microRNA information: hsa-miR-138-5p

SectionIDlink
Mature name: hsa-miR-138-5pmiRbase
Accession: MIMAT0000430miRbase
Precursor name: hsa-mir-138-1 miRbase
Precursor accession: MI0000476miRbase
Symbol: MIR138-1HGNC
RefSeq ID: NR_029700GenBank
Sequence: AGCUGGUGUUGUGAAUCAGGCCG



Reported expression in cancers: hsa-miR-138-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-138-5p

B cell lymphomaderegulation"Importantly decreased expression of miR-138-5p and ......"24914240
hsa-miR-138-5p

bladder cancerderegulation"Expression levels of miRNAs were assessed by quant ......"23169479qPCR
hsa-miR-138-5p

breast cancerupregulation"MicroRNA microArray analysis was performed compari ......"24626163Microarray
hsa-miR-138-5p

cervical and endocervical cancerdownregulation"MicroRNA-138 miR-138 has been shown to play a crit ......"27049264qPCR
hsa-miR-138-5p

colon cancerdownregulation"To present proof-of-principle application for empl ......"23741026qPCR; Microarray
hsa-miR-138-5p

colorectal cancerdownregulation"The expression levels of miR-138 were first examin ......"24171926qPCR
hsa-miR-138-5p

colorectal cancerdownregulation"This study investigated the effects of miR-138-5p ......"27248318
hsa-miR-138-5p

esophageal cancerdownregulation"The aim of this study was to evaluate the effect o ......"23319823qPCR
hsa-miR-138-5p

gastric cancerderegulation"The results from the miRNA microarray analysis wer ......"21475928qPCR; Microarray
hsa-miR-138-5p

glioblastomaupregulation"From these we selected miR-138 for further functio ......"26887050
hsa-miR-138-5p

head and neck cancerdownregulation"Recent evidence suggests that deregulation of micr ......"23445815
hsa-miR-138-5p

kidney renal cell cancerdownregulation"MiR-138 has been shown to be downregulated in vari ......"24406044
hsa-miR-138-5p

liver cancerdownregulation"In this study we identified 10 upregulated miRNAs ......"22362728qPCR
hsa-miR-138-5p

liver cancerdownregulation"Simultaneously 9 miRNAs were down-regulated in the ......"24273923
hsa-miR-138-5p

liver cancerdownregulation"Accumulating evidence suggests that miR-138 expres ......"27347323
hsa-miR-138-5p

lung cancerderegulation"In this study microRNA miRNA expression profiling ......"19597153
hsa-miR-138-5p

lung squamous cell cancerupregulation"Previous studies demonstrate that microRNA-138 miR ......"26201895
hsa-miR-138-5p

lung squamous cell cancerdownregulation"Down-regulation of miR-138 is observed in a variet ......"27049260qPCR
hsa-miR-138-5p

pancreatic cancerupregulation"Here we set out to investigate the role of microRN ......"25875420
hsa-miR-138-5p

prostate cancerderegulation"Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......"23781281
hsa-miR-138-5p

thyroid cancerderegulation"In this study we evaluated miRNA expression as a m ......"21537871Microarray
hsa-miR-138-5p

thyroid cancerderegulation"Deregulated miRNAs were confirmed by quantitative ......"24127332qPCR; in situ hybridization
hsa-miR-138-5p

thyroid cancerderegulation"Quantitative real-time PCR qRT-PCR was used to val ......"26380656qPCR



