microRNA information: hsa-miR-138-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-138-5p | miRbase |
Accession: | MIMAT0000430 | miRbase |
Precursor name: | hsa-mir-138-1 | miRbase |
Precursor accession: | MI0000476 | miRbase |
Symbol: | MIR138-1 | HGNC |
RefSeq ID: | NR_029700 | GenBank |
Sequence: | AGCUGGUGUUGUGAAUCAGGCCG |
Reported expression in cancers: hsa-miR-138-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-138-5p | B cell lymphoma | deregulation | "Importantly decreased expression of miR-138-5p and ......" | 24914240 | |
hsa-miR-138-5p | bladder cancer | deregulation | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | qPCR |
hsa-miR-138-5p | breast cancer | upregulation | "MicroRNA microArray analysis was performed compari ......" | 24626163 | Microarray |
hsa-miR-138-5p | cervical and endocervical cancer | downregulation | "MicroRNA-138 miR-138 has been shown to play a crit ......" | 27049264 | qPCR |
hsa-miR-138-5p | colon cancer | downregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
hsa-miR-138-5p | colorectal cancer | downregulation | "The expression levels of miR-138 were first examin ......" | 24171926 | qPCR |
hsa-miR-138-5p | colorectal cancer | downregulation | "This study investigated the effects of miR-138-5p ......" | 27248318 | |
hsa-miR-138-5p | esophageal cancer | downregulation | "The aim of this study was to evaluate the effect o ......" | 23319823 | qPCR |
hsa-miR-138-5p | gastric cancer | deregulation | "The results from the miRNA microarray analysis wer ......" | 21475928 | qPCR; Microarray |
hsa-miR-138-5p | glioblastoma | upregulation | "From these we selected miR-138 for further functio ......" | 26887050 | |
hsa-miR-138-5p | head and neck cancer | downregulation | "Recent evidence suggests that deregulation of micr ......" | 23445815 | |
hsa-miR-138-5p | kidney renal cell cancer | downregulation | "MiR-138 has been shown to be downregulated in vari ......" | 24406044 | |
hsa-miR-138-5p | liver cancer | downregulation | "In this study we identified 10 upregulated miRNAs ......" | 22362728 | qPCR |
hsa-miR-138-5p | liver cancer | downregulation | "Simultaneously 9 miRNAs were down-regulated in the ......" | 24273923 | |
hsa-miR-138-5p | liver cancer | downregulation | "Accumulating evidence suggests that miR-138 expres ......" | 27347323 | |
hsa-miR-138-5p | lung cancer | deregulation | "In this study microRNA miRNA expression profiling ......" | 19597153 | |
hsa-miR-138-5p | lung squamous cell cancer | upregulation | "Previous studies demonstrate that microRNA-138 miR ......" | 26201895 | |
hsa-miR-138-5p | lung squamous cell cancer | downregulation | "Down-regulation of miR-138 is observed in a variet ......" | 27049260 | qPCR |
hsa-miR-138-5p | pancreatic cancer | upregulation | "Here we set out to investigate the role of microRN ......" | 25875420 | |
hsa-miR-138-5p | prostate cancer | deregulation | "Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......" | 23781281 | |
hsa-miR-138-5p | thyroid cancer | deregulation | "In this study we evaluated miRNA expression as a m ......" | 21537871 | Microarray |
hsa-miR-138-5p | thyroid cancer | deregulation | "Deregulated miRNAs were confirmed by quantitative ......" | 24127332 | qPCR; in situ hybridization |
hsa-miR-138-5p | thyroid cancer | deregulation | "Quantitative real-time PCR qRT-PCR was used to val ......" | 26380656 | qPCR |
Reported cancer pathway affected by hsa-miR-138-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-138-5p | breast cancer | Epithelial mesenchymal transition pathway | "In this study in order to investigate the associat ......" | 26796277 | Western blot; Luciferase |
