microRNA information: hsa-miR-141-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-141-5p | miRbase |
| Accession: | MIMAT0004598 | miRbase |
| Precursor name: | hsa-mir-141 | miRbase |
| Precursor accession: | MI0000457 | miRbase |
| Symbol: | MIR141 | HGNC |
| RefSeq ID: | NR_029682 | GenBank |
| Sequence: | CAUCUUCCAGUACAGUGUUGGA |
Reported expression in cancers: hsa-miR-141-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-141-5p | bladder cancer | upregulation | "Increased miR 141 expression is associated with di ......" | 25304156 | qPCR |
| hsa-miR-141-5p | breast cancer | downregulation | "Circulating miR 200c and miR 141 and outcomes in p ......" | 25885099 | Reverse transcription PCR |
| hsa-miR-141-5p | breast cancer | downregulation | "Expression levels of miR-200a miR-200b miR-200c mi ......" | 26201425 | qPCR |
| hsa-miR-141-5p | cervical and endocervical cancer | upregulation | "Vote-counting analysis showed that up-regulation w ......" | 25920605 | |
| hsa-miR-141-5p | colorectal cancer | deregulation | "Differential expression of serum miR 126 miR 141 a ......" | 24653631 | qPCR |
| hsa-miR-141-5p | endometrial cancer | upregulation | "We evaluated the differential expressions of miRNA ......" | 21035172 | Microarray |
| hsa-miR-141-5p | esophageal cancer | downregulation | "The relative expression of some candidate miRNAs w ......" | 24155113 | qPCR |
| hsa-miR-141-5p | gastric cancer | downregulation | "Down regulation of miR 141 in gastric cancer and i ......" | 19363643 | qPCR |
| hsa-miR-141-5p | gastric cancer | downregulation | "Here we report that the miR-200 family members miR ......" | 25502084 | |
| hsa-miR-141-5p | gastric cancer | downregulation | "Prognostic value of miR 141 downregulation in gast ......" | 26681225 | Reverse transcription PCR |
| hsa-miR-141-5p | gastric cancer | downregulation | "Anti proliferative role and prognostic implication ......" | 27648145 | |
| hsa-miR-141-5p | head and neck cancer | deregulation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | qPCR; Microarray |
| hsa-miR-141-5p | kidney renal cell cancer | downregulation | "Genome wide microRNA expression profiling in renal ......" | 18925646 | Microarray; qPCR |
| hsa-miR-141-5p | kidney renal cell cancer | downregulation | "A possible role for microRNA 141 down regulation i ......" | 23206420 | qPCR; in situ hybridization |
| hsa-miR-141-5p | kidney renal cell cancer | downregulation | "Our recent studies of microRNA miRNA expression si ......" | 23635949 | |
| hsa-miR-141-5p | kidney renal cell cancer | downregulation | "We performed microarray-based miRNA profiling of c ......" | 24647573 | Microarray |
| hsa-miR-141-5p | liver cancer | downregulation | "The expressions of miR-200c and miR-141 were downr ......" | 24135722 | |
| hsa-miR-141-5p | liver cancer | downregulation | "Expression of the microRNA-200 family was investig ......" | 26447841 | qPCR |
| hsa-miR-141-5p | melanoma | upregulation | "Arsenic exposed Keratinocytes Exhibit Differential ......" | 27054085 | qPCR |
| hsa-miR-141-5p | ovarian cancer | upregulation | "To identify the micro-ribonucleic acids miRNAs exp ......" | 24816756 | qPCR |
| hsa-miR-141-5p | pancreatic cancer | downregulation | "In this study we explored the role of miR-141 in p ......" | 24013097 | |
| hsa-miR-141-5p | prostate cancer | upregulation | "Three of these hsa-miR-141 hsa-miR-298 and hsa-miR ......" | 22052531 | |
| hsa-miR-141-5p | prostate cancer | upregulation | "Aberrant expressions of microRNAs including upregu ......" | 22314666 | |
| hsa-miR-141-5p | prostate cancer | upregulation | "Exosomal microRNA 141 is upregulated in the serum ......" | 26770063 | Reverse transcription PCR |
| hsa-miR-141-5p | thyroid cancer | downregulation | "microRNA-141 miR-141 a member of the miR-200 famil ......" | 27186273 |
Reported cancer pathway affected by hsa-miR-141-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-141-5p | breast cancer | Apoptosis pathway | "miR 141 confers docetaxel chemoresistance of breas ......" | 25813250 | Luciferase |
| hsa-miR-141-5p | colon cancer | Apoptosis pathway | "By performing MTT wound-healing and Transwell migr ......" | 27460529 | Flow cytometry; Cell migration assay |
| hsa-miR-141-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "Induction of epithelial mesenchymal transition and ......" | 25757925 | |
| hsa-miR-141-5p | colorectal cancer | cell cycle pathway | "MicroRNA 141 regulates the tumour suppressor DLC1 ......" | 26278151 | Transwell assay; Western blot; Luciferase |
| hsa-miR-141-5p | esophageal cancer | Apoptosis pathway | "MicroRNA 141 confers resistance to cisplatin induc ......" | 21289630 | |
| hsa-miR-141-5p | esophageal cancer | Wnt signaling pathway | "Inhibition of SOX17 by microRNA 141 and methylatio ......" | 22921431 | Western blot; Luciferase; Colony formation |
| hsa-miR-141-5p | gastric cancer | cell cycle pathway; Apoptosis pathway | "MiR 141 Inhibits Gastric Cancer Proliferation by I ......" | 26233544 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-141-5p | gastric cancer | cell cycle pathway | "Anti proliferative role and prognostic implication ......" | 27648145 | Colony formation |
| hsa-miR-141-5p | kidney renal cell cancer | Epithelial mesenchymal transition pathway | "Our recent studies of microRNA miRNA expression si ......" | 23635949 | |
| hsa-miR-141-5p | liver cancer | Apoptosis pathway | "microRNA 141 inhibits cell proliferation and invas ......" | 25425543 | Western blot; Luciferase |
| hsa-miR-141-5p | liver cancer | Apoptosis pathway | "MiR 141 Activates Nrf2 Dependent Antioxidant Pathw ......" | 25896253 | |
| hsa-miR-141-5p | lung squamous cell cancer | PI3K/Akt signaling pathway | "MicroRNA 141 promotes the proliferation of non sma ......" | 24945731 | |
| hsa-miR-141-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "The difference in miRNA expression profiles betwee ......" | 26783187 | |