Reported cancer pathway affected by hsa-miR-138-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-138-5p

breast cancerEpithelial mesenchymal transition pathway"In this study in order to investigate the associat ......"26796277Western blot; Luciferase
hsa-miR-138-5p

cervical and endocervical cancercell cycle pathway; Apoptosis pathway"These include hsa-miR-138 hsa-miR-210 and hsa-miR- ......"23012319
hsa-miR-138-5p

chronic myeloid leukemiacell cycle pathway; Apoptosis pathway"Here we report a novel BCR breakpoint cluster regi ......"23208504Colony formation; Luciferase
hsa-miR-138-5p

esophageal cancerApoptosis pathway"The flow cytometry FCM and Hoechst/PI staining wer ......"27536892Flow cytometry
hsa-miR-138-5p

glioblastomaApoptosis pathway"Using microarray-based miRNA expression profiling ......"26887050
hsa-miR-138-5p

head and neck cancercell cycle pathway; Apoptosis pathway"Using microarrays a panel of differentially expres ......"19540661
hsa-miR-138-5p

head and neck cancerEpithelial mesenchymal transition pathway"The tumour suppressor roles of the let-7 family th ......"23340306
hsa-miR-138-5p

kidney renal cell cancerApoptosis pathway"MiR 138 suppresses expression of hypoxia inducible ......"21875287Western blot; Cell migration assay
hsa-miR-138-5p

liver cancercell cycle pathway"MiR 138 induces cell cycle arrest by targeting cyc ......"22362728Colony formation; Luciferase
hsa-miR-138-5p

liver cancercell cycle pathway"MicroRNA 138 miR-138 is recently shown to inhibit ......"25439221
hsa-miR-138-5p

lung cancercell cycle pathway"Cell cycles and doubling time were detected by flo ......"21645449Flow cytometry; MTT assay
hsa-miR-138-5p

lung squamous cell cancerApoptosis pathway"Up-regulation of miR-138 increased the sensitivity ......"21787234Flow cytometry
hsa-miR-138-5p

lung squamous cell cancercell cycle pathway"We noted that both miR-138 and H2AX have been impl ......"25699650
hsa-miR-138-5p

lung squamous cell cancercell cycle pathway"FOXP4 modulates tumor growth and independently ass ......"25994569Western blot; Cell proliferation assay; Cell migration assay; Cell Proliferation Assay; Luciferase
hsa-miR-138-5p

lung squamous cell cancercell cycle pathway"Previous studies demonstrate that microRNA-138 miR ......"26201895Luciferase; Cell migration assay
hsa-miR-138-5p

lung squamous cell cancerEpithelial mesenchymal transition pathway"MiR 138 inhibits cell proliferation and reverses e ......"26283050Luciferase
hsa-miR-138-5p

lung squamous cell cancerEpithelial mesenchymal transition pathway"Down-regulation of miR-138 is observed in a variet ......"27049260MTT assay; Western blot; Luciferase
hsa-miR-138-5p

prostate cancercell cycle pathway"MiR 26a and miR 138 block the G1/S transition by t ......"27562865
hsa-miR-138-5p

sarcomaApoptosis pathway"MiR 138 Acts as a Tumor Suppressor by Targeting EZ ......"27019355Cell migration assay
hsa-miR-138-5p

sarcomaApoptosis pathway"MicroRNA-138 miR-138 has been proven to be a tumor ......"27095063Flow cytometry; Luciferase



Reported cancer prognosis affected by hsa-miR-138-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-138-5p

bladder cancerdrug resistance"By changing the cellular level of the response-ide ......"22954303
hsa-miR-138-5p

bladder cancerstaging"Expression levels of miRNAs were assessed by quant ......"23169479
hsa-miR-138-5p

bladder cancermetastasis"Here we aimed to study the role of miR-138 in regu ......"26646296Luciferase
hsa-miR-138-5p

breast cancerprogression"MicroRNA microArray analysis was performed compari ......"24626163
hsa-miR-138-5p

breast cancermetastasis; tumorigenesis"In this study in order to investigate the associat ......"26796277Western blot; Luciferase
hsa-miR-138-5p

breast cancerworse prognosis; drug resistance"The aim of this study was to investigate the role ......"27746365
hsa-miR-138-5p

cervical and endocervical cancerprogression"These include hsa-miR-138 hsa-miR-210 and hsa-miR- ......"23012319
hsa-miR-138-5p