hsa-miR-138-5p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "These include hsa-miR-138 hsa-miR-210 and hsa-miR- ......" | 23012319 | |
hsa-miR-138-5p | chronic myeloid leukemia | cell cycle pathway; Apoptosis pathway | "Here we report a novel BCR breakpoint cluster regi ......" | 23208504 | Colony formation; Luciferase |
hsa-miR-138-5p | esophageal cancer | Apoptosis pathway | "The flow cytometry FCM and Hoechst/PI staining wer ......" | 27536892 | Flow cytometry |
hsa-miR-138-5p | glioblastoma | Apoptosis pathway | "Using microarray-based miRNA expression profiling ......" | 26887050 | |
hsa-miR-138-5p | head and neck cancer | cell cycle pathway; Apoptosis pathway | "Using microarrays a panel of differentially expres ......" | 19540661 | |
hsa-miR-138-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "The tumour suppressor roles of the let-7 family th ......" | 23340306 | |
hsa-miR-138-5p | kidney renal cell cancer | Apoptosis pathway | "MiR 138 suppresses expression of hypoxia inducible ......" | 21875287 | Western blot; Cell migration assay |
hsa-miR-138-5p | liver cancer | cell cycle pathway | "MiR 138 induces cell cycle arrest by targeting cyc ......" | 22362728 | Colony formation; Luciferase |
hsa-miR-138-5p | liver cancer | cell cycle pathway | "MicroRNA 138 miR-138 is recently shown to inhibit ......" | 25439221 | |
hsa-miR-138-5p | lung cancer | cell cycle pathway | "Cell cycles and doubling time were detected by flo ......" | 21645449 | Flow cytometry; MTT assay |
hsa-miR-138-5p | lung squamous cell cancer | Apoptosis pathway | "Up-regulation of miR-138 increased the sensitivity ......" | 21787234 | Flow cytometry |
hsa-miR-138-5p | lung squamous cell cancer | cell cycle pathway | "We noted that both miR-138 and H2AX have been impl ......" | 25699650 | |
hsa-miR-138-5p | lung squamous cell cancer | cell cycle pathway | "FOXP4 modulates tumor growth and independently ass ......" | 25994569 | Western blot; Cell proliferation assay; Cell migration assay; Cell Proliferation Assay; Luciferase |
hsa-miR-138-5p | lung squamous cell cancer | cell cycle pathway | "Previous studies demonstrate that microRNA-138 miR ......" | 26201895 | Luciferase; Cell migration assay |
hsa-miR-138-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MiR 138 inhibits cell proliferation and reverses e ......" | 26283050 | Luciferase |
hsa-miR-138-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "Down-regulation of miR-138 is observed in a variet ......" | 27049260 | MTT assay; Western blot; Luciferase |
hsa-miR-138-5p | prostate cancer | cell cycle pathway | "MiR 26a and miR 138 block the G1/S transition by t ......" | 27562865 | |
hsa-miR-138-5p | sarcoma | Apoptosis pathway | "MiR 138 Acts as a Tumor Suppressor by Targeting EZ ......" | 27019355 | Cell migration assay |
hsa-miR-138-5p | sarcoma | Apoptosis pathway | "MicroRNA-138 miR-138 has been proven to be a tumor ......" | 27095063 | Flow cytometry; Luciferase |
Reported cancer prognosis affected by hsa-miR-138-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-138-5p | bladder cancer | drug resistance | "By changing the cellular level of the response-ide ......" | 22954303 | |
hsa-miR-138-5p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
hsa-miR-138-5p | bladder cancer | metastasis | "Here we aimed to study the role of miR-138 in regu ......" | 26646296 | Luciferase |
hsa-miR-138-5p | breast cancer | progression | "MicroRNA microArray analysis was performed compari ......" | 24626163 | |
hsa-miR-138-5p | breast cancer | metastasis; tumorigenesis | "In this study in order to investigate the associat ......" | 26796277 | Western blot; Luciferase |
hsa-miR-138-5p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