| hsa-miR-141-5p | lung squamous cell cancer | Apoptosis pathway | "Inhibition of miR 141 reverses cisplatin resistanc ......" | 27383306 | Western blot; MTT assay; Luciferase |
| hsa-miR-141-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "Both resistant variants display a strong epithelia ......" | 26025631 | |
| hsa-miR-141-5p | pancreatic cancer | Apoptosis pathway | "In this study we explored the role of miR-141 in p ......" | 24013097 | Luciferase; Western blot |
| hsa-miR-141-5p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "hsa miR 141 downregulates TM4SF1 to inhibit pancre ......" | 24285464 | Western blot; Flow cytometry; Luciferase |
| hsa-miR-141-5p | sarcoma | Apoptosis pathway | "Tumor suppressing effects of miR 141 in human oste ......" | 24307282 | |
| hsa-miR-141-5p | thyroid cancer | Apoptosis pathway | "microRNA 141 inhibits thyroid cancer cell growth a ......" | 27186273 |
Reported cancer prognosis affected by hsa-miR-141-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-141-5p | bladder cancer | worse prognosis | "Quantitative real-time PCR was applied to measure ......" | 23266581 | |
| hsa-miR-141-5p | bladder cancer | malignant trasformation; poor survival | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
| hsa-miR-141-5p | bladder cancer | worse prognosis; staging; malignant trasformation; poor survival; progression | "Increased miR 141 expression is associated with di ......" | 25304156 | |
| hsa-miR-141-5p | bladder cancer | malignant trasformation | "Association between tissue miR 141 miR 200c and mi ......" | 25703910 | |
| hsa-miR-141-5p | bladder cancer | malignant trasformation | "Evaluation of miR 141 miR 200c miR 30b Expression ......" | 25815280 | |
| hsa-miR-141-5p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
| hsa-miR-141-5p | breast cancer | drug resistance | "MiRNA microarray analysis identified 299 and 226 m ......" | 21399894 | |
| hsa-miR-141-5p | breast cancer | metastasis | "Whole genome miR array analysis using PELP1-overex ......" | 23975430 | |
| hsa-miR-141-5p | breast cancer | differentiation | "Progesterone downregulation of miR 141 contributes ......" | 25241899 | |
| hsa-miR-141-5p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
| hsa-miR-141-5p | breast cancer | drug resistance | "miR 141 confers docetaxel chemoresistance of breas ......" | 25813250 | Luciferase |
| hsa-miR-141-5p | breast cancer | staging; metastasis; progression; poor survival | "Circulating miR 200c and miR 141 and outcomes in p ......" | 25885099 | |
| hsa-miR-141-5p | breast cancer | metastasis | "We also revealed that KLF8 directly represses the ......" | 26025929 | |
| hsa-miR-141-5p | breast cancer | metastasis; progression; poor survival | "miR 141 Mediated Regulation of Brain Metastasis Fr ......" | 27075851 | |
| hsa-miR-141-5p | colon cancer | worse prognosis; staging; poor survival; metastasis | "Circulating plasma MiR 141 is a novel biomarker fo ......" | 21445232 | |
| hsa-miR-141-5p | colorectal cancer | cell migration | "MicroRNA 141 regulates Smad interacting protein 1 ......" | 19830559 | Western blot; Wound Healing Assay; Luciferase |
| hsa-miR-141-5p | colorectal cancer | metastasis | "Applying real-time PCR we detected the expression ......" | 21827717 | |
| hsa-miR-141-5p | colorectal cancer | metastasis | "Liver metastasis tissues showed higher expression ......" | 22735571 | |
| hsa-miR-141-5p | colorectal cancer | staging | "Genome-wide microarray analysis of miRNA expressio ......" | 23673725 | |
| hsa-miR-141-5p | colorectal cancer | staging | "Tumor tissue samples were obtained from 127 surgic ......" | 24510588 | |
| hsa-miR-141-5p | colorectal cancer | metastasis; staging | "Differential expression of serum miR 126 miR 141 a ......" | 24653631 | |
| hsa-miR-141-5p | colorectal cancer | drug resistance | "Induction of epithelial mesenchymal transition and ......" | 25757925 | |
| hsa-miR-141-5p | colorectal cancer | progression | "Cancer biopsy colonic mucosa from the resected spe ......" | 25989926 | |
| hsa-miR-141-5p | colorectal cancer | progression | "MicroRNA 141 regulates the tumour suppressor DLC1 ......" | 26278151 | Transwell assay; Western blot; Luciferase |
| hsa-miR-141-5p | colorectal cancer | staging; worse prognosis | "Comprehensive analyses showed that plasma miR-96 d ......" | 26863633 | |
| hsa-miR-141-5p | colorectal cancer | poor survival | "In this study ten candidates were identified using ......" | 27126129 | |
| hsa-miR-141-5p | endometrial cancer | tumorigenesis | "The miRNA profiles were analyzed by miRNA microarr ......" | 24742567 | |
| hsa-miR-141-5p | esophageal cancer | drug resistance | "MicroRNA 141 confers resistance to cisplatin induc ......" | 21289630 | |
| hsa-miR-141-5p | esophageal cancer | drug resistance | "Involvement of microRNA 141 3p in 5 fluorouracil a ......" | 27644195 | MTT assay; Luciferase |
| hsa-miR-141-5p | gastric cancer | motility; progression | "miR 141 suppresses proliferation and motility of g ......" | 24276755 | Colony formation |
| hsa-miR-141-5p | gastric cancer | drug resistance | "Helicobacter pylori modulates cisplatin sensitivit ......" | 24628843 | Western blot; Luciferase |
| hsa-miR-141-5p | gastric cancer | staging; poor survival | "Here we report that the miR-200 family members miR ......" | 25502084 | Wound Healing Assay |
| hsa-miR-141-5p | gastric cancer | metastasis | "MicroRNA 141 inhibits tumor growth and metastasis ......" | 25633292 | |
| hsa-miR-141-5p | gastric cancer | cell migration | "MicroRNA 141 inhibits migration of gastric cancer ......" | 25975736 | Western blot; Wound Healing Assay; Luciferase |
| hsa-miR-141-5p | gastric cancer | staging; metastasis | "In the first step of this study preliminary experi ......" | 26233325 | |