chronic myeloid leukemiadrug resistance"Here we report a novel BCR breakpoint cluster regi ......"23208504Colony formation; Luciferase
hsa-miR-138-5p

colon cancerstaging"To present proof-of-principle application for empl ......"23741026
hsa-miR-138-5p

colorectal cancermetastasis; worse prognosis"Down regulation of miR 138 promotes colorectal can ......"24171926Luciferase
hsa-miR-138-5p

colorectal cancerworse prognosis"Screening for downregulated miRNAs in CRC tissues ......"25845814
hsa-miR-138-5p

colorectal cancerstaging; metastasis; poor survival; tumorigenesis"The tumor suppressor miR 138 5p targets PD L1 in c ......"27248318
hsa-miR-138-5p

esophageal cancerprogression; poor survival"Downregulation of miR 138 sustains NF κB activati ......"23319823Luciferase
hsa-miR-138-5p

glioblastomaprogression; poor survival"Moreover high levels of miR-138 are associated wit ......"23707559
hsa-miR-138-5p

glioblastomadrug resistance; progression; poor survival"Using microarray-based miRNA expression profiling ......"26887050
hsa-miR-138-5p

head and neck cancermetastasis"Using microarrays a panel of differentially expres ......"19540661
hsa-miR-138-5p

head and neck cancertumorigenesis; progression"Recent evidence suggests that deregulation of micr ......"23445815
hsa-miR-138-5p

head and neck cancermotility; progression; poor survival"We hypothesize that miR-138 can inhibit the functi ......"24565984Western blot; Colony formation
hsa-miR-138-5p

kidney renal cell cancercell migration"MiR 138 suppresses expression of hypoxia inducible ......"21875287Western blot; Cell migration assay
hsa-miR-138-5p

liver cancertumorigenesis"Six hundred and sixty seven human miRNAs were quan ......"23082062Western blot; Luciferase
hsa-miR-138-5p

liver cancerstaging; metastasis; worse prognosis"MicroRNA 138 miR-138 is recently shown to inhibit ......"25439221
hsa-miR-138-5p

liver cancerprogression; tumorigenesis"miR 138 suppresses cell proliferation and invasion ......"27347323Colony formation; Luciferase; Western blot
hsa-miR-138-5p

lung cancerdrug resistance"Cell cycles and doubling time were detected by flo ......"21645449Flow cytometry; MTT assay
hsa-miR-138-5p

lung cancerpoor survival; cell migration"To explore the anticancer function of α-solanine ......"26631041Western blot; Luciferase; MTT assay
hsa-miR-138-5p

lung squamous cell cancerdrug resistance"Up-regulation of miR-138 increased the sensitivity ......"21787234Flow cytometry
hsa-miR-138-5p

lung squamous cell cancerdrug resistance"miR 138 5p reverses gefitinib resistance in non sm ......"24582749Luciferase
hsa-miR-138-5p

lung squamous cell cancerworse prognosis; staging; metastasis; poor survival"microRNA miR-138 has been recognized as a potentia ......"25064732
hsa-miR-138-5p

lung squamous cell cancerdrug resistance; progression"We noted that both miR-138 and H2AX have been impl ......"25699650
hsa-miR-138-5p

lung squamous cell cancerprogression"MiR 138 inhibits cell proliferation and reverses e ......"26283050Luciferase
hsa-miR-138-5p

lung squamous cell cancermetastasis; malignant trasformation"MicroRNA miR-138 was found to have suppressive eff ......"27223073Western blot; Luciferase; Wound Healing Assay
hsa-miR-138-5p

ovarian cancerstaging; metastasis"Results indicated that miR-138 directly targeted S ......"23389731
hsa-miR-138-5p

ovarian cancermetastasis"The results showed that increased Limk1 and decrea ......"25190487
hsa-miR-138-5p