hsa-miR-138-5p | cervical and endocervical cancer | progression | "These include hsa-miR-138 hsa-miR-210 and hsa-miR- ......" | 23012319 | |
hsa-miR-138-5p | chronic myeloid leukemia | drug resistance | "Here we report a novel BCR breakpoint cluster regi ......" | 23208504 | Colony formation; Luciferase |
hsa-miR-138-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
hsa-miR-138-5p | colorectal cancer | metastasis; worse prognosis | "Down regulation of miR 138 promotes colorectal can ......" | 24171926 | Luciferase |
hsa-miR-138-5p | colorectal cancer | worse prognosis | "Screening for downregulated miRNAs in CRC tissues ......" | 25845814 | |
hsa-miR-138-5p | colorectal cancer | staging; metastasis; poor survival; tumorigenesis | "The tumor suppressor miR 138 5p targets PD L1 in c ......" | 27248318 | |
hsa-miR-138-5p | esophageal cancer | progression; poor survival | "Downregulation of miR 138 sustains NF κB activati ......" | 23319823 | Luciferase |
hsa-miR-138-5p | glioblastoma | progression; poor survival | "Moreover high levels of miR-138 are associated wit ......" | 23707559 | |
hsa-miR-138-5p | glioblastoma | drug resistance; progression; poor survival | "Using microarray-based miRNA expression profiling ......" | 26887050 | |
hsa-miR-138-5p | head and neck cancer | metastasis | "Using microarrays a panel of differentially expres ......" | 19540661 | |
hsa-miR-138-5p | head and neck cancer | tumorigenesis; progression | "Recent evidence suggests that deregulation of micr ......" | 23445815 | |
hsa-miR-138-5p | head and neck cancer | motility; progression; poor survival | "We hypothesize that miR-138 can inhibit the functi ......" | 24565984 | Western blot; Colony formation |
hsa-miR-138-5p | kidney renal cell cancer | cell migration | "MiR 138 suppresses expression of hypoxia inducible ......" | 21875287 | Western blot; Cell migration assay |
hsa-miR-138-5p | liver cancer | tumorigenesis | "Six hundred and sixty seven human miRNAs were quan ......" | 23082062 | Western blot; Luciferase |
hsa-miR-138-5p | liver cancer | staging; metastasis; worse prognosis | "MicroRNA 138 miR-138 is recently shown to inhibit ......" | 25439221 | |
hsa-miR-138-5p | liver cancer | progression; tumorigenesis | "miR 138 suppresses cell proliferation and invasion ......" | 27347323 | Colony formation; Luciferase; Western blot |
hsa-miR-138-5p | lung cancer | drug resistance | "Cell cycles and doubling time were detected by flo ......" | 21645449 | Flow cytometry; MTT assay |
hsa-miR-138-5p | lung cancer | poor survival; cell migration | "To explore the anticancer function of α-solanine ......" | 26631041 | Western blot; Luciferase; MTT assay |
hsa-miR-138-5p | lung squamous cell cancer | drug resistance | "Up-regulation of miR-138 increased the sensitivity ......" | 21787234 | Flow cytometry |
hsa-miR-138-5p | lung squamous cell cancer | drug resistance | "miR 138 5p reverses gefitinib resistance in non sm ......" | 24582749 | Luciferase |
hsa-miR-138-5p | lung squamous cell cancer | worse prognosis; staging; metastasis; poor survival | "microRNA miR-138 has been recognized as a potentia ......" | 25064732 | |
hsa-miR-138-5p | lung squamous cell cancer | drug resistance; progression | "We noted that both miR-138 and H2AX have been impl ......" | 25699650 | |
hsa-miR-138-5p | lung squamous cell cancer | progression | "MiR 138 inhibits cell proliferation and reverses e ......" | 26283050 | Luciferase |
hsa-miR-138-5p | lung squamous cell cancer | metastasis; malignant trasformation | "MicroRNA miR-138 was found to have suppressive eff ......" | 27223073 | Western blot; Luciferase; Wound Healing Assay |
hsa-miR-138-5p | ovarian cancer | staging; metastasis | "Results indicated that miR-138 directly targeted S ......" | 23389731 | |
hsa-miR-138-5p | ovarian cancer | metastasis | "The results showed that increased Limk1 and decrea ......" | 25190487 | |
hsa-miR-138-5p | pancreatic cancer | metastasis | "The expression levels of microRNAs and mRNAs were ......" | 23373509 | Western blot |
hsa-miR-138-5p | sarcoma | drug resistance; malignant trasformation | "MiR 138 Acts as a Tumor Suppressor by Targeting EZ ......" | 27019355 | Cell migration assay |
hsa-miR-138-5p | sarcoma | progression | "MicroRNA-138 miR-138 has been proven to be a tumor ......" | 27095063 | Flow cytometry; Luciferase |
hsa-miR-138-5p | thyroid cancer | metastasis; recurrence | "In this study we evaluated miRNA expression as a m ......" | 21537871 | |
hsa-miR-138-5p | thyroid cancer | malignant trasformation | "A miRNA array was used to identify differentially ......" | 22006248 |
Reported gene related to hsa-miR-138-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-138-5p | chronic myeloid leukemia | CCND3 | "In addition CCND3 is another target of miR-138 whi ......" | 23208504 |
hsa-miR-138-5p | liver cancer | CCND3 | "MiR 138 induces cell cycle arrest by targeting cyc ......" | 22362728 |
hsa-miR-138-5p | liver cancer | CCND3 | "The aim of this study was to investigate the clini ......" | 25439221 |
hsa-miR-138-5p | liver cancer | CCND3 | "Our data suggest an importance of miR-138 and miR- ......" | 23082062 |
hsa-miR-138-5p | lung squamous cell cancer | CCND3 | "Luciferase assay and qRT-PCR showed that CCND3 was ......" | 26201895 |
hsa-miR-138-5p | kidney renal cell cancer | EZH2 | "MiR 138 induces renal carcinoma cell senescence by ......" | 24406044 |
hsa-miR-138-5p | lung squamous cell cancer | EZH2 | "MiR 138 inhibits tumor growth through repression o ......" | 23343715 |
hsa-miR-138-5p | lung squamous cell cancer | EZH2 | "FOXP4 downregulation-mediated inhibition on cancer ......" | 25994569 |
hsa-miR-138-5p | prostate cancer | EZH2 | "In the present study the influence of miR-26a and ......" | 27562865 |
hsa-miR-138-5p | sarcoma | EZH2 | "MiR 138 Acts as a Tumor Suppressor by Targeting EZ ......" | 27019355 |
hsa-miR-138-5p | breast cancer | CDH1 | "miR-138 overexpression also down-regulated vimenti ......" | 26796277 |
hsa-miR-138-5p | lung squamous cell cancer | CDH1 | "In addition the epithelial-mesenchymal transition ......" | 27049260 |
hsa-miR-138-5p | lung squamous cell cancer | PDK1 | "The aim of this study was to investigate the role ......" | 24405893 |
hsa-miR-138-5p | lung squamous cell cancer | PDK1 | "microRNA miR-138 has been recognized as a potentia ......" | 25064732 |
hsa-miR-138-5p | head and neck cancer | PTK2 | "Furthermore a significant down regulation was obse ......" | 24565984 |
hsa-miR-138-5p | lung cancer | PTK2 | "Moreover we discovered that α-solanine could affe ......" | 26631041 |
hsa-miR-138-5p | breast cancer | VIM | "miR-138 overexpression also down-regulated vimenti ......" | 26796277 |
hsa-miR-138-5p | lung squamous cell cancer | VIM | "In addition the epithelial-mesenchymal transition ......" | 27049260 |
hsa-miR-138-5p | bladder cancer | ZEB2 | "We analyzed the levels of miR-138 and ZEB2 a key f ......" | 26646296 |
hsa-miR-138-5p | lung squamous cell cancer | ZEB2 | "Notably luciferase reporter assay confirmed that Z ......" | 27049260 |
hsa-miR-138-5p | chronic myeloid leukemia | ABL1 | "Moreover overexpression of miR-138 led to the down ......" | 23208504 |
hsa-miR-138-5p | lung squamous cell cancer | ADM | "Ectopic expression of miR-138 sensitized chemoresi ......" | 27049260 |
hsa-miR-138-5p | thyroid cancer | ATM | "One miRNA miR-138 was significantly downregulated ......" | 18201269 |