| hsa-miR-141-5p | gastric cancer | malignant trasformation; progression | "MiR 141 Inhibits Gastric Cancer Proliferation by I ......" | 26233544 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-141-5p | gastric cancer | poor survival; staging; metastasis; differentiation; progression; worse prognosis | "Prognostic value of miR 141 downregulation in gast ......" | 26681225 | |
| hsa-miR-141-5p | gastric cancer | worse prognosis; tumor size | "Anti proliferative role and prognostic implication ......" | 27648145 | Colony formation |
| hsa-miR-141-5p | head and neck cancer | malignant trasformation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | |
| hsa-miR-141-5p | kidney papillary renal cell cancer | staging; poor survival | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-141-5p | kidney renal cell cancer | malignant trasformation | "We performed genome-wide expression profiling of m ......" | 19228262 | |
| hsa-miR-141-5p | kidney renal cell cancer | metastasis; malignant trasformation | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 | |
| hsa-miR-141-5p | kidney renal cell cancer | drug resistance | "A possible role for microRNA 141 down regulation i ......" | 23206420 | |
| hsa-miR-141-5p | kidney renal cell cancer | metastasis | "miR 141 is a key regulator of renal cell carcinoma ......" | 24647573 | |
| hsa-miR-141-5p | kidney renal cell cancer | poor survival | "Using vote-counting strategy and robust rank aggre ......" | 25974855 | |
| hsa-miR-141-5p | liver cancer | poor survival | "The expressions of miR-200c and miR-141 were downr ......" | 24135722 | |
| hsa-miR-141-5p | liver cancer | drug resistance | "MiR 141 Activates Nrf2 Dependent Antioxidant Pathw ......" | 25896253 | |
| hsa-miR-141-5p | liver cancer | metastasis; progression; tumorigenesis | "Direct targeting sperm associated antigen 9 by miR ......" | 26790956 | Western blot; Luciferase; Cell migration assay |
| hsa-miR-141-5p | lung squamous cell cancer | tumorigenesis | "MicroRNA 141 promotes the proliferation of non sma ......" | 24945731 | |
| hsa-miR-141-5p | lung squamous cell cancer | staging; poor survival; cell migration | "miR 141 and miR 200c as markers of overall surviva ......" | 25003366 | |
| hsa-miR-141-5p | lung squamous cell cancer | drug resistance | "The difference in miRNA expression profiles betwee ......" | 26783187 | |
| hsa-miR-141-5p | lung squamous cell cancer | drug resistance | "Inhibition of miR 141 reverses cisplatin resistanc ......" | 27383306 | Western blot; MTT assay; Luciferase |
| hsa-miR-141-5p | melanoma | tumorigenesis | "Arsenic exposed Keratinocytes Exhibit Differential ......" | 27054085 | |
| hsa-miR-141-5p | ovarian cancer | worse prognosis | "The microRNA expression profiles were examined usi ......" | 18451233 | |
| hsa-miR-141-5p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
| hsa-miR-141-5p | ovarian cancer | drug resistance | "miR 141 regulates KEAP1 and modulates cisplatin se ......" | 23045278 | |
| hsa-miR-141-5p | ovarian cancer | progression | "The aberrant expression of the miR-200 family miR- ......" | 24952258 | |
| hsa-miR-141-5p | ovarian cancer | staging; poor survival; worse prognosis | "MicroRNA 200c and microRNA 141 as potential diagno ......" | 25636451 | |
| hsa-miR-141-5p | ovarian cancer | drug resistance | "Both resistant variants display a strong epithelia ......" | 26025631 | |
| hsa-miR-141-5p | ovarian cancer | drug resistance | "Analysis of microarray identified genes and microR ......" | 26261572 | |
| hsa-miR-141-5p | ovarian cancer | progression | "Suppression of SIK1 by miR 141 in human ovarian ca ......" | 27081781 | |
| hsa-miR-141-5p | pancreatic cancer | staging; metastasis; tumor size; poor survival | "In this study we explored the role of miR-141 in p ......" | 24013097 | Luciferase; Western blot |
| hsa-miR-141-5p | pancreatic cancer | progression | "hsa miR 141 downregulates TM4SF1 to inhibit pancre ......" | 24285464 | Western blot; Flow cytometry; Luciferase |
| hsa-miR-141-5p | pancreatic cancer | staging | "In addition from 10 to 50 weeks of age stage-speci ......" | 26516699 | |
| hsa-miR-141-5p | prostate cancer | staging | "Investigation of miR 21 miR 141 and miR 221 in blo ......" | 21274675 | |
| hsa-miR-141-5p | prostate cancer | drug resistance; progression | "Comparison of circulating MicroRNA 141 to circulat ......" | 21723797 | |
| hsa-miR-141-5p | prostate cancer | progression | "Three of these hsa-miR-141 hsa-miR-298 and hsa-miR ......" | 22052531 | |
| hsa-miR-141-5p | prostate cancer | tumorigenesis; malignant trasformation | "miR 141 modulates androgen receptor transcriptiona ......" | 22314666 | |
| hsa-miR-141-5p | prostate cancer | metastasis | "An elevated serum miR 141 level in patients with b ......" | 23377530 | |
| hsa-miR-141-5p | prostate cancer | drug resistance | "Label free and reagentless electrochemical detecti ......" | 23743328 | |
| hsa-miR-141-5p | prostate cancer | recurrence; progression | "MicroRNAs in the serum of patients who had experie ......" | 23846169 | |
| hsa-miR-141-5p | prostate cancer | recurrence | "Investigation of miR 21 miR 141 and miR 221 expres ......" | 25252191 | |
| hsa-miR-141-5p | prostate cancer | worse prognosis | "Promising preliminary results were published conce ......" | 26751899 | |
| hsa-miR-141-5p | prostate cancer | staging | "Expression levels of five miRNAs miR-19b miR-21 mi ......" | 27753010 | |
| hsa-miR-141-5p | sarcoma | tumorigenesis | "Tumor suppressing effects of miR 141 in human oste ......" | 24307282 | |
| hsa-miR-141-5p | sarcoma | metastasis; motility | "Paeonol suppresses chondrosarcoma metastasis throu ......" | 24992595 | |
| hsa-miR-141-5p | thyroid cancer | metastasis; staging | "microRNA 141 inhibits thyroid cancer cell growth a ......" | 27186273 |
Reported gene related to hsa-miR-141-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-141-5p | gastric cancer | KEAP1 | "We also demonstrated that miR-141 directly targets ......" | 24628843 |
| hsa-miR-141-5p | liver cancer | KEAP1 | "MiR 141 Activates Nrf2 Dependent Antioxidant Pathw ......" | 25896253 |
