microRNA information: hsa-miR-139-3p

SectionIDlink
Mature name: hsa-miR-139-3pmiRbase
Accession: MIMAT0004552miRbase
Precursor name: hsa-mir-139 miRbase
Precursor accession: MI0000261miRbase
Symbol: MIR139HGNC
RefSeq ID: NR_029603GenBank
Sequence: UGGAGACGCGGCCCUGUUGGAGU



Reported expression in cancers: hsa-miR-139-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-139-3p

cervical and endocervical cancerderegulation"In this study we aimed to analyze the effect on an ......"27505862qPCR
hsa-miR-139-3p

colorectal cancerdownregulation"MiR 139 inhibits invasion and metastasis of colore ......"22580051
hsa-miR-139-3p

colorectal cancerdownregulation"The expression levels of miR-139 in colorectal car ......"22642900qPCR
hsa-miR-139-3p

colorectal cancerdownregulation"Gene module based regulator inference identifying ......"25286864
hsa-miR-139-3p

esophageal cancerderegulation"miRNA high-throughput sequencing data were downloa ......"26498375RNA-Seq
hsa-miR-139-3p

glioblastomadownregulation"We used high-throughput sequencing to comprehensiv ......"21912681RNA-Seq
hsa-miR-139-3p

head and neck cancerderegulation"MicroRNA alterations that consistently identified ......"19753298
hsa-miR-139-3p

liver cancerdownregulation"We investigated mechanisms of hepatocellular carci ......"20951699
hsa-miR-139-3p

liver cancerdownregulation"miR-139 suppressed the luciferase activity of the ......"23001723
hsa-miR-139-3p

lung squamous cell cancerdownregulation"Histone methylation mediated silencing of miR 139 ......"26256448
hsa-miR-139-3p

lymphomadownregulation"Clinical and epidemiological data suggest that chr ......"22307176Reverse transcription PCR; in situ hybridization
hsa-miR-139-3p

pancreatic cancerupregulation"miR 139 and miR 200c regulate pancreatic cancer en ......"25955258Microarray; qPCR
hsa-miR-139-3p

thyroid cancerdownregulation"Of these miR-296 and miR-139 were down-regulated a ......"19926710



Reported cancer pathway affected by hsa-miR-139-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-139-3p

cervical and endocervical cancerApoptosis pathway"MiR 139 3p induces cell apoptosis and inhibits met ......"27505862Luciferase
hsa-miR-139-3p

colorectal cancercell cycle pathway"Gene module based regulator inference identifying ......"25286864
hsa-miR-139-3p

colorectal cancerEpithelial mesenchymal transition pathway"miR 139 5p Inhibits the Epithelial Mesenchymal Tra ......"27244080
hsa-miR-139-3p

gastric cancerApoptosis pathway"In this study we report the identification of a no ......"25499265
hsa-miR-139-3p

glioblastomacell cycle pathway"MicroRNA 139 5p acts as a tumor suppressor by targ ......"26449464
hsa-miR-139-3p

liver cancerApoptosis pathway"miR 139 regulates the proliferation and invasion o ......"24190507Luciferase
hsa-miR-139-3p

liver cancerEpithelial mesenchymal transition pathway"miR 139 5p inhibits epithelial mesenchymal transit ......"26022123



Reported cancer prognosis affected by hsa-miR-139-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-139-3p

bladder cancercell migration"Dual tumor suppressors miR 139 5p and miR 139 3p t ......"27355528Luciferase
hsa-miR-139-3p

breast cancerworse prognosis; drug resistance"The aim of this study was to investigate the role ......"27746365
hsa-miR-139-3p

cervical and endocervical cancermetastasis; progression"MiR 139 3p induces cell apoptosis and inhibits met ......"27505862Luciferase
hsa-miR-139-3p

colon cancerworse prognosis; staging; poor survival"MicroRNA 139 3p indicates a poor prognosis of colo ......"25550849
hsa-miR-139-3p