pancreatic cancermetastasis"The expression levels of microRNAs and mRNAs were ......"23373509Western blot
hsa-miR-138-5p

sarcomadrug resistance; malignant trasformation"MiR 138 Acts as a Tumor Suppressor by Targeting EZ ......"27019355Cell migration assay
hsa-miR-138-5p

sarcomaprogression"MicroRNA-138 miR-138 has been proven to be a tumor ......"27095063Flow cytometry; Luciferase
hsa-miR-138-5p

thyroid cancermetastasis; recurrence"In this study we evaluated miRNA expression as a m ......"21537871
hsa-miR-138-5p

thyroid cancermalignant trasformation"A miRNA array was used to identify differentially ......"22006248



Reported gene related to hsa-miR-138-5p

miRNAcancergenereportingPUBMED
hsa-miR-138-5p

chronic myeloid leukemiaCCND3"In addition CCND3 is another target of miR-138 whi ......"23208504
hsa-miR-138-5p

liver cancerCCND3"MiR 138 induces cell cycle arrest by targeting cyc ......"22362728
hsa-miR-138-5p

liver cancerCCND3"The aim of this study was to investigate the clini ......"25439221
hsa-miR-138-5p

liver cancerCCND3"Our data suggest an importance of miR-138 and miR- ......"23082062
hsa-miR-138-5p

lung squamous cell cancerCCND3"Luciferase assay and qRT-PCR showed that CCND3 was ......"26201895
hsa-miR-138-5p

kidney renal cell cancerEZH2"MiR 138 induces renal carcinoma cell senescence by ......"24406044
hsa-miR-138-5p

lung squamous cell cancerEZH2"MiR 138 inhibits tumor growth through repression o ......"23343715
hsa-miR-138-5p

lung squamous cell cancerEZH2"FOXP4 downregulation-mediated inhibition on cancer ......"25994569
hsa-miR-138-5p

prostate cancerEZH2"In the present study the influence of miR-26a and ......"27562865
hsa-miR-138-5p

sarcomaEZH2"MiR 138 Acts as a Tumor Suppressor by Targeting EZ ......"27019355
hsa-miR-138-5p

breast cancerCDH1"miR-138 overexpression also down-regulated vimenti ......"26796277
hsa-miR-138-5p

lung squamous cell cancerCDH1"In addition the epithelial-mesenchymal transition ......"27049260
hsa-miR-138-5p

lung squamous cell cancerPDK1"The aim of this study was to investigate the role ......"24405893
hsa-miR-138-5p

lung squamous cell cancerPDK1"microRNA miR-138 has been recognized as a potentia ......"25064732
hsa-miR-138-5p

head and neck cancerPTK2"Furthermore a significant down regulation was obse ......"24565984
hsa-miR-138-5p

lung cancerPTK2"Moreover we discovered that α-solanine could affe ......"26631041
hsa-miR-138-5p

breast cancerVIM"miR-138 overexpression also down-regulated vimenti ......"26796277
hsa-miR-138-5p

lung squamous cell cancerVIM"In addition the epithelial-mesenchymal transition ......"27049260
hsa-miR-138-5p

bladder cancerZEB2"We analyzed the levels of miR-138 and ZEB2 a key f ......"26646296
hsa-miR-138-5p

lung squamous cell cancerZEB2"Notably luciferase reporter assay confirmed that Z ......"27049260
hsa-miR-138-5p

chronic myeloid leukemiaABL1"Moreover overexpression of miR-138 led to the down ......"23208504
hsa-miR-138-5p

lung squamous cell cancerADM"Ectopic expression of miR-138 sensitized chemoresi ......"27049260
hsa-miR-138-5p

thyroid cancerATM"One miRNA miR-138 was significantly downregulated ......"18201269
hsa-miR-138-5p

glioblastomaBCL2L11"The apoptosis regulator BIM was identified as a di ......"26887050
hsa-miR-138-5p