| hsa-miR-141-5p | ovarian cancer | KEAP1 | "miR 141 regulates KEAP1 and modulates cisplatin se ......" | 23045278 |
| hsa-miR-141-5p | head and neck cancer | ZEB1 | "Accordingly the enforced expression of miR-200c an ......" | 24424572 |
| hsa-miR-141-5p | lung squamous cell cancer | ZEB1 | "Nintedanib was able to reverse TGF-β1-induced EMT ......" | 26783187 |
| hsa-miR-141-5p | sarcoma | ZEB1 | "It is estimated that miR-141 played its role via Z ......" | 24307282 |
| hsa-miR-141-5p | gastric cancer | ZEB2 | "These results suggest that miR‑141 may be involv ......" | 25975736 |
| hsa-miR-141-5p | kidney renal cell cancer | ZEB2 | "TargetScan algorithm revealed that ZFHX1B mRNA is ......" | 18925646 |
| hsa-miR-141-5p | sarcoma | ZEB2 | "It is estimated that miR-141 played its role via Z ......" | 24307282 |
| hsa-miR-141-5p | prostate cancer | AR | "miR 141 3p regulates the expression of androgen re ......" | 26062412 |
| hsa-miR-141-5p | prostate cancer | AR | "miR 141 modulates androgen receptor transcriptiona ......" | 22314666 |
| hsa-miR-141-5p | gastric cancer | CDH1 | "We also found that miR-200c and miR-141 directly t ......" | 25502084 |
| hsa-miR-141-5p | head and neck cancer | CDH1 | "Accordingly the enforced expression of miR-200c an ......" | 24424572 |
| hsa-miR-141-5p | endometrial cancer | PTEN | "PTEN might be a potential target of miR-141 and mi ......" | 24742567 |
| hsa-miR-141-5p | esophageal cancer | PTEN | "Involvement of microRNA 141 3p in 5 fluorouracil a ......" | 27644195 |
| hsa-miR-141-5p | colon cancer | CEACAM5 | "We observed that combination of miR-141 and carcin ......" | 21445232 |
| hsa-miR-141-5p | prostate cancer | CTAG1B | "Prostate cancer antigen 3 PCA3 and microRNA-141 mi ......" | 25685739 |
| hsa-miR-141-5p | breast cancer | CTNNB1 | "miR-141 expression level was downregulated in MDA- ......" | 26164002 |
| hsa-miR-141-5p | colorectal cancer | DICER1 | "In liver metastases Dicer was positively related t ......" | 21827717 |
| hsa-miR-141-5p | colorectal cancer | DLC1 | "MicroRNA 141 regulates the tumour suppressor DLC1 ......" | 26278151 |
| hsa-miR-141-5p | prostate cancer | DNMT1 | "In PC3 cells miR-200c and miR-141 expression is su ......" | 27198154 |
| hsa-miR-141-5p | prostate cancer | DNMT3A | "The biological significance of miR-200c and miR-14 ......" | 27198154 |
| hsa-miR-141-5p | gastric cancer | E2F3 | "MiR 141 Inhibits Gastric Cancer Proliferation by I ......" | 26233544 |
| hsa-miR-141-5p | breast cancer | EGFR | "Treatment with the EGFR inhibitor AG1478 or overex ......" | 26025929 |
| hsa-miR-141-5p | breast cancer | EIF4E | "miR 141 confers docetaxel chemoresistance of breas ......" | 25813250 |
| hsa-miR-141-5p | kidney renal cell cancer | EPHA2 | "miR 141 is a key regulator of renal cell carcinoma ......" | 24647573 |
| hsa-miR-141-5p | ovarian cancer | EPHA7 | "Among those the expression of EPHA7 and PI15 were ......" | 26261572 |
| hsa-miR-141-5p | breast cancer | ERBB2 | "MiR-141 was significantly higher in the blood of p ......" | 25885099 |
| hsa-miR-141-5p | gastric cancer | H19 | "The Interaction Between MiR 141 and lncRNA H19 in ......" | 26160158 |
| hsa-miR-141-5p | gastric cancer | HDGF | "miR 141 suppresses proliferation and motility of g ......" | 24276755 |
| hsa-miR-141-5p | prostate cancer | HK3 | "miR-21 and miR-141 were quantified through real-ti ......" | 24288670 |
| hsa-miR-141-5p | gastric cancer | IGF1R | "Insulin-like growth factor 1 receptor IGF1R was ov ......" | 27648145 |
| hsa-miR-141-5p | breast cancer | IL6 | "In addition dysregulated miR-200b/c and miR-141 et ......" | 25270211 |
| hsa-miR-141-5p | thyroid cancer | INSR | "microRNA 141 inhibits thyroid cancer cell growth a ......" | 27186273 |
| hsa-miR-141-5p | thyroid cancer | IRS2 | "Forced expression of IRS2 reversed the inhibition ......" | 27186273 |
| hsa-miR-141-5p | prostate cancer | KLK11 | "The aim of our study was to monitor serum levels o ......" | 24288670 |
| hsa-miR-141-5p | pancreatic cancer | MAP4K4 | "To understand how miR-141 mediates the phenotype o ......" | 24013097 |
| hsa-miR-141-5p | liver cancer | MAPK8 | "Direct targeting sperm associated antigen 9 by miR ......" | 26790956 |
| hsa-miR-141-5p | gastric cancer | MEG3 | "MiR 141 Inhibits Gastric Cancer Proliferation by I ......" | 26233544 |
| hsa-miR-141-5p | prostate cancer | NR0B2 | "miR 141 modulates androgen receptor transcriptiona ......" | 22314666 |
| hsa-miR-141-5p | prostate cancer | PCA3 | "Androgen Stimulation of PCA3 and miR 141 and Their ......" | 25685739 |
| hsa-miR-141-5p | lung squamous cell cancer | PDCD4 | "Luciferase activity assay was employed to validate ......" | 27383306 |
| hsa-miR-141-5p | breast cancer | PELP1 | "Whole genome miR array analysis using PELP1-overex ......" | 23975430 |
| hsa-miR-141-5p | breast cancer | PGR | "Progesterone downregulation of miR 141 contributes ......" | 25241899 |
| hsa-miR-141-5p | lung squamous cell cancer | PHLPP1 | "MicroRNA 141 promotes the proliferation of non sma ......" | 24945731 |
| hsa-miR-141-5p | lung squamous cell cancer | PHLPP2 | "MicroRNA 141 promotes the proliferation of non sma ......" | 24945731 |
| hsa-miR-141-5p | ovarian cancer | PI15 | "Among those the expression of EPHA7 and PI15 were ......" | 26261572 |
| hsa-miR-141-5p | sarcoma | PRKCD | "Since paeonol inhibits migration and invasion of h ......" | 24992595 |
| hsa-miR-141-5p | kidney renal cell cancer | SEMA6A | "The regulation of SEMA6A by miR-141 was verified b ......" | 20420713 |
| hsa-miR-141-5p | ovarian cancer | SIK1 | "Suppression of SIK1 by miR 141 in human ovarian ca ......" | 27081781 |
| hsa-miR-141-5p | breast cancer | SLC10A4 | "Here we investigated P4 downregulation of miR-141 ......" | 25241899 |
| hsa-miR-141-5p | esophageal cancer | SOX17 | "Inhibition of SOX17 by microRNA 141 and methylatio ......" | 22921431 |
| hsa-miR-141-5p | liver cancer | SPAG9 | "SPAG9 and miR-141 expression were detected in HCC ......" | 26790956 |
| hsa-miR-141-5p | sarcoma | SRC | "Paeonol suppresses chondrosarcoma metastasis throu ......" | 24992595 |
| hsa-miR-141-5p | gastric cancer | STAT4 | "Down regulation of miR 141 induced by helicobacter ......" | 24732377 |
| hsa-miR-141-5p | breast cancer | STAT5A | "Progesterone downregulation of miR 141 contributes ......" | 25241899 |
| hsa-miR-141-5p | gastric cancer | TAZ | "MicroRNA 141 inhibits tumor growth and metastasis ......" | 25633292 |
| hsa-miR-141-5p | pancreatic cancer | TM4SF1 | "hsa miR 141 downregulates TM4SF1 to inhibit pancre ......" | 24285464 |
| hsa-miR-141-5p | kidney renal cell cancer | VEGFA | "We also found strong anti-correlation between VEGF ......" | 20420713 |
| hsa-miR-141-5p | esophageal cancer | YAP1 | "MicroRNA 141 confers resistance to cisplatin induc ......" | 21289630 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-141-5p | ELL2 | 10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; OV; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.127; TCGA BRCA -0.098; TCGA ESCA -0.156; TCGA HNSC -0.167; TCGA LIHC -0.13; TCGA LUSC -0.199; TCGA OV -0.153; TCGA THCA -0.129; TCGA STAD -0.192; TCGA UCEC -0.119 |
hsa-miR-141-5p | IL6R | 10 cancers: BLCA; BRCA; COAD; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.207; TCGA BRCA -0.212; TCGA COAD -0.223; TCGA LIHC -0.117; TCGA LUAD -0.117; TCGA LUSC -0.351; TCGA PRAD -0.173; TCGA THCA -0.437; TCGA STAD -0.154; TCGA UCEC -0.159 |
hsa-miR-141-5p | GAB1 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.102; TCGA BRCA -0.081; TCGA CESC -0.139; TCGA ESCA -0.127; TCGA HNSC -0.11; TCGA LUAD -0.202; TCGA LUSC -0.158; TCGA PRAD -0.205; TCGA THCA -0.108; TCGA STAD -0.234; TCGA UCEC -0.221 |
hsa-miR-141-5p | DPYSL3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.575; TCGA BRCA -0.259; TCGA CESC -0.398; TCGA COAD -0.856; TCGA ESCA -0.471; TCGA HNSC -0.117; TCGA LUAD -0.241; TCGA LUSC -0.209; TCGA PAAD -0.229; TCGA PRAD -0.735; TCGA STAD -0.56; TCGA UCEC -0.34 |
hsa-miR-141-5p | ITGA9 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.383; TCGA BRCA -0.293; TCGA CESC -0.514; TCGA COAD -0.589; TCGA ESCA -0.4; TCGA HNSC -0.229; TCGA LUAD -0.195; TCGA LUSC -0.723; TCGA PAAD -0.281; TCGA PRAD -0.842; TCGA STAD -0.459; TCGA UCEC -0.301 |
hsa-miR-141-5p | MRVI1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.438; TCGA BRCA -0.284; TCGA CESC -0.526; TCGA COAD -0.778; TCGA ESCA -0.486; TCGA HNSC -0.291; TCGA LUAD -0.257; TCGA LUSC -0.522; TCGA OV -0.104; TCGA PAAD -0.253; TCGA PRAD -0.961; TCGA THCA -0.409; TCGA STAD -0.59; TCGA UCEC -0.452 |
hsa-miR-141-5p | CDH19 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.515; TCGA BRCA -0.374; TCGA COAD -1.293; TCGA ESCA -0.65; TCGA HNSC -0.271; TCGA LUAD -0.308; TCGA LUSC -0.447; TCGA PRAD -0.912; TCGA STAD -1.021 |
hsa-miR-141-5p | SELE | 11 cancers: BLCA; BRCA; CESC; COAD; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.304; TCGA BRCA -0.237; TCGA CESC -0.368; TCGA COAD -0.6; TCGA LUAD -0.256; TCGA LUSC -0.819; TCGA PAAD -0.426; TCGA PRAD -0.905; TCGA THCA -0.781; TCGA STAD -0.239; TCGA UCEC -0.366 |
hsa-miR-141-5p | PRKAB2 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.097; TCGA BRCA -0.064; TCGA CESC -0.078; TCGA COAD -0.086; TCGA ESCA -0.088; TCGA HNSC -0.135; TCGA PRAD -0.148; TCGA STAD -0.193; TCGA UCEC -0.12 |
hsa-miR-141-5p | KIAA0408 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.623; TCGA BRCA -1.094; TCGA COAD -0.971; TCGA ESCA -0.819; TCGA HNSC -0.575; TCGA LUAD -0.378; TCGA LUSC -1.32; TCGA PAAD -0.396; TCGA PRAD -0.724; TCGA STAD -0.742 |
hsa-miR-141-5p | PAM | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.248; TCGA BRCA -0.22; TCGA CESC -0.19; TCGA COAD -0.279; TCGA ESCA -0.208; TCGA HNSC -0.181; TCGA LUAD -0.086; TCGA LUSC -0.246; TCGA PRAD -0.398; TCGA STAD -0.258 |
hsa-miR-141-5p | ITPRIP | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.195; TCGA BRCA -0.182; TCGA COAD -0.202; TCGA ESCA -0.163; TCGA HNSC -0.097; TCGA LUAD -0.288; TCGA LUSC -0.317; TCGA PAAD -0.24; TCGA PRAD -0.368; TCGA THCA -0.149; TCGA STAD -0.152; TCGA UCEC -0.18 |
hsa-miR-141-5p | CAMK1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.228; TCGA BRCA -0.279; TCGA CESC -0.139; TCGA COAD -0.088; TCGA ESCA -0.158; TCGA HNSC -0.121; TCGA KIRP -0.132; TCGA LIHC -0.077; TCGA LUAD -0.154; TCGA LUSC -0.305; TCGA PAAD -0.24; TCGA THCA -0.1; TCGA STAD -0.211; TCGA UCEC -0.15 |
hsa-miR-141-5p | MCTP1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.247; TCGA BRCA -0.293; TCGA CESC -0.241; TCGA COAD -0.538; TCGA ESCA -0.16; TCGA HNSC -0.138; TCGA LUAD -0.18; TCGA LUSC -0.472; TCGA PAAD -0.334; TCGA PRAD -0.191; TCGA THCA -0.371; TCGA STAD -0.131; TCGA UCEC -0.218 |
hsa-miR-141-5p | GIMAP1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.309; TCGA BRCA -0.313; TCGA CESC -0.291; TCGA COAD -0.417; TCGA ESCA -0.239; TCGA HNSC -0.215; TCGA LUAD -0.307; TCGA LUSC -0.704; TCGA PAAD -0.418; TCGA PRAD -0.373; TCGA THCA -0.367; TCGA UCEC -0.268 |
hsa-miR-141-5p | AP1S2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.356; TCGA BRCA -0.155; TCGA CESC -0.328; TCGA COAD -0.324; TCGA ESCA -0.359; TCGA HNSC -0.265; TCGA LUAD -0.296; TCGA LUSC -0.399; TCGA OV -0.147; TCGA PAAD -0.358; TCGA PRAD -0.386; TCGA THCA -0.241; TCGA STAD -0.434; TCGA UCEC -0.19 |
hsa-miR-141-5p | TAL1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.207; TCGA BRCA -0.396; TCGA CESC -0.349; TCGA COAD -0.5; TCGA ESCA -0.287; TCGA HNSC -0.233; TCGA LUAD -0.345; TCGA LUSC -0.586; TCGA OV -0.113; TCGA PAAD -0.37; TCGA PRAD -0.409; TCGA THCA -0.202; TCGA STAD -0.224; TCGA UCEC -0.412 |
hsa-miR-141-5p | COL3A1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.474; TCGA BRCA -0.109; TCGA CESC -0.548; TCGA COAD -0.648; TCGA ESCA -0.266; TCGA HNSC -0.487; TCGA LUSC -0.226; TCGA OV -0.322; TCGA PAAD -0.315; TCGA PRAD -0.42; TCGA THCA -0.702; TCGA STAD -0.107; TCGA UCEC -0.307 |
hsa-miR-141-5p | CDO1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.6; TCGA BRCA -0.747; TCGA CESC -0.676; TCGA COAD -1.254; TCGA ESCA -0.537; TCGA HNSC -0.309; TCGA LIHC -0.33; TCGA LUAD -0.438; TCGA LUSC -0.897; TCGA PAAD -0.315; TCGA PRAD -0.531; TCGA THCA -0.558; TCGA STAD -0.712; TCGA UCEC -0.621 |
hsa-miR-141-5p | NTNG1 | 11 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.671; TCGA CESC -0.433; TCGA ESCA -0.578; TCGA HNSC -0.547; TCGA LUAD -0.449; TCGA LUSC -1.046; TCGA OV -0.375; TCGA PAAD -0.586; TCGA PRAD -0.201; TCGA STAD -0.808; TCGA UCEC -0.335 |
hsa-miR-141-5p | DSE | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.197; TCGA BRCA -0.227; TCGA COAD -0.172; TCGA ESCA -0.125; TCGA HNSC -0.13; TCGA LUAD -0.19; TCGA LUSC -0.16; TCGA PAAD -0.257; TCGA PRAD -0.185; TCGA THCA -0.211; TCGA STAD -0.141; TCGA UCEC -0.065 |
hsa-miR-141-5p | STAT5A | 11 cancers: BLCA; BRCA; COAD; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.123; TCGA BRCA -0.274; TCGA COAD -0.106; TCGA KIRP -0.068; TCGA LUAD -0.203; TCGA LUSC -0.394; TCGA PAAD -0.143; TCGA PRAD -0.349; TCGA THCA -0.149; TCGA STAD -0.081; TCGA UCEC -0.096 |
hsa-miR-141-5p | ACVRL1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.232; TCGA BRCA -0.286; TCGA CESC -0.345; TCGA COAD -0.153; TCGA ESCA -0.198; TCGA HNSC -0.268; TCGA LUAD -0.318; TCGA LUSC -0.715; TCGA OV -0.147; TCGA PAAD -0.228; TCGA PRAD -0.445; TCGA THCA -0.166; TCGA STAD -0.073; TCGA UCEC -0.183 |
hsa-miR-141-5p | RAB32 | 14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.234; TCGA BRCA -0.136; TCGA COAD -0.142; TCGA ESCA -0.123; TCGA HNSC -0.181; TCGA KIRP -0.073; TCGA LUAD -0.173; TCGA LUSC -0.19; TCGA OV -0.083; TCGA PAAD -0.2; TCGA PRAD -0.325; TCGA THCA -0.252; TCGA STAD -0.116; TCGA UCEC -0.113 |
hsa-miR-141-5p | CARD8 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.05; TCGA BRCA -0.129; TCGA CESC -0.094; TCGA COAD -0.142; TCGA ESCA -0.089; TCGA HNSC -0.121; TCGA LUAD -0.137; TCGA LUSC -0.398; TCGA PAAD -0.227; TCGA THCA -0.081; TCGA STAD -0.093; TCGA UCEC -0.113 |
hsa-miR-141-5p | NRXN1 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.655; TCGA BRCA -0.379; TCGA CESC -0.323; TCGA COAD -1.369; TCGA ESCA -0.708; TCGA LUAD -0.431; TCGA PRAD -0.801; TCGA STAD -1.039; TCGA UCEC -0.574 |
hsa-miR-141-5p | EPDR1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.436; TCGA BRCA -0.404; TCGA CESC -0.508; TCGA COAD -0.37; TCGA ESCA -0.287; TCGA HNSC -0.456; TCGA KIRP -0.099; TCGA LUAD -0.207; TCGA LUSC -0.362; TCGA OV -0.126; TCGA PAAD -0.185; TCGA PRAD -0.232; TCGA STAD -0.247; TCGA UCEC -0.301 |
hsa-miR-141-5p | TACC1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.149; TCGA BRCA -0.375; TCGA CESC -0.259; TCGA COAD -0.14; TCGA ESCA -0.237; TCGA LUAD -0.247; TCGA LUSC -0.321; TCGA PAAD -0.09; TCGA PRAD -0.525; TCGA THCA -0.103; TCGA STAD -0.344; TCGA UCEC -0.407 |
hsa-miR-141-5p | ITGA1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.323; TCGA BRCA -0.257; TCGA CESC -0.285; TCGA COAD -0.194; TCGA ESCA -0.233; TCGA HNSC -0.213; TCGA LIHC -0.053; TCGA LUAD -0.144; TCGA LUSC -0.529; TCGA OV -0.113; TCGA PAAD -0.147; TCGA PRAD -0.677; TCGA THCA -0.18; TCGA STAD -0.365; TCGA UCEC -0.179 |
hsa-miR-141-5p | SAMD4A | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.358; TCGA BRCA -0.394; TCGA CESC -0.309; TCGA COAD -0.38; TCGA ESCA -0.315; TCGA HNSC -0.292; TCGA LUAD -0.385; TCGA LUSC -0.54; TCGA PAAD -0.221; TCGA PRAD -0.559; TCGA STAD -0.424; TCGA UCEC -0.349 |
hsa-miR-141-5p | H6PD | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.077; TCGA BRCA -0.168; TCGA CESC -0.094; TCGA COAD -0.092; TCGA ESCA -0.073; TCGA HNSC -0.065; TCGA LIHC -0.12; TCGA LUSC -0.08; TCGA PAAD -0.112; TCGA PRAD -0.08; TCGA STAD -0.085; TCGA UCEC -0.12 |
hsa-miR-141-5p | FOXN3 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.135; TCGA BRCA -0.31; TCGA COAD -0.185; TCGA ESCA -0.163; TCGA HNSC -0.051; TCGA LIHC -0.077; TCGA LUAD -0.155; TCGA PAAD -0.14; TCGA PRAD -0.158; TCGA THCA -0.161; TCGA STAD -0.272; TCGA UCEC -0.221 |
hsa-miR-141-5p | ASB1 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.151; TCGA BRCA -0.155; TCGA CESC -0.112; TCGA COAD -0.075; TCGA ESCA -0.077; TCGA HNSC -0.103; TCGA PRAD -0.197; TCGA STAD -0.163; TCGA UCEC -0.131 |
hsa-miR-141-5p | SEC22C | 9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.127; TCGA CESC -0.096; TCGA ESCA -0.091; TCGA HNSC -0.1; TCGA LUAD -0.112; TCGA LUSC -0.257; TCGA PAAD -0.068; TCGA STAD -0.082; TCGA UCEC -0.084 |
hsa-miR-141-5p | RASSF2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.158; TCGA BRCA -0.112; TCGA CESC -0.298; TCGA COAD -0.505; TCGA ESCA -0.319; TCGA HNSC -0.163; TCGA LUAD -0.258; TCGA LUSC -0.645; TCGA PAAD -0.454; TCGA PRAD -0.371; TCGA THCA -0.601; TCGA STAD -0.279; TCGA UCEC -0.272 |
hsa-miR-141-5p | SAMHD1 | 9 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.254; TCGA BRCA -0.106; TCGA ESCA -0.206; TCGA LUAD -0.267; TCGA LUSC -0.464; TCGA PAAD -0.288; TCGA PRAD -0.347; TCGA THCA -0.435; TCGA STAD -0.108 |
hsa-miR-141-5p | XYLT1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.237; TCGA BRCA -0.189; TCGA CESC -0.295; TCGA COAD -0.211; TCGA ESCA -0.112; TCGA HNSC -0.209; TCGA LUAD -0.149; TCGA LUSC -0.397; TCGA PAAD -0.117; TCGA THCA -0.176; TCGA STAD -0.157; TCGA UCEC -0.44 |
hsa-miR-141-5p | SH3PXD2A | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.101; TCGA BRCA -0.08; TCGA CESC -0.074; TCGA COAD -0.206; TCGA ESCA -0.084; TCGA HNSC -0.069; TCGA PAAD -0.158; TCGA PRAD -0.501; TCGA THCA -0.201; TCGA STAD -0.167; TCGA UCEC -0.229 |
hsa-miR-141-5p | CBL | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.09; TCGA BRCA -0.089; TCGA CESC -0.116; TCGA COAD -0.069; TCGA ESCA -0.064; TCGA LUAD -0.145; TCGA LUSC -0.055; TCGA PAAD -0.123; TCGA PRAD -0.105; TCGA THCA -0.096; TCGA STAD -0.099; TCGA UCEC -0.119 |
hsa-miR-141-5p | IGFBP5 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.494; TCGA BRCA -0.215; TCGA CESC -0.554; TCGA COAD -0.73; TCGA ESCA -0.256; TCGA HNSC -0.157; TCGA OV -0.17; TCGA PAAD -0.267; TCGA PRAD -0.399; TCGA STAD -0.366; TCGA UCEC -0.383 |
hsa-miR-141-5p | CHST3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.293; TCGA BRCA -0.295; TCGA CESC -0.109; TCGA COAD -0.52; TCGA ESCA -0.188; TCGA HNSC -0.067; TCGA LUAD -0.247; TCGA OV -0.179; TCGA PRAD -0.745; TCGA THCA -0.106; TCGA STAD -0.319; TCGA UCEC -0.17 |
hsa-miR-141-5p | KIF1C | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD | mirMAP | TCGA BLCA -0.071; TCGA BRCA -0.177; TCGA CESC -0.059; TCGA ESCA -0.13; TCGA HNSC -0.21; TCGA KIRP -0.051; TCGA LIHC -0.06; TCGA LUAD -0.092; TCGA LUSC -0.239; TCGA STAD -0.069 |
hsa-miR-141-5p | ETS1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.124; TCGA BRCA -0.223; TCGA CESC -0.21; TCGA COAD -0.254; TCGA ESCA -0.181; TCGA HNSC -0.237; TCGA LUAD -0.263; TCGA LUSC -0.64; TCGA OV -0.093; TCGA PAAD -0.273; TCGA PRAD -0.304; TCGA THCA -0.317; TCGA UCEC -0.199 |
hsa-miR-141-5p | FAIM2 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; OV; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.733; TCGA BRCA -0.12; TCGA CESC -0.244; TCGA ESCA -0.356; TCGA HNSC -0.262; TCGA LUSC -0.559; TCGA OV -0.246; TCGA PRAD -0.732; TCGA THCA -0.827; TCGA STAD -0.374 |
hsa-miR-141-5p | FTO | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.101; TCGA BRCA -0.105; TCGA CESC -0.108; TCGA COAD -0.135; TCGA ESCA -0.095; TCGA HNSC -0.071; TCGA LIHC -0.058; TCGA LUAD -0.095; TCGA LUSC -0.107; TCGA PRAD -0.128; TCGA STAD -0.196; TCGA UCEC -0.146 |
hsa-miR-141-5p | MYOCD | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.608; TCGA BRCA -0.59; TCGA CESC -0.686; TCGA COAD -1.025; TCGA ESCA -0.591; TCGA LUAD -0.426; TCGA LUSC -0.955; TCGA PAAD -0.407; TCGA PRAD -1.142; TCGA THCA -0.266; TCGA STAD -0.837; TCGA UCEC -0.896 |
hsa-miR-141-5p | ITPKB | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.176; TCGA BRCA -0.094; TCGA CESC -0.181; TCGA COAD -0.219; TCGA ESCA -0.237; TCGA LUAD -0.063; TCGA PAAD -0.22; TCGA PRAD -0.054; TCGA THCA -0.145; TCGA STAD -0.469; TCGA UCEC -0.188 |
hsa-miR-141-5p | AFF3 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.616; TCGA CESC -0.558; TCGA COAD -0.75; TCGA ESCA -0.526; TCGA HNSC -0.173; TCGA LUAD -0.287; TCGA LUSC -0.827; TCGA PAAD -0.435; TCGA THCA -0.507; TCGA STAD -0.657; TCGA UCEC -0.3 |
hsa-miR-141-5p | DAAM2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.381; TCGA BRCA -0.387; TCGA CESC -0.571; TCGA COAD -0.595; TCGA ESCA -0.527; TCGA HNSC -0.379; TCGA LUAD -0.196; TCGA LUSC -0.678; TCGA OV -0.127; TCGA PAAD -0.439; TCGA PRAD -0.794; TCGA THCA -0.217; TCGA STAD -0.558; TCGA UCEC -0.265 |
hsa-miR-141-5p | NACC2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.278; TCGA BRCA -0.121; TCGA CESC -0.117; TCGA COAD -0.118; TCGA ESCA -0.167; TCGA HNSC -0.056; TCGA LUAD -0.07; TCGA LUSC -0.123; TCGA OV -0.073; TCGA PAAD -0.084; TCGA PRAD -0.446; TCGA STAD -0.34; TCGA UCEC -0.093 |
hsa-miR-141-5p | DIXDC1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.506; TCGA BRCA -0.249; TCGA CESC -0.41; TCGA COAD -0.4; TCGA ESCA -0.36; TCGA HNSC -0.215; TCGA KIRP -0.096; TCGA LUAD -0.221; TCGA LUSC -0.409; TCGA PAAD -0.121; TCGA PRAD -0.425; TCGA STAD -0.554; TCGA UCEC -0.379 |
hsa-miR-141-5p | MMP16 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.396; TCGA BRCA -0.168; TCGA CESC -0.549; TCGA COAD -0.555; TCGA ESCA -0.262; TCGA HNSC -0.483; TCGA LUAD -0.2; TCGA LUSC -0.371; TCGA OV -0.315; TCGA PAAD -0.226; TCGA PRAD -0.758; TCGA STAD -0.397; TCGA UCEC -0.343 |
hsa-miR-141-5p | GDF6 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.36; TCGA BRCA -0.216; TCGA COAD -1.01; TCGA ESCA -0.538; TCGA HNSC -0.311; TCGA LUAD -0.371; TCGA OV -0.343; TCGA PAAD -0.381; TCGA PRAD -0.379; TCGA STAD -0.602; TCGA UCEC -0.361 |
hsa-miR-141-5p | FBXO32 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.31; TCGA CESC -0.123; TCGA COAD -0.436; TCGA ESCA -0.275; TCGA HNSC -0.223; TCGA PAAD -0.151; TCGA PRAD -0.345; TCGA STAD -0.556; TCGA UCEC -0.281 |
hsa-miR-141-5p | EDA | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD | mirMAP | TCGA BLCA -0.099; TCGA BRCA -0.286; TCGA CESC -0.192; TCGA COAD -0.292; TCGA ESCA -0.193; TCGA HNSC -0.108; TCGA LUAD -0.137; TCGA LUSC -0.157; TCGA STAD -0.136 |
hsa-miR-141-5p | FMNL3 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.18; TCGA BRCA -0.107; TCGA CESC -0.137; TCGA COAD -0.235; TCGA ESCA -0.113; TCGA HNSC -0.105; TCGA LUAD -0.228; TCGA LUSC -0.319; TCGA PAAD -0.283; TCGA PRAD -0.261; TCGA THCA -0.092; TCGA STAD -0.107; TCGA UCEC -0.136 |
hsa-miR-141-5p | GRIK3 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.358; TCGA CESC -0.341; TCGA COAD -0.531; TCGA ESCA -0.7; TCGA HNSC -0.243; TCGA LUAD -0.296; TCGA LUSC -0.333; TCGA PAAD -0.207; TCGA PRAD -0.553; TCGA THCA -0.398; TCGA STAD -0.843 |
hsa-miR-141-5p | TUB | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.379; TCGA BRCA -0.211; TCGA CESC -0.326; TCGA COAD -0.861; TCGA ESCA -0.353; TCGA HNSC -0.164; TCGA KIRP -0.091; TCGA LUAD -0.164; TCGA PAAD -0.282; TCGA PRAD -0.113; TCGA STAD -0.585; TCGA UCEC -0.387 |
hsa-miR-141-5p | PRKCB | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.448; TCGA BRCA -0.127; TCGA CESC -0.192; TCGA COAD -0.566; TCGA ESCA -0.396; TCGA HNSC -0.112; TCGA LUAD -0.2; TCGA LUSC -0.636; TCGA PAAD -0.653; TCGA PRAD -1.053; TCGA THCA -0.587; TCGA STAD -0.533; TCGA UCEC -0.269 |
hsa-miR-141-5p | SHE | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.349; TCGA BRCA -0.426; TCGA CESC -0.403; TCGA COAD -0.569; TCGA ESCA -0.249; TCGA HNSC -0.245; TCGA LUAD -0.176; TCGA LUSC -0.818; TCGA OV -0.158; TCGA PAAD -0.369; TCGA PRAD -0.397; TCGA STAD -0.309; TCGA UCEC -0.447 |
hsa-miR-141-5p | SH3PXD2B | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.194; TCGA BRCA -0.065; TCGA CESC -0.181; TCGA COAD -0.26; TCGA ESCA -0.192; TCGA HNSC -0.091; TCGA KIRP -0.059; TCGA PAAD -0.196; TCGA PRAD -0.53; TCGA STAD -0.222; TCGA UCEC -0.122 |
hsa-miR-141-5p | LYNX1 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.194; TCGA BRCA -0.304; TCGA COAD -0.897; TCGA ESCA -0.263; TCGA HNSC -0.306; TCGA LUAD -0.336; TCGA LUSC -0.176; TCGA OV -0.393; TCGA PAAD -0.161; TCGA PRAD -0.478; TCGA STAD -0.561; TCGA UCEC -0.262 |
hsa-miR-141-5p | SPN | 9 cancers: BLCA; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.244; TCGA COAD -0.22; TCGA ESCA -0.126; TCGA KIRP -0.066; TCGA LUAD -0.359; TCGA LUSC -0.823; TCGA PAAD -0.393; TCGA PRAD -0.27; TCGA THCA -0.661 |
hsa-miR-141-5p | ITSN1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.117; TCGA BRCA -0.294; TCGA CESC -0.154; TCGA COAD -0.125; TCGA ESCA -0.073; TCGA HNSC -0.1; TCGA LUAD -0.123; TCGA LUSC -0.16; TCGA PAAD -0.133; TCGA PRAD -0.319; TCGA STAD -0.125; TCGA UCEC -0.139 |
hsa-miR-141-5p | RYR2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.475; TCGA BRCA -0.272; TCGA CESC -0.277; TCGA COAD -0.708; TCGA ESCA -0.526; TCGA LUAD -0.242; TCGA LUSC -0.397; TCGA PAAD -0.216; TCGA PRAD -0.372; TCGA THCA -0.332; TCGA STAD -0.664; TCGA UCEC -0.239 |
hsa-miR-141-5p | BACH2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.489; TCGA BRCA -0.28; TCGA CESC -0.231; TCGA COAD -0.698; TCGA ESCA -0.287; TCGA HNSC -0.231; TCGA LUAD -0.227; TCGA LUSC -0.177; TCGA PAAD -0.423; TCGA PRAD -0.377; TCGA THCA -0.29; TCGA STAD -0.306; TCGA UCEC -0.398 |
hsa-miR-141-5p | NFIA | 9 cancers: BLCA; BRCA; ESCA; KIRP; LIHC; LUAD; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.209; TCGA BRCA -0.134; TCGA ESCA -0.153; TCGA KIRP -0.129; TCGA LIHC -0.095; TCGA LUAD -0.076; TCGA PAAD -0.092; TCGA PRAD -0.101; TCGA STAD -0.326 |
hsa-miR-141-5p | SNX18 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.072; TCGA BRCA -0.118; TCGA CESC -0.07; TCGA COAD -0.252; TCGA ESCA -0.077; TCGA HNSC -0.097; TCGA LUAD -0.08; TCGA LUSC -0.104; TCGA OV -0.071; TCGA PAAD -0.104; TCGA PRAD -0.11; TCGA STAD -0.116; TCGA UCEC -0.151 |
hsa-miR-141-5p | CITED2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.051; TCGA BRCA -0.146; TCGA CESC -0.211; TCGA COAD -0.085; TCGA ESCA -0.17; TCGA HNSC -0.186; TCGA LUAD -0.13; TCGA LUSC -0.496; TCGA PAAD -0.118; TCGA STAD -0.277; TCGA UCEC -0.281 |
hsa-miR-141-5p | CDC42BPA | 10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUSC; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.159; TCGA BRCA -0.11; TCGA COAD -0.148; TCGA HNSC -0.076; TCGA LIHC -0.083; TCGA LUSC -0.091; TCGA PRAD -0.082; TCGA THCA -0.073; TCGA STAD -0.119; TCGA UCEC -0.117 |
hsa-miR-141-5p | YAP1 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.115; TCGA BRCA -0.209; TCGA CESC -0.141; TCGA COAD -0.078; TCGA ESCA -0.086; TCGA HNSC -0.092; TCGA PRAD -0.314; TCGA STAD -0.106; TCGA UCEC -0.133 |
hsa-miR-141-5p | DPYSL2 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.389; TCGA BRCA -0.263; TCGA CESC -0.265; TCGA ESCA -0.131; TCGA HNSC -0.114; TCGA LUAD -0.231; TCGA LUSC -0.548; TCGA PAAD -0.079; TCGA PRAD -0.565; TCGA THCA -0.375; TCGA STAD -0.193; TCGA UCEC -0.371 |
hsa-miR-141-5p | PAFAH1B1 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.068; TCGA BRCA -0.081; TCGA ESCA -0.07; TCGA HNSC -0.09; TCGA LUSC -0.083; TCGA PAAD -0.064; TCGA PRAD -0.101; TCGA STAD -0.109; TCGA UCEC -0.094 |
hsa-miR-141-5p | CRYZL1 | 9 cancers: BRCA; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BRCA -0.058; TCGA ESCA -0.099; TCGA HNSC -0.057; TCGA LUAD -0.08; TCGA LUSC -0.116; TCGA OV -0.051; TCGA PRAD -0.085; TCGA STAD -0.172; TCGA UCEC -0.064 |
hsa-miR-141-5p | SEMA3C | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.156; TCGA CESC -0.237; TCGA COAD -0.282; TCGA ESCA -0.167; TCGA HNSC -0.369; TCGA LUAD -0.196; TCGA OV -0.102; TCGA PRAD -0.182; TCGA THCA -0.685; TCGA STAD -0.365; TCGA UCEC -0.172 |
hsa-miR-141-5p | MARCKS | 9 cancers: BRCA; COAD; HNSC; KIRP; LUAD; OV; PAAD; THCA; UCEC | MirTarget | TCGA BRCA -0.056; TCGA COAD -0.154; TCGA HNSC -0.157; TCGA KIRP -0.094; TCGA LUAD -0.065; TCGA OV -0.081; TCGA PAAD -0.12; TCGA THCA -0.306; TCGA UCEC -0.124 |
hsa-miR-141-5p | RHOBTB2 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BRCA -0.1; TCGA CESC -0.138; TCGA COAD -0.175; TCGA ESCA -0.112; TCGA HNSC -0.193; TCGA LUSC -0.543; TCGA PAAD -0.101; TCGA PRAD -0.247; TCGA STAD -0.108; TCGA UCEC -0.166 |
hsa-miR-141-5p | CLCN6 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.172; TCGA CESC -0.132; TCGA COAD -0.085; TCGA ESCA -0.084; TCGA HNSC -0.055; TCGA LUAD -0.073; TCGA LUSC -0.156; TCGA PAAD -0.106; TCGA STAD -0.15; TCGA UCEC -0.145 |
hsa-miR-141-5p | PHACTR2 | 10 cancers: BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.186; TCGA CESC -0.154; TCGA HNSC -0.094; TCGA LUAD -0.167; TCGA LUSC -0.346; TCGA PAAD -0.152; TCGA PRAD -0.244; TCGA THCA -0.073; TCGA STAD -0.075; TCGA UCEC -0.124 |
hsa-miR-141-5p | SHROOM4 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BRCA -0.283; TCGA CESC -0.427; TCGA COAD -0.285; TCGA ESCA -0.115; TCGA HNSC -0.25; TCGA LUAD -0.306; TCGA LUSC -0.685; TCGA OV -0.126; TCGA PAAD -0.238; TCGA PRAD -0.496; TCGA STAD -0.145; TCGA UCEC -0.181 |
hsa-miR-141-5p | RBMS1 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.216; TCGA CESC -0.093; TCGA COAD -0.589; TCGA ESCA -0.15; TCGA HNSC -0.074; TCGA LUAD -0.088; TCGA LUSC -0.077; TCGA PAAD -0.214; TCGA PRAD -0.459; TCGA THCA -0.125; TCGA STAD -0.251; TCGA UCEC -0.206 |
hsa-miR-141-5p | ZNF132 | 9 cancers: BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.087; TCGA CESC -0.229; TCGA COAD -0.149; TCGA ESCA -0.169; TCGA LUAD -0.1; TCGA LUSC -0.143; TCGA PAAD -0.122; TCGA STAD -0.203; TCGA UCEC -0.18 |
hsa-miR-141-5p | MTSS1L | 9 cancers: CESC; COAD; ESCA; LUAD; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.124; TCGA COAD -0.143; TCGA ESCA -0.146; TCGA LUAD -0.071; TCGA PAAD -0.086; TCGA PRAD -0.331; TCGA THCA -0.081; TCGA STAD -0.288; TCGA UCEC -0.125 |
Enriched cancer pathways of putative targets