colorectal cancermetastasis"To identify miRNA expression patterns associated w ......"21174058
hsa-miR-139-3p

colorectal cancermetastasis; progression"MiR 139 inhibits invasion and metastasis of colore ......"22580051
hsa-miR-139-3p

colorectal cancerstaging; poor survival"Regulation of RAP1B by miR 139 suppresses human co ......"22642900RNAi
hsa-miR-139-3p

colorectal cancerstaging; metastasis"The miRNA expression profiles of CRC tissues match ......"22970014
hsa-miR-139-3p

colorectal cancerstaging"In addition a panel of 3 plasma miRNAs miR-431 miR ......"24022433
hsa-miR-139-3p

colorectal cancerstaging"Gene module based regulator inference identifying ......"25286864
hsa-miR-139-3p

colorectal cancerdrug resistance"MiR 139 5p reverses CD44+/CD133+ associated multid ......"27738333
hsa-miR-139-3p

gastric cancermetastasis"HER2 interacts with CD44 to up regulate CXCR4 via ......"21925125
hsa-miR-139-3p

gastric cancercell migration"In this study we report the identification of a no ......"25499265
hsa-miR-139-3p

liver cancermetastasis; progression; worse prognosis; differentiation; cell migration; motility"The microRNA miR 139 suppresses metastasis and pro ......"20951699
hsa-miR-139-3p

liver cancermetastasis; cell migration"Derepression of c Fos caused by microRNA 139 down ......"23001723Western blot; Luciferase
hsa-miR-139-3p

liver cancerpoor survival"Downregulation of microRNA 139 is associated with ......"24549282
hsa-miR-139-3p

lung squamous cell cancermetastasis"Histone methylation mediated silencing of miR 139 ......"26256448
hsa-miR-139-3p

pancreatic cancercell migration"miR 139 and miR 200c regulate pancreatic cancer en ......"25955258



Reported gene related to hsa-miR-139-3p

miRNAcancergenereportingPUBMED
hsa-miR-139-3p

breast cancerNOTCH1"MiR 139 5p inhibits the biological function of bre ......"26299922
hsa-miR-139-3p

colorectal cancerNOTCH1"miR 139 5p sensitizes colorectal cancer cells to 5 ......"27173050
hsa-miR-139-3p

colorectal cancerNOTCH1"MiR 139 5p inhibits migration and invasion of colo ......"25149074
hsa-miR-139-3p

colorectal cancerNOTCH1"MiR 139 5p reverses CD44+/CD133+ associated multid ......"27738333
hsa-miR-139-3p

colorectal cancerNOTCH1"microRNA 139 5p exerts tumor suppressor function b ......"24885920
hsa-miR-139-3p

colorectal cancerAMFR"MiR 139 5p inhibits migration and invasion of colo ......"25149074
hsa-miR-139-3p

colorectal cancerBCL2"miR 139 5p Inhibits the Epithelial Mesenchymal Tra ......"27244080
hsa-miR-139-3p

glioblastomaELTD1"MicroRNA 139 5p acts as a tumor suppressor by targ ......"26449464
hsa-miR-139-3p

colorectal cancerETS1"A known oncogene ETS1 a key transcription factor i ......"25286864
hsa-miR-139-3p

liver cancerFOS"Derepression of c Fos caused by microRNA 139 down ......"23001723
hsa-miR-139-3p

gastric cancerJUN"In this study we report the identification of a no ......"25499265
hsa-miR-139-3p

bladder cancerMMP11"The matrix metalloprotease 11 gene MMP11 was ident ......"27355528
hsa-miR-139-3p

colorectal cancerMMP2"We also found miR-139 directed migration inactivat ......"22580051
hsa-miR-139-3p

colorectal cancerNFASC"Targeted deletion of miR 139 5p activates MAPK NF ......"26859226
hsa-miR-139-3p