sarcomaBHLHE41"Dual-luciferase reporter assay was used to identif ......"27095063
hsa-miR-138-5p

colorectal cancerCD274"The tumor suppressor miR 138 5p targets PD L1 in c ......"27248318
hsa-miR-138-5p

kidney renal cell cancerCDKN2A"Transfection of miR-138 mimic induced SN-12 cell s ......"24406044
hsa-miR-138-5p

lung squamous cell cancerERCC1"The authors also found that excision repair cross- ......"21787234
hsa-miR-138-5p

pancreatic cancerFOXC1"A predicted target of miR-138-5p FOXC1 was first v ......"25875420
hsa-miR-138-5p

lung squamous cell cancerFOXP4"FOXP4 modulates tumor growth and independently ass ......"25994569
hsa-miR-138-5p

lung squamous cell cancerGIT1"MiR 138 inhibits cell proliferation and reverses e ......"26283050
hsa-miR-138-5p

lung squamous cell cancerGNB2"miR 138 5p reverses gefitinib resistance in non sm ......"24582749
hsa-miR-138-5p

lung squamous cell cancerGPR124"Bioinformatics analysis and luciferase reporter as ......"24582749
hsa-miR-138-5p

lung squamous cell cancerH2AFX"We noted that both miR-138 and H2AX have been impl ......"25699650
hsa-miR-138-5p

kidney renal cell cancerHIF1A"Western blot and reporter assays were used to asse ......"21875287
hsa-miR-138-5p

lung squamous cell cancerINSR"Finally we were able to show miR-138 overexpressio ......"25699650
hsa-miR-138-5p

breast cancerKDM5C"We discovered that KDM5C is overexpressed in breas ......"26621457
hsa-miR-138-5p

ovarian cancerLIMK1"The results showed that increased Limk1 and decrea ......"25190487
hsa-miR-138-5p

cervical and endocervical cancerMET"In addition increased expression of miR-138 led to ......"27049264
hsa-miR-138-5p

esophageal cancerNFASC"Downregulation of miR 138 sustains NF κB activati ......"23319823
hsa-miR-138-5p

liver cancerPCNA"MiR 138 induces cell cycle arrest by targeting cyc ......"22362728
hsa-miR-138-5p

lung squamous cell cancerPDPK1"microRNA miR-138 has been recognized as a potentia ......"25064732
hsa-miR-138-5p

head and neck cancerRHOC"We hypothesize that miR-138 can inhibit the functi ......"24565984
hsa-miR-138-5p

kidney renal cell cancerRP1"MiR 138 suppresses expression of hypoxia inducible ......"21875287
hsa-miR-138-5p

lung squamous cell cancerSCLC1"In light of these data we sought to characterize t ......"25699650
hsa-miR-138-5p

lung squamous cell cancerSEMA4C"MiR 138 inhibits cell proliferation and reverses e ......"26283050
hsa-miR-138-5p

lung cancerSENP1"Then we investigated the underlying mechanisms res ......"24691972
hsa-miR-138-5p

ovarian cancerSOX4"Results indicated that miR-138 directly targeted S ......"23389731
hsa-miR-138-5p

liver cancerSOX9"miR 138 suppresses cell proliferation and invasion ......"27347323
hsa-miR-138-5p

head and neck cancerSRC"Furthermore a significant down regulation was obse ......"24565984
hsa-miR-138-5p

thyroid cancerTERT"Downregulation of miR 138 is associated with overe ......"18201269
hsa-miR-138-5p

esophageal cancerTRAF2"Silencing miR-138 promoted K63-linked polyubiquiti ......"23319823
hsa-miR-138-5p

colorectal cancerTWIST2"Down regulation of miR 138 promotes colorectal can ......"24171926
hsa-miR-138-5p

lung squamous cell cancerYAP1"We further identified YAP1 as a direct target gene ......"27223073



Expression profile in cancer corhorts: