 137 inhibit proliferation of gliob ......" | 18577219 | |
hsa-miR-137 | glioblastoma | differentiation | "MicroRNA 137 is downregulated in glioblastoma and ......" | 23714687 | Luciferase |
hsa-miR-137 | glioblastoma | malignant trasformation; differentiation | "Genomic analyses reveal broad impact of miR 137 on ......" | 24465609 | |
hsa-miR-137 | glioblastoma | progression | "Direct transfection of miR 137 mimics is more effe ......" | 26187071 | |
hsa-miR-137 | head and neck cancer | poor survival; progression; staging; tumor size | "MicroRNA 137 promoter methylation is associated wi ......" | 21425146 | |
hsa-miR-137 | liver cancer | metastasis; poor survival; progression; worse prognosis | "FoxD3 regulated microRNA 137 suppresses tumour gro ......" | 24970808 | |
hsa-miR-137 | liver cancer | metastasis | "Inhibition of cell proliferation and metastasis of ......" | 26352279 | Western blot; Luciferase |
hsa-miR-137 | liver cancer | cell migration | "HEY2 a target of miR 137 indicates poor outcomes a ......" | 27191260 | Colony formation |
hsa-miR-137 | liver cancer | poor survival | "Prognostic relevance of miR 137 in patients with h ......" | 27473646 | |
hsa-miR-137 | lung cancer | staging; metastasis; progression | "In this work the methylation of six miRNA genes mi ......" | 24450160 | |
hsa-miR-137 | lung cancer | drug resistance | "To address this issue we inserted microRNA respons ......" | 25132116 | |
hsa-miR-137 | lung cancer | poor survival | "MicroRNA 137 inhibits tumor growth and sensitizes ......" | 26989074 | |
hsa-miR-137 | lung cancer | drug resistance; worse prognosis; poor survival | "Oncogenic miR 137 contributes to cisplatin resista ......" | 27429846 | Luciferase |
hsa-miR-137 | lung squamous cell cancer | progression; cell migration | "miR 137 impairs the proliferative and migratory ca ......" | 24243432 | |
hsa-miR-137 | lung squamous cell cancer | staging; metastasis; worse prognosis; progression | "microRNA 137 functions as a tumor suppressor in hu ......" | 25498886 | Luciferase |
hsa-miR-137 | lung squamous cell cancer | cell migration; progression | "MicroRNA 137 inhibits cell migration and invasion ......" | 26617798 | Luciferase |
hsa-miR-137 | melanoma | tumorigenesis | "Epigenetics microRNAs and carcinogenesis: function ......" | 21051724 | Flow cytometry; Cell Proliferation Assay; Luciferase; Western blot |
hsa-miR-137 | melanoma | malignant trasformation; staging; poor survival; cell migration | "miR 137 inhibits the invasion of melanoma cells th ......" | 23151846 | |
hsa-miR-137 | melanoma | drug resistance | "To improve uveal melanoma specificity of adenoviru ......" | 24001901 | Luciferase |
hsa-miR-137 | ovarian cancer | progression; poor survival | "MicroRNA 137 suppresses tumor growth in epithelial ......" | 25955305 | |
hsa-miR-137 | ovarian cancer | poor survival | "MiR 137 and miR 34a directly target Snail and inhi ......" | 27596137 | Western blot; Luciferase |
hsa-miR-137 | pancreatic cancer | poor survival; cell migration; tumor size | "microRNA 137 modulates pancreatic cancer cells tum ......" | 25550779 | |
hsa-miR-137 | pancreatic cancer | drug resistance | "miR 137 Modulates a Tumor Suppressor Network Induc ......" | 26904954 | |
hsa-miR-137 | thyroid cancer | malignant trasformation; progression | "microRNA 137 is downregulated in thyroid cancer an ......" | 26695142 | Colony formation; Luciferase |
hsa-miR-137 | thyroid cancer | staging; metastasis | "MiR 137 acts as a tumor suppressor in papillary th ......" | 26847706 | Colony formation; Luciferase; Western blot |
Reported gene related to hsa-miR-137
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-137 | colorectal cancer | CDC42 | "miR 137 targets Cdc42 expression induces cell cycl ......" | 20473940 |
hsa-miR-137 | gastric cancer | CDC42 | "miR 137 is frequently down regulated in gastric ca ......" | 21221794 |
hsa-miR-137 | liver cancer | CDC42 | "Inhibition of cell proliferation and metastasis of ......" | 26352279 |
hsa-miR-137 | lung cancer | CDC42 | "miR 137 inhibits the proliferation of lung cancer ......" | 23178712 |
hsa-miR-137 | gastric cancer | CDK6 | "Bioinformatics prediction and luciferase reporter ......" | 25342326 |
hsa-miR-137 | glioblastoma | CDK6 | "Transfection of microRNA-124 or microRNA-137 also ......" | 18577219 |
hsa-miR-137 | lung cancer | CDK6 | "miR 137 inhibits the proliferation of lung cancer ......" | 23178712 |
hsa-miR-137 | melanoma | CDK6 | "The results showed that miR-137 can act as a tumor ......" | 21051724 |
hsa-miR-137 | melanoma | MITF | "In addition we confirm the previously reported eff ......" | 20644734 |
hsa-miR-137 | melanoma | MITF | "In these studies we have identified microRNA-137 m ......" | 18316599 |
hsa-miR-137 | melanoma | MITF | "Overexpression of miR-137 downregulated MITF a tra ......" | 21051724 |
hsa-miR-137 | gastric cancer | AKT2 | "MicroRNA 137 Contributes to Dampened Tumorigenesis ......" | 26102366 |
hsa-miR-137 | liver cancer | AKT2 | "FoxD3 regulated microRNA 137 suppresses tumour gro ......" | 24970808 |
hsa-miR-137 | breast cancer | CTBP1 | "miR 137 suppresses the invasion and procedure of E ......" | 26337822 |
hsa-miR-137 | melanoma | CTBP1 | "In the present study we identified miR-137 as a po ......" | 21278922 |
hsa-miR-137 | lung cancer | EGFR | "Moreover the endogenous CASP3 can be modulated by ......" | 27429846 |
hsa-miR-137 | thyroid cancer | EGFR | "microRNA 137 is downregulated in thyroid cancer an ......" | 26695142 |
hsa-miR-137 | glioblastoma | GSC | "Furthermore combining miR-137 and antimiR-10b syne ......" | 27448441 |
hsa-miR-137 | glioblastoma | GSC | "miR-137 inhibits GSC self-renewal and promotes the ......" | 23714687 |
hsa-miR-137 | colorectal cancer | PXN | "Overexpression of paxillin induced by miR 137 supp ......" | 23275153 |
hsa-miR-137 | lung squamous cell cancer | PXN | "miR 137 impairs the proliferative and migratory ca ......" | 24243432 |
hsa-miR-137 | melanoma | BCL2 | "Finally miR-137 induced apoptosis in melanoma cell ......" | 23151846 |
hsa-miR-137 | lung squamous cell cancer | BMP7 | "MicroRNA 137 inhibits cell migration and invasion ......" | 26617798 |
hsa-miR-137 | lung cancer | CASP3 | "Oncogenic miR 137 contributes to cisplatin resista ......" | 27429846 |
hsa-miR-137 | gastric cancer | CUL4A | "Interestingly CUL4A expression was inhibited by th ......" | 26840256 |
hsa-miR-137 | thyroid cancer | CXCL12 | "MiR 137 acts as a tumor suppressor in papillary th ......" | 26847706 |
hsa-miR-137 | glioblastoma | CXCR4 | "miR-137 inhibits GSC self-renewal and promotes the ......" | 23714687 |
hsa-miR-137 | colon cancer | DCLK1 | "miR 137 Regulates the Tumorigenicity of Colon Canc ......" | 26747706 |
hsa-miR-137 | glioblastoma | DCLRE1C | "In addition ectopic expression of miR-137 inhibite ......" | 25939439 |
hsa-miR-137 | thyroid cancer | EGF | "With prediction software and luciferase reporter a ......" | 26695142 |
hsa-miR-137 | glioblastoma | EZH2 | "MiR 137 inhibits proliferation and angiogenesis of ......" | 25939439 |
hsa-miR-137 | colorectal cancer | FMNL2 | "MicroRNA 137 an HMGA1 target suppresses colorectal ......" | 23201162 |
hsa-miR-137 | liver cancer | FOXO1 | "Together these results indicate that the rs1759223 ......" | 25739100 |
hsa-miR-137 | sarcoma | FXYD6 | "MicroRNA 137 is downregulated in human osteosarcom ......" | 26302771 |
hsa-miR-137 | lung cancer | HDAC9 | "Lung cancer cell lines were treated with either a ......" | 26101014 |
hsa-miR-137 | liver cancer | HEY2 | "HEY2 a target of miR 137 indicates poor outcomes a ......" | 27191260 |
hsa-miR-137 | colorectal cancer | HMGA1 | "MicroRNA 137 an HMGA1 target suppresses colorectal ......" | 23201162 |
hsa-miR-137 | pancreatic cancer | KDM4A | "Restoring the KDM4A expression contributed to bypa ......" | 26904954 |
hsa-miR-137 | breast cancer | KDM5B | "We further identified KDM5B a histone demethylase ......" | 26621457 |
hsa-miR-137 | gastric cancer | KLF12 | "miR 137 plays tumor suppressor roles in gastric ca ......" | 27468717 |
hsa-miR-137 | breast cancer | MBD2 | "We further identified KDM5B a histone demethylase ......" | 26621457 |
hsa-miR-137 | pancreatic cancer | MIA | "Lentivirual vector containing miR-137 mimic was us ......" | 25550779 |
hsa-miR-137 | thyroid cancer | MMP2 | "miR-137 mimics downregulated B-CPAP cell prolifera ......" | 26695142 |
hsa-miR-137 | colorectal cancer | MSI1 | "Tumor suppressive microRNA 137 negatively regulate ......" | 25940441 |
hsa-miR-137 | ovarian cancer | MTDH | "miR 137 suppresses cell growth in ovarian cancer b ......" | 24144591 |
hsa-miR-137 | gastric cancer | MYO1C | "miR 137 plays tumor suppressor roles in gastric ca ......" | 27468717 |
hsa-miR-137 | glioblastoma | PABPC1 | "To evaluate the potential of miR-137 in glioblasto ......" | 24465609 |
hsa-miR-137 | melanoma | PAK2 | "miR 137 inhibits proliferation of melanoma cells b ......" | 26186482 |
hsa-miR-137 | bladder cancer | PAQR3 | "MicroRNA 137 upregulation increases bladder cancer ......" | 25330156 |
hsa-miR-137 | thyroid cancer | PCNA | "miR-137 mimics downregulated B-CPAP cell prolifera ......" | 26695142 |
hsa-miR-137 | lung cancer | PDIK1L | "We further demonstrated that the tumor suppressive ......" | 26989074 |
hsa-miR-137 | lung cancer | PRDX2 | "Lung cancer cell lines were treated with either a ......" | 26101014 |
hsa-miR-137 | glioblastoma | PTGS2 | "miR 137 is frequently down regulated in glioblasto ......" | 22406049 |
hsa-miR-137 | pancreatic cancer | PTN | "The molecular target of miR-137 pleiotropic growth ......" | 25550779 |
hsa-miR-137 | lung squamous cell cancer | SCLC1 | "MiR-137 expression was examined in parental and dr ......" | 24412084 |
hsa-miR-137 | lung squamous cell cancer | SLC22A18 | "microRNA 137 functions as a tumor suppressor in hu ......" | 25498886 |
hsa-miR-137 | ovarian cancer | SNAI1 | "MiR 137 and miR 34a directly target Snail and inhi ......" | 27596137 |
hsa-miR-137 | glioblastoma | VEGFA | "Combination of miR-137 mimics transfection and DPN ......" | 26187071 |
hsa-miR-137 | breast cancer | WNT11 | "Furthermore transfection with miR-137 mimics suppr ......" | 22723937 |