cervical and endocervical cancerNOB1"MiR 139 3p induces cell apoptosis and inhibits met ......"27505862
hsa-miR-139-3p

lung squamous cell cancerPDE2A"MiR-139 is located within the intron of PDE2A and ......"26256448
hsa-miR-139-3p

colorectal cancerRAP1B"Regulation of RAP1B by miR 139 suppresses human co ......"22642900
hsa-miR-139-3p

liver cancerROCK1"The microRNA miR 139 suppresses metastasis and pro ......"20951699
hsa-miR-139-3p

liver cancerROCK2"The microRNA miR 139 suppresses metastasis and pro ......"20951699
hsa-miR-139-3p

colorectal cancerSTAT3"Targeted deletion of miR 139 5p activates MAPK NF ......"26859226
hsa-miR-139-3p

liver cancerTCF7L2"Based on computational and expression analysis we ......"24190507
hsa-miR-139-3p

breast cancerTOP2A"We identified that miR-139 a previous reported ant ......"26079880
hsa-miR-139-3p

liver cancerZEB1"miR 139 5p inhibits epithelial mesenchymal transit ......"26022123
hsa-miR-139-3p

liver cancerZEB2"miR 139 5p inhibits epithelial mesenchymal transit ......"26022123



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-139-3p
CTU1
15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.183; TCGA BRCA -0.131; TCGA COAD -0.122; TCGA HNSC -0.245; TCGA KIRC -0.134; TCGA KIRP -0.113; TCGA LGG -0.075; TCGA LIHC -0.131; TCGA LUAD -0.136; TCGA LUSC -0.192; TCGA OV -0.079; TCGA PAAD -0.101; TCGA PRAD -0.296; TCGA THCA -0.131; TCGA STAD -0.153
hsa-miR-139-3p
METTL2A
12 cancers: BLCA; BRCA; COAD; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.068; TCGA BRCA -0.109; TCGA COAD -0.117; TCGA KIRP -0.053; TCGA LIHC -0.103; TCGA LUAD -0.075; TCGA LUSC -0.149; TCGA OV -0.063; TCGA PRAD -0.057; TCGA SARC -0.064; TCGA STAD -0.122; TCGA UCEC -0.071
hsa-miR-139-3p
MSI1
11 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
PITA
TCGA BLCA -0.254; TCGA BRCA -0.124; TCGA HNSC -0.277; TCGA LGG -0.176; TCGA LIHC -0.561; TCGA LUAD -0.391; TCGA LUSC -0.577; TCGA OV -0.229; TCGA PRAD -0.219; TCGA SARC -0.467; TCGA UCEC -0.161
hsa-miR-139-3p
CPT1B
11 cancers: BLCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; UCEC
PITA
TCGA BLCA -0.199; TCGA CESC -0.153; TCGA COAD -0.179; TCGA HNSC -0.111; TCGA KIRP -0.274; TCGA LIHC -0.201; TCGA LUAD -0.31; TCGA LUSC -0.188; TCGA PRAD -0.433; TCGA THCA -0.38; TCGA UCEC -0.197
hsa-miR-139-3p
LMTK3
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.184; TCGA BRCA -0.19; TCGA HNSC -0.147; TCGA KIRC -0.24; TCGA KIRP -0.364; TCGA LIHC -0.207; TCGA PAAD -0.258; TCGA PRAD -0.128; TCGA THCA -0.255; TCGA STAD -0.182; TCGA UCEC -0.166
hsa-miR-139-3p
HIST2H2AA3
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.187; TCGA BRCA -0.361; TCGA COAD -0.258; TCGA HNSC -0.202; TCGA KIRC -0.325; TCGA LGG -0.154; TCGA LUAD -0.265; TCGA LUSC -0.282; TCGA PAAD -0.351; TCGA PRAD -0.158; TCGA THCA -0.283; TCGA UCEC -0.233
hsa-miR-139-3p
TFAP2A
11 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.238; TCGA BRCA -0.266; TCGA ESCA -0.511; TCGA HNSC -0.077; TCGA LIHC -0.485; TCGA LUAD -0.387; TCGA LUSC -0.771; TCGA PAAD -0.764; TCGA THCA -0.12; TCGA STAD -0.43; TCGA UCEC -0.49
hsa-miR-139-3p
SOX11
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.276; TCGA BRCA -0.557; TCGA CESC -0.369; TCGA ESCA -0.659; TCGA HNSC -0.438; TCGA LGG -0.147; TCGA LIHC -0.504; TCGA LUAD -0.289; TCGA LUSC -0.459; TCGA PAAD -0.576; TCGA THCA -0.883; TCGA STAD -0.387
hsa-miR-139-3p
MCRS1
10 cancers: BLCA; BRCA; COAD; KIRP; LIHC; LUAD; LUSC; OV; PRAD; UCEC
miRNATAP
TCGA BLCA -0.064; TCGA BRCA -0.062; TCGA COAD -0.107; TCGA KIRP -0.082; TCGA LIHC -0.218; TCGA LUAD -0.076; TCGA LUSC -0.07; TCGA OV -0.088; TCGA PRAD -0.107; TCGA UCEC -0.062
hsa-miR-139-3p
PABPC1L
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.335; TCGA BRCA -0.066; TCGA CESC -0.239; TCGA COAD -0.212; TCGA HNSC -0.555; TCGA KIRC -0.311; TCGA KIRP -0.407; TCGA LGG -0.162; TCGA LIHC -0.438; TCGA LUAD -0.419; TCGA LUSC -0.222; TCGA PRAD -0.437; TCGA SARC -0.163; TCGA THCA -0.312; TCGA STAD -0.382; TCGA UCEC -0.188
hsa-miR-139-3p
SOX4
15 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.203; TCGA BRCA -0.175; TCGA ESCA -0.166; TCGA HNSC -0.097; TCGA KIRP -0.287; TCGA LGG -0.104; TCGA LIHC -0.336; TCGA LUAD -0.223; TCGA LUSC -0.224; TCGA PAAD -0.296; TCGA PRAD -0.178; TCGA SARC -0.177; TCGA THCA -0.468; TCGA STAD -0.35; TCGA UCEC -0.134
hsa-miR-139-3p
NOX4
11 cancers: BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.082; TCGA ESCA -0.453; TCGA HNSC -0.175; TCGA LGG -0.248; TCGA LIHC -0.327; TCGA LUAD -0.109; TCGA LUSC -0.189; TCGA PAAD -0.53; TCGA PRAD -0.613; TCGA THCA -0.511; TCGA STAD -0.254
hsa-miR-139-3p
BMP1
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; THCA; STAD
miRNATAP
TCGA BRCA -0.066; TCGA ESCA -0.287; TCGA HNSC -0.168; TCGA KIRC -0.24; TCGA KIRP -0.371; TCGA LGG -0.15; TCGA PAAD -0.182; TCGA THCA -0.268; TCGA STAD -0.187
hsa-miR-139-3p
NOB1
11 cancers: COAD; ESCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; THCA; STAD
MirTarget
TCGA COAD -0.126; TCGA ESCA -0.094; TCGA KIRC -0.097; TCGA KIRP -0.055; TCGA LGG -0.053; TCGA LUSC -0.159; TCGA OV -0.077; TCGA PAAD -0.114; TCGA PRAD -0.055; TCGA THCA -0.068; TCGA STAD -0.171
hsa-miR-139-3p
ATP5G2
10 cancers: COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA
miRNATAP
TCGA COAD -0.104; TCGA KIRC -0.19; TCGA KIRP -0.053; TCGA LIHC -0.13; TCGA LUAD -0.054; TCGA LUSC -0.082; TCGA OV -0.113; TCGA PAAD -0.068; TCGA PRAD -0.171; TCGA THCA -0.053





Enriched cancer pathways of putative targets