hsa-miR-138-5p | glioblastoma | BCL2L11 | "The apoptosis regulator BIM was identified as a di ......" | 26887050 |
hsa-miR-138-5p | sarcoma | BHLHE41 | "Dual-luciferase reporter assay was used to identif ......" | 27095063 |
hsa-miR-138-5p | colorectal cancer | CD274 | "The tumor suppressor miR 138 5p targets PD L1 in c ......" | 27248318 |
hsa-miR-138-5p | kidney renal cell cancer | CDKN2A | "Transfection of miR-138 mimic induced SN-12 cell s ......" | 24406044 |
hsa-miR-138-5p | lung squamous cell cancer | ERCC1 | "The authors also found that excision repair cross- ......" | 21787234 |
hsa-miR-138-5p | pancreatic cancer | FOXC1 | "A predicted target of miR-138-5p FOXC1 was first v ......" | 25875420 |
hsa-miR-138-5p | lung squamous cell cancer | FOXP4 | "FOXP4 modulates tumor growth and independently ass ......" | 25994569 |
hsa-miR-138-5p | lung squamous cell cancer | GIT1 | "MiR 138 inhibits cell proliferation and reverses e ......" | 26283050 |
hsa-miR-138-5p | lung squamous cell cancer | GNB2 | "miR 138 5p reverses gefitinib resistance in non sm ......" | 24582749 |
hsa-miR-138-5p | lung squamous cell cancer | GPR124 | "Bioinformatics analysis and luciferase reporter as ......" | 24582749 |
hsa-miR-138-5p | lung squamous cell cancer | H2AFX | "We noted that both miR-138 and H2AX have been impl ......" | 25699650 |
hsa-miR-138-5p | kidney renal cell cancer | HIF1A | "Western blot and reporter assays were used to asse ......" | 21875287 |
hsa-miR-138-5p | lung squamous cell cancer | INSR | "Finally we were able to show miR-138 overexpressio ......" | 25699650 |
hsa-miR-138-5p | breast cancer | KDM5C | "We discovered that KDM5C is overexpressed in breas ......" | 26621457 |
hsa-miR-138-5p | ovarian cancer | LIMK1 | "The results showed that increased Limk1 and decrea ......" | 25190487 |
hsa-miR-138-5p | cervical and endocervical cancer | MET | "In addition increased expression of miR-138 led to ......" | 27049264 |
hsa-miR-138-5p | esophageal cancer | NFASC | "Downregulation of miR 138 sustains NF κB activati ......" | 23319823 |
hsa-miR-138-5p | liver cancer | PCNA | "MiR 138 induces cell cycle arrest by targeting cyc ......" | 22362728 |
hsa-miR-138-5p | lung squamous cell cancer | PDPK1 | "microRNA miR-138 has been recognized as a potentia ......" | 25064732 |
hsa-miR-138-5p | head and neck cancer | RHOC | "We hypothesize that miR-138 can inhibit the functi ......" | 24565984 |
hsa-miR-138-5p | kidney renal cell cancer | RP1 | "MiR 138 suppresses expression of hypoxia inducible ......" | 21875287 |
hsa-miR-138-5p | lung squamous cell cancer | SCLC1 | "In light of these data we sought to characterize t ......" | 25699650 |
hsa-miR-138-5p | lung squamous cell cancer | SEMA4C | "MiR 138 inhibits cell proliferation and reverses e ......" | 26283050 |
hsa-miR-138-5p | lung cancer | SENP1 | "Then we investigated the underlying mechanisms res ......" | 24691972 |
hsa-miR-138-5p | ovarian cancer | SOX4 | "Results indicated that miR-138 directly targeted S ......" | 23389731 |
hsa-miR-138-5p | liver cancer | SOX9 | "miR 138 suppresses cell proliferation and invasion ......" | 27347323 |
hsa-miR-138-5p | head and neck cancer | SRC | "Furthermore a significant down regulation was obse ......" | 24565984 |
hsa-miR-138-5p | thyroid cancer | TERT | "Downregulation of miR 138 is associated with overe ......" | 18201269 |
hsa-miR-138-5p | esophageal cancer | TRAF2 | "Silencing miR-138 promoted K63-linked polyubiquiti ......" | 23319823 |
hsa-miR-138-5p | colorectal cancer | TWIST2 | "Down regulation of miR 138 promotes colorectal can ......" | 24171926 |
hsa-miR-138-5p | lung squamous cell cancer | YAP1 | "We further identified YAP1 as a direct target gene ......" | 27223073 |
Expression profile in cancer corhorts: