microRNA information: hsa-miR-143-3p

SectionIDlink
Mature name: hsa-miR-143-3pmiRbase
Accession: MIMAT0000435miRbase
Precursor name: hsa-mir-143 miRbase
Precursor accession: MI0000459miRbase
Symbol: MIR143HGNC
RefSeq ID: NR_029684GenBank
Sequence: UGAGAUGAAGCACUGUAGCUC



Reported expression in cancers: hsa-miR-143-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-143-3p

T cell leukemiaupregulation"The expression of miR-143 was up-regulated during ......"19464056
hsa-miR-143-3p

bladder cancerdownregulation"MicroRNA expression signatures of bladder cancer r ......"21464941RNA-Seq; qPCR
hsa-miR-143-3p

bladder cancerdownregulation"This study has provided novel important evidence w ......"23104321
hsa-miR-143-3p

breast cancerdownregulation"MiRNA expression profiles in 11 PMBCs were analyze ......"23691441qPCR; Microarray
hsa-miR-143-3p

breast cancerdownregulation"Here we investigate the role of miR-143 in breast ......"24218337
hsa-miR-143-3p

cervical and endocervical cancerdownregulation"Down-regulation was reported most consistently for ......"25920605
hsa-miR-143-3p

cervical and endocervical cancerdownregulation"The expression pattern of miR-143 was also evaluat ......"26854447Northern blot
hsa-miR-143-3p

colon cancerdownregulation"miR 143 overexpression impairs growth of human col ......"21901135qPCR
hsa-miR-143-3p

colon cancerdownregulation"miR-143 is located at a fragile site on chromosome ......"22691140Microarray
hsa-miR-143-3p

colon cancerdownregulation"To present proof-of-principle application for empl ......"23741026qPCR; Microarray
hsa-miR-143-3p

colon cancerdownregulation"miR-143 and miR-145 are downregulated in colon can ......"26824186
hsa-miR-143-3p

colorectal cancerdownregulation"Applying real-time RT-PCR we investigated the miR- ......"19242066qPCR
hsa-miR-143-3p

colorectal cancerdownregulation"MicroRNA 143 targets DNA methyltransferases 3A in ......"19638978qPCR
hsa-miR-143-3p

colorectal cancerdownregulation"MicroRNAs are aberrantly expressed in cancer; micr ......"19843160
hsa-miR-143-3p

colorectal cancerdownregulation"Role of anti oncomirs miR 143 and 145 in human col ......"20094072
hsa-miR-143-3p

colorectal cancerdownregulation"Elevated expression of miR-31 p = 0.004 and mi ......"21739196
hsa-miR-143-3p

colorectal cancerdownregulation"MicroRNA-143 miRNA-143 is frequently down-regulate ......"22549179
hsa-miR-143-3p

colorectal cancerdownregulation"We previously reported that miR-143 and -145 are f ......"23397547
hsa-miR-143-3p

colorectal cancerdownregulation"MicroRNA 143 inhibits tumor growth and angiogenesi ......"23574723
hsa-miR-143-3p

colorectal cancerdownregulation"The expression levels of miR-143 -145 and -34a wer ......"25584614
hsa-miR-143-3p

colorectal cancerdownregulation"Expression of 16 miRNAs miRNA-9 21 30d 31 106a 127 ......"25773836qPCR
hsa-miR-143-3p

colorectal cancerdownregulation"Secondly validation of the results was carried out ......"27365381qPCR
hsa-miR-143-3p

endometrial cancerdownregulation"Down regulation of miR 145 and miR 143 might be as ......"24071015Microarray; qPCR
hsa-miR-143-3p

esophageal cancerderegulation"Among these miRNAs that displayed unique miRNA exp ......"23516093
hsa-miR-143-3p

esophageal cancerderegulation"The expression profiles of miRNAs in paired EC and ......"23761828Microarray; qPCR
hsa-miR-143-3p

esophageal cancerderegulation"The relative expression levels of the following mi ......"25667498qPCR
hsa-miR-143-3p

esophageal cancerderegulation"MiR-143-3p has been identified to function as a tu ......"27358073
hsa-miR-143-3p

gastric cancerdownregulation"miR-143 was detected by quantitative real-time PCR ......"25492481qPCR
hsa-miR-143-3p

gastric cancerdownregulation"Expression of miR 143 and miR 145 and their functi ......"25656032
hsa-miR-143-3p

gastric cancerdownregulation"Results indicated that the expression of miR-143 w ......"26349981
hsa-miR-143-3p

glioblastomadownregulation"The results showed that the expression of miR-143 ......"26541455
hsa-miR-143-3p

kidney renal cell cancerdownregulation"The expression levels of miR-143 and miR-145 were ......"24033605
hsa-miR-143-3p

liver cancerupregulation"Serum microRNA 143 and microRNA 215 as potential b ......"24993656qPCR
hsa-miR-143-3p

liver cancerupregulation"Real-time quantitative PCR was utilized to detect ......"25270212qPCR
hsa-miR-143-3p

lung cancerdownregulation"Targeting PKCε by miR 143 regulates cell apoptosi ......"24070896
hsa-miR-143-3p

lung squamous cell cancerdownregulation"The levels of two mature miRNAs miR-143 and miR-15 ......"24286416qPCR
hsa-miR-143-3p

lymphomadownregulation"Histone deacetylase inhibitor prevents cell growth ......"24577510Microarray
hsa-miR-143-3p

melanomadownregulation"We found that miR-143 expression was significantly ......"24722758
hsa-miR-143-3p

ovarian cancerdownregulation"The aim of this study was to find specific profile ......"23542579Microarray; qPCR
hsa-miR-143-3p

pancreatic cancerupregulation"Changes in miR 143 and miR 21 expression and clini ......"22836856
hsa-miR-143-3p

prostate cancerdownregulation"Down-regulation of miR-143 has been reported in a ......"26269764
hsa-miR-143-3p

prostate cancerdownregulation"In prior work miR-143 was markedly downregulated i ......"26721309
hsa-miR-143-3p

sarcomadownregulation"miR-143 was the most downregulated miRNA P < 0.01 ......"21427707Microarray
hsa-miR-143-3p

sarcomadownregulation"Real-time PCR was used to measure miR-143 levels. ......"25576341qPCR



Reported cancer pathway affected by hsa-miR-143-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-143-3p

T cell leukemiaApoptosis pathway"Role of microRNA 143 in Fas mediated apoptosis in ......"19464056
hsa-miR-143-3p

bladder cancerMAPK signaling pathway"Replacement treatment with microRNA 143 and 145 in ......"23104321Luciferase
hsa-miR-143-3p

breast cancerApoptosis pathway; cell cycle pathway"Long noncoding RNA UCA1 modulates breast cancer ce ......"26439035Luciferase; Flow cytometry; MTT assay
hsa-miR-143-3p

breast cancerEpithelial mesenchymal transition pathway"miR 143 suppresses epithelial mesenchymal transiti ......"26618772
hsa-miR-143-3p

cervical and endocervical cancerApoptosis pathway"miR 143 is downregulated in cervical cancer and pr ......"22160209Luciferase
hsa-miR-143-3p

cervical and endocervical cancerApoptosis pathway"E3 ubiquitin ligase isolated by differential displ ......"27446260Western blot; Colony formation
hsa-miR-143-3p

colon cancerApoptosis pathway"miR 143 overexpression impairs growth of human col ......"21901135
hsa-miR-143-3p

colorectal cancerApoptosis pathway"Characterized mechanism of alpha mangostin induced ......"17553685Western blot
hsa-miR-143-3p

colorectal cancerApoptosis pathway"MicroRNA-143 miRNA-143 is frequently down-regulate ......"22549179
hsa-miR-143-3p

colorectal cancerp53 signaling pathway"Analysis of the combined action of miR 143 and miR ......"23128394
hsa-miR-143-3p

colorectal cancerApoptosis pathway"MicroRNA 143 replenishment re sensitizes colorecta ......"26581910
hsa-miR-143-3p

colorectal cancerApoptosis pathway"miR 143 regulates proliferation and apoptosis of c ......"26629019
hsa-miR-143-3p

colorectal cancercell cycle pathway; Apoptosis pathway"MicroRNA miR-143 and miR-145 have been identified ......"27444415Luciferase
hsa-miR-143-3p

esophageal cancerApoptosis pathway"MicroRNA 143 functions as a tumor suppressor in hu ......"23276710
hsa-miR-143-3p

esophageal cancerApoptosis pathway"miR 143 inhibits tumor progression by targeting FA ......"26758433
hsa-miR-143-3p

esophageal cancercell cycle pathway; Epithelial mesenchymal transition pathway"MiR 143 inhibits tumor cell proliferation and inva ......"26806810Luciferase
hsa-miR-143-3p

esophageal cancerEpithelial mesenchymal transition pathway; Apoptosis pathway"MiR 143 3p functions as a tumor suppressor by regu ......"27358073
hsa-miR-143-3p

gastric cancerApoptosis pathway"MicroRNA 143 suppresses gastric cancer cell growth ......"24616567Western blot; Luciferase
hsa-miR-143-3p

gastric cancerApoptosis pathway"Involvement of miR 143 in cisplatin resistance of ......"25492481MTT assay; Luciferase; Western blot
hsa-miR-143-3p

glioblastomaApoptosis pathway"MiR 143 enhances the antitumor activity of shikoni ......"26541455
hsa-miR-143-3p

liver cancerApoptosis pathway"miR 143 inhibits proliferation and invasion of hep ......"25270212Flow cytometry; MTT assay; Western blot
hsa-miR-143-3p

lung cancerApoptosis pathway"Targeting PKCε by miR 143 regulates cell apoptosi ......"24070896
hsa-miR-143-3p

melanomaApoptosis pathway"MicroRNA 143 targets Syndecan 1 to repress cell gr ......"24722758
hsa-miR-143-3p

prostate cancercell cycle pathway"miR 143 decreases prostate cancer cells proliferat ......"21197560Western blot; Colony formation; MTT assay
hsa-miR-143-3p

prostate cancercell cycle pathway; Apoptosis pathway"MicroRNA 143 acts as a tumor suppressor by targeti ......"26269764
hsa-miR-143-3p

prostate cancerApoptosis pathway"Nevertheless decreased expressions of tumor suppre ......"26843836
hsa-miR-143-3p

sarcomaApoptosis pathway"microRNA 143 down regulated in osteosarcoma promot ......"20878132
hsa-miR-143-3p

sarcomaApoptosis pathway"Small RNA sequencing and functional characterizati ......"21693658
hsa-miR-143-3p

sarcomaApoptosis pathway"Propofol inhibits proliferation and invasion of os ......"24762226
hsa-miR-143-3p

sarcomaMAPK signaling pathway"MiR 143 inhibits EGFR signaling dependent osteosar ......"25227664
hsa-miR-143-3p

sarcomaApoptosis pathway"Effect of miR 143 on the apoptosis of osteosarcoma ......"26823739Western blot
hsa-miR-143-3p

sarcomaApoptosis pathway"MicroRNA 143 promotes apoptosis of osteosarcoma ce ......"27133034Western blot; Flow cytometry



Reported cancer prognosis affected by hsa-miR-143-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-143-3p

bladder cancerprogression; poor survival; recurrence"miR 143 miR 222 and miR 452 are useful as tumor st ......"22426337
hsa-miR-143-3p

bladder cancerstaging"Expression levels of miRNAs were assessed by quant ......"23169479
hsa-miR-143-3p

bladder cancermotility"A profile of miRNA expression was determined using ......"24966896
hsa-miR-143-3p

bladder cancerpoor survival"Uncovering the clinical utility of miR 143 miR 145 ......"25804644
hsa-miR-143-3p

bladder cancerworse prognosis"Circulating microRNAs miR 92a miR 100 and miR 143 ......"26916216
hsa-miR-143-3p

breast cancerstaging"Global miRNA analysis was performed on serum from ......"24694649
hsa-miR-143-3p

breast cancermetastasis; progression"In order to investigate the regulation of CD44 by ......"27121210Flow cytometry; Luciferase
hsa-miR-143-3p

breast cancermalignant trasformation"The expression levels of miR-143 miR-663a miR-668 ......"27236032
hsa-miR-143-3p

breast cancerdrug resistance"18F FDG PET/CT for Monitoring the Response of Brea ......"27574783
hsa-miR-143-3p

cervical and endocervical cancertumorigenesis"All cell lines examined contained no detectable mi ......"18596939
hsa-miR-143-3p

cervical and endocervical cancermetastasis; tumor size; staging; differentiation; progression"Clinical significance of miR 143 expression in wom ......"24517947
hsa-miR-143-3p

cervical and endocervical cancerstaging"In this study we assessed the expression of transl ......"26854447Western blot
hsa-miR-143-3p

colon cancertumorigenesis"To further investigate the in vivo biological sign ......"18172508
hsa-miR-143-3p

colon cancerprogression"miR 143 overexpression impairs growth of human col ......"21901135
hsa-miR-143-3p

colon cancertumorigenesis"Both miR-143 and miR-145 have been shown to posses ......"22897626
hsa-miR-143-3p

colon cancerstaging"To present proof-of-principle application for empl ......"23741026
hsa-miR-143-3p

colorectal cancertumorigenesis"Role of miR 143 targeting KRAS in colorectal tumor ......"19137007Luciferase
hsa-miR-143-3p

colorectal cancerprogression"Applying real-time RT-PCR we investigated the miR- ......"19242066
hsa-miR-143-3p

colorectal cancerdrug resistance"MicroRNA 143 reduces viability and increases sensi ......"19843160
hsa-miR-143-3p

colorectal cancerdifferentiation"SW620 CRC cells were stably transduced with miR-14 ......"19843336
hsa-miR-143-3p

colorectal cancerstaging; progression; tumorigenesis"Role of anti oncomirs miR 143 and 145 in human col ......"20094072
hsa-miR-143-3p

colorectal cancermetastasis; tumorigenesis"Relevance of miR 21 and miR 143 expression in tiss ......"20620599
hsa-miR-143-3p

colorectal cancerdrug resistance; differentiation"Analysis of the combined action of miR 143 and miR ......"23128394
hsa-miR-143-3p

colorectal cancermetastasis"In turn the level of miR-143 in CRC cells decreasi ......"23173124
hsa-miR-143-3p

colorectal cancerstaging; metastasis; drug resistance"MicroRNA 143 inhibits tumor growth and angiogenesi ......"23574723
hsa-miR-143-3p

colorectal cancerdrug resistance"MicroRNA 143 is a putative predictive factor for t ......"26392389
hsa-miR-143-3p

colorectal cancermetastasis"Secondly validation of the results was carried out ......"27365381
hsa-miR-143-3p

endometrial cancerworse prognosis; poor survival"Down regulation of miR 145 and miR 143 might be as ......"24071015
hsa-miR-143-3p

esophageal cancermetastasis; worse prognosis"The cluster of miR 143 and miR 145 affects the ris ......"22457808Luciferase; Western blot
hsa-miR-143-3p

esophageal cancerstaging; metastasis; poor survival; recurrence; worse prognosis; drug resistance"There are several microRNAs that have been consist ......"23092342
hsa-miR-143-3p

esophageal cancermetastasis"MicroRNA 143 functions as a tumor suppressor in hu ......"23276710
hsa-miR-143-3p

esophageal cancerdrug resistance"Esophageal cancer selective expression of TRAIL me ......"24659424
hsa-miR-143-3p

esophageal cancerpoor survival; metastasis"TaqMan human miRNA arrays and bioinformatics were ......"25030863
hsa-miR-143-3p

esophageal cancerstaging"Deregulation of miR 93 and miR 143 in human esopha ......"26427659
hsa-miR-143-3p

esophageal cancerprogression"miR 143 inhibits tumor progression by targeting FA ......"26758433
hsa-miR-143-3p

esophageal cancerstaging; metastasis; cell migration"MiR 143 inhibits tumor cell proliferation and inva ......"26806810Luciferase
hsa-miR-143-3p

esophageal cancerprogression; worse prognosis; motility"MiR 143 3p functions as a tumor suppressor by regu ......"27358073
hsa-miR-143-3p

gastric cancerstaging"miR-32 miR-182 and miR-143 dysregulated expression ......"21874264
hsa-miR-143-3p

gastric cancermetastasis"Conversely the expression of miR-143 and -195 in c ......"24649051
hsa-miR-143-3p

gastric cancerdrug resistance"Involvement of miR 143 in cisplatin resistance of ......"25492481MTT assay; Luciferase; Western blot
hsa-miR-143-3p

gastric cancermetastasis; cell migration; progression"Expression of miR 143 and miR 145 and their functi ......"25656032Transwell assay
hsa-miR-143-3p

gastric cancerdrug resistance"MicroRNA 143 enhances chemosensitivity of Querceti ......"26349981Western blot
hsa-miR-143-3p

glioblastomadrug resistance; staging"The SOX2 response program in glioblastoma multifor ......"21211035Colony formation
hsa-miR-143-3p

glioblastomadifferentiation"miR 143 inhibits glycolysis and depletes stemness ......"23376635
hsa-miR-143-3p

lung squamous cell cancerworse prognosis; staging; poor survival"Deregulated expression of miR 21 miR 143 and miR 1 ......"20363096
hsa-miR-143-3p

lung squamous cell cancermetastasis; cell migration"MicroRNA 143 inhibits migration and invasion of hu ......"23904792
hsa-miR-143-3p

melanomastaging; malignant trasformation"MicroRNA 143 targets Syndecan 1 to repress cell gr ......"24722758
hsa-miR-143-3p

ovarian cancerpoor survival"The Cox proportional hazards model and the log-ran ......"21345725
hsa-miR-143-3p

ovarian cancerdrug resistance"MiRNAs sequencing data from 487 SEOC patients were ......"25485872
hsa-miR-143-3p

ovarian cancerpoor survival"The authors used quantitative polymerase chain rea ......"25556270Western blot
hsa-miR-143-3p

ovarian cancermetastasis; tumorigenesis; staging"MiR 143 targets CTGF and exerts tumor suppressing ......"27398154Luciferase
hsa-miR-143-3p

pancreatic cancermetastasis"miR 143 inhibits the metastasis of pancreatic canc ......"23070684Western blot
hsa-miR-143-3p

pancreatic cancerstaging"Using Affymetrix microarrays we established a glob ......"26807325
hsa-miR-143-3p

prostate cancerprogression; staging"miR 143 interferes with ERK5 signaling and abrogat ......"19855844Luciferase
hsa-miR-143-3p

prostate cancertumorigenesis"miR 143 decreases prostate cancer cells proliferat ......"21197560Western blot; Colony formation; MTT assay
hsa-miR-143-3p

prostate cancermetastasis; progression"miR 143 and miR 145 inhibit stem cell characterist ......"22948942Colony formation
hsa-miR-143-3p

prostate cancermetastasis; differentiation; progression; motility"Up regulated microRNA 143 in cancer stem cells dif ......"23383988Transwell assay; Luciferase
hsa-miR-143-3p

prostate cancercell migration; metastasis"MicroRNA 143 inhibits cell migration and invasion ......"23732700Western blot; Luciferase
hsa-miR-143-3p

prostate cancercell migration"Restoration of miR-143 or miR-145 in PCa cell line ......"24284362Luciferase
hsa-miR-143-3p

prostate cancerdrug resistance"To solve this problem we inserted miRNA response e ......"24292881Luciferase
hsa-miR-143-3p

prostate cancerstaging; malignant trasformation"Comparative microRNA profiling of prostate carcino ......"24337069
hsa-miR-143-3p

prostate cancermetastasis"We identify that TGFβ1-related miR-143 miR-145 mi ......"24763824
hsa-miR-143-3p

prostate cancermalignant trasformation; drug resistance"Mitigation of arsenic induced acquired cancer phen ......"26721309
hsa-miR-143-3p

prostate cancerdrug resistance"Nevertheless decreased expressions of tumor suppre ......"26843836
hsa-miR-143-3p

sarcomametastasis"MicroRNA 143 regulates human osteosarcoma metastas ......"21427707Western blot
hsa-miR-143-3p

sarcomametastasis"Levels of six candidate miRNAs miR-21 miR-199a-3p ......"23269581
hsa-miR-143-3p

sarcomacell migration"TGF β1 promotes osteosarcoma cell migration and i ......"25562163Western blot; Luciferase
hsa-miR-143-3p

sarcomapoor survival; drug resistance; worse prognosis"microRNA 143 is associated with the survival of AL ......"25576341Western blot; Colony formation; MTT assay
hsa-miR-143-3p

sarcomametastasis"PAI 1 a target gene of miR 143 regulates invasion ......"26817521
hsa-miR-143-3p

sarcomaprogression; cell migration"MicroRNA 143 promotes apoptosis of osteosarcoma ce ......"27133034Western blot; Flow cytometry



Reported gene related to hsa-miR-143-3p

miRNAcancergenereportingPUBMED
hsa-miR-143-3p

cervical and endocervical cancerBCL2"miR 143 is downregulated in cervical cancer and pr ......"22160209
hsa-miR-143-3p

colorectal cancerBCL2"In addition extracellular-regulated protein kinase ......"19843160
hsa-miR-143-3p

gastric cancerBCL2"Involvement of miR 143 in cisplatin resistance of ......"25492481
hsa-miR-143-3p

sarcomaBCL2"In chemoresistant SAOS-2 and U2OS osteosarcomas ce ......"25576341
hsa-miR-143-3p

sarcomaBCL2"microRNA 143 down regulated in osteosarcoma promot ......"20878132
hsa-miR-143-3p

sarcomaBCL2"To our knowledge it was the first time to target B ......"27133034
hsa-miR-143-3p

sarcomaBCL2"Real-time fluorescent RT-PCR was used to quantify ......"26823739
hsa-miR-143-3p

colon cancerKRAS"Stable miR-143 or miR-145 overexpression increased ......"26824186
hsa-miR-143-3p

colorectal cancerKRAS"In KRAS mutated tumours increased miR-200b and dec ......"22804917
hsa-miR-143-3p

colorectal cancerKRAS"The expression of miR-143 is often down-regulated ......"27725862
hsa-miR-143-3p

colorectal cancerKRAS"Role of miR 143 targeting KRAS in colorectal tumor ......"19137007
hsa-miR-143-3p

colorectal cancerKRAS"MicroRNA 143 replenishment re sensitizes colorecta ......"26581910
hsa-miR-143-3p

colorectal cancerKRAS"In turn the level of miR-143 in CRC cells decreasi ......"23173124
hsa-miR-143-3p

prostate cancerKRAS"miR 143 decreases prostate cancer cells proliferat ......"21197560
hsa-miR-143-3p

breast cancerHK2"We previously identified hexokinase 2 the major gl ......"27574783
hsa-miR-143-3p

colon cancerHK2"MicroRNA 143 down regulates Hexokinase 2 in colon ......"22691140
hsa-miR-143-3p

glioblastomaHK2"We show that miR-143 is significantly down-regulat ......"23376635
hsa-miR-143-3p

kidney renal cell cancerHK2"Luciferase reporter assays showed that both miR-14 ......"24033605
hsa-miR-143-3p

lung squamous cell cancerHK2"Furthermore knockdown of ATG2B and hexokinase 2 a ......"25322940
hsa-miR-143-3p

prostate cancerHK2"MicroRNA 143 acts as a tumor suppressor by targeti ......"26269764
hsa-miR-143-3p

T cell leukemiaMAPK7"On the contrary an extracellular signal-regulated ......"19464056
hsa-miR-143-3p

bladder cancerMAPK7"We recently reported that both microRNA miR-143 an ......"23104321
hsa-miR-143-3p

bladder cancerMAPK7"These findings suggest that the chemically-modifie ......"21550168
hsa-miR-143-3p

breast cancerMAPK7"miR 143 suppresses epithelial mesenchymal transiti ......"26618772
hsa-miR-143-3p

colorectal cancerMAPK7"Interestingly the level of microRNA-143 which nega ......"17553685
hsa-miR-143-3p

prostate cancerMAPK7"miR 143 interferes with ERK5 signaling and abrogat ......"19855844
hsa-miR-143-3p

prostate cancerMMP13"MicroRNA 143 inhibits cell migration and invasion ......"23732700
hsa-miR-143-3p

sarcomaMMP13"Western blot analyses revealed that MMP-13 was mos ......"21427707
hsa-miR-143-3p

sarcomaMMP13"Moreover the overexpression of miR-143 decreased M ......"24762226
hsa-miR-143-3p

lung squamous cell cancerATG2B"miR 143 inhibits cell proliferation by targeting a ......"25322940
hsa-miR-143-3p

sarcomaATG2B"In chemoresistant SAOS-2 and U2OS osteosarcomas ce ......"25576341
hsa-miR-143-3p

breast cancerDNMT3A"Ectopic expression of miR-143 inhibited proliferat ......"24218337
hsa-miR-143-3p

colorectal cancerDNMT3A"Using in silico predictions DNA methyltranferase 3 ......"19638978
hsa-miR-143-3p

colon cancerEGFR"EGFR signals downregulate tumor suppressors miR 14 ......"21653642
hsa-miR-143-3p

sarcomaEGFR"MiR 143 inhibits EGFR signaling dependent osteosar ......"25227664
hsa-miR-143-3p

colorectal cancerIGF1R"MiR 143 and MiR 145 regulate IGF1R to suppress cel ......"25474488
hsa-miR-143-3p

gastric cancerIGF1R"Involvement of miR 143 in cisplatin resistance of ......"25492481
hsa-miR-143-3p

colorectal cancerMACC1"MicroRNA 143 targets MACC1 to inhibit cell invasio ......"22533346
hsa-miR-143-3p

colorectal cancerMACC1"In turn the level of miR-143 in CRC cells decreasi ......"23173124
hsa-miR-143-3p

prostate cancerMMP9"Secreted matrix metalloproteinase MMP activity was ......"26721309
hsa-miR-143-3p

sarcomaMMP9"Here we reported significant lower level of miR-14 ......"25227664
hsa-miR-143-3p

gastric cancerPTGS2"MicroRNA 143 suppresses gastric cancer cell growth ......"24616567
hsa-miR-143-3p

pancreatic cancerPTGS2"miR 143 decreases COX 2 mRNA stability and express ......"23973710
hsa-miR-143-3p

bladder cancerSERPINE1"Mature miR-143 and miR-145 are coordinately expres ......"22108519
hsa-miR-143-3p

sarcomaSERPINE1"Immunohistochemical analysis using clinical sample ......"26817521
hsa-miR-143-3p

colorectal cancerTLR2"We also found that miR-143 a putative tumour suppr ......"23866094
hsa-miR-143-3p

liver cancerTLR2"miR 143 inhibits proliferation and invasion of hep ......"25270212
hsa-miR-143-3p

colorectal cancerTP53"Major mediators of the oncosuppression by miR-143 ......"23128394
hsa-miR-143-3p

lung squamous cell cancerTP53"p53 regulates the maturation process of miR-16 and ......"21400525
hsa-miR-143-3p

prostate cancerABCG2"miR-143 restoration dysregulated the expression of ......"26721309
hsa-miR-143-3p

melanomaAGO2"miR-143 directly targeted the 3'-untranslated regi ......"24722758
hsa-miR-143-3p

colorectal cancerAPC"Our data clearly indicated that the decreased expr ......"23397547
hsa-miR-143-3p

glioblastomaBAG3"MiR 143 enhances the antitumor activity of shikoni ......"26541455
hsa-miR-143-3p

cervical and endocervical cancerCARD8"We measured the expression of mir-21 and mir-143 i ......"22194833
hsa-miR-143-3p

T cell leukemiaCASP3"The increased expression of miR-143 emerged from 1 ......"19464056
hsa-miR-143-3p

colorectal cancerCD276"Consequently the direct target genes of miR-143 B7 ......"27626488
hsa-miR-143-3p

breast cancerCD44"A luciferase reporter assay demonstrated that miR- ......"27121210
hsa-miR-143-3p

colorectal cancerCEBPB"The upregulated miR-155 attenuated miR-143 by inhi ......"27626488
hsa-miR-143-3p

ovarian cancerCTGF"MiR 143 targets CTGF and exerts tumor suppressing ......"27398154
hsa-miR-143-3p

colorectal cancerDLD"Characterized mechanism of alpha mangostin induced ......"17553685
hsa-miR-143-3p

endometrial cancerDNMT3B"In univariate analysis the combination of DNMT3B o ......"24071015
hsa-miR-143-3p

colorectal cancerENDOG"Characterized mechanism of alpha mangostin induced ......"17553685
hsa-miR-143-3p

breast cancerERBB3"miR 143 and miR 145 synergistically regulate ERBB3 ......"25248370
hsa-miR-143-3p

esophageal cancerFAM83F"miR 143 inhibits tumor progression by targeting FA ......"26758433
hsa-miR-143-3p

T cell leukemiaFAS"Role of microRNA 143 in Fas mediated apoptosis in ......"19464056
hsa-miR-143-3p

prostate cancerFNDC3B"Up regulated microRNA 143 in cancer stem cells dif ......"23383988
hsa-miR-143-3p

esophageal cancerFSCN1"The protein level of FSCN1 showed no significant l ......"22457808
hsa-miR-143-3p

colorectal cancerFXYD3"Furthermore FXYD3 an ion transport regulator and a ......"26392389
hsa-miR-143-3p

gastric cancerGABARAPL1"MicroRNA 143 enhances chemosensitivity of Querceti ......"26349981
hsa-miR-143-3p

breast cancerHK1"We previously identified hexokinase 2 the major gl ......"27574783
hsa-miR-143-3p

colon cancerHRAS"The Evi1 microRNA 143 K Ras axis in colon cancer ......"21276449
hsa-miR-143-3p

colorectal cancerIGF1"Furthermore insulin-like growth factor-I receptor ......"23574723
hsa-miR-143-3p

bladder cancerILK"We newly elucidated that miR-143 targeted akt and ......"23104321
hsa-miR-143-3p

prostate cancerLIMK1"The anticancer effects of miR-143 overexpression a ......"26721309
hsa-miR-143-3p

pancreatic cancerMAP2K6"miR-143 were detected at fold levels of 0.41 ± 0. ......"23973710
hsa-miR-143-3p

pancreatic cancerMIA"miR-143 were detected at fold levels of 0.41 ± 0. ......"23973710
hsa-miR-143-3p

prostate cancerMMP2"Secreted matrix metalloproteinase MMP activity was ......"26721309
hsa-miR-143-3p

prostate cancerMYO6"A computational search indicated the 3'-untranslat ......"20353999
hsa-miR-143-3p

prostate cancerNOTCH1"miR-143 restoration dysregulated the expression of ......"26721309
hsa-miR-143-3p

glioblastomaNUAK2"miR 143 inhibits oncogenic traits by degrading NUA ......"27081712
hsa-miR-143-3p

pancreatic cancerPCS"Expression levels of miR-143 and miR-21 and correl ......"22836856
hsa-miR-143-3p

sarcomaPLK1"The downregulation of PRC1 and its docking partner ......"21693658
hsa-miR-143-3p

sarcomaPRC1"The downregulation of PRC1 and its docking partner ......"21693658
hsa-miR-143-3p

breast cancerPTEN"Restoration of miR-143 expression in breast cancer ......"24218337
hsa-miR-143-3p

esophageal cancerQKI"MiR 143 3p functions as a tumor suppressor by regu ......"27358073
hsa-miR-143-3p

breast cancerSCPEP1"UCA1 is present in Ago2-containing RNA-induced sil ......"26439035
hsa-miR-143-3p

melanomaSDC1"MicroRNA 143 targets Syndecan 1 to repress cell gr ......"24722758
hsa-miR-143-3p

breast cancerSMUG1"18F FDG PET/CT for Monitoring the Response of Brea ......"27574783
hsa-miR-143-3p

glioblastomaSOX2"Using next generation sequencing we identified 105 ......"21211035
hsa-miR-143-3p

esophageal cancerSTAT3"MiR 143 inhibits tumor cell proliferation and inva ......"26806810
hsa-miR-143-3p

melanomaTCL1B"In this study we investigated whether microRNA-143 ......"24722758
hsa-miR-143-3p

colorectal cancerTLR4"The regulation of Toll like receptor 2 by miR 143 ......"23866094
hsa-miR-143-3p

breast cancerTNFRSF10C"Restoration of miR-143 expression in breast cancer ......"24218337
hsa-miR-143-3p

prostate cancerTWIST1"In the present study we investigated whether loss ......"26721309
hsa-miR-143-3p

cervical and endocervical cancerUBR5"Furthermore microRNA miR-143 expression levels wer ......"27446260
hsa-miR-143-3p

breast cancerUCA1"Long noncoding RNA UCA1 modulates breast cancer ce ......"26439035
hsa-miR-143-3p

sarcomaVCAN"TGF β1 promotes osteosarcoma cell migration and i ......"25562163
hsa-miR-143-3p

colorectal cancerVTCN1"Consequently the direct target genes of miR-143 B7 ......"27626488



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-143-3p
HK2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.158; TCGA BRCA -0.087; TCGA CESC -0.138; TCGA COAD -0.285; TCGA ESCA -0.331; TCGA KIRP -0.251; TCGA LUSC -0.194; TCGA PRAD -0.194; TCGA SARC -0.307; TCGA STAD -0.535; TCGA UCEC -0.257
hsa-miR-143-3p
HRAS
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.163; TCGA BRCA -0.132; TCGA COAD -0.106; TCGA HNSC -0.25; TCGA KIRP -0.086; TCGA LIHC -0.141; TCGA LUAD -0.125; TCGA LUSC -0.234; TCGA PAAD -0.206; TCGA PRAD -0.331; TCGA THCA -0.101; TCGA STAD -0.085
hsa-miR-143-3p
MYO6
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.105; TCGA BRCA -0.186; TCGA COAD -0.128; TCGA ESCA -0.155; TCGA KIRC -0.158; TCGA KIRP -0.07; TCGA PRAD -0.283; TCGA THCA -0.081; TCGA STAD -0.214; TCGA UCEC -0.181
hsa-miR-143-3p
DLG3
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.085; TCGA BRCA -0.243; TCGA COAD -0.254; TCGA ESCA -0.104; TCGA KIRC -0.095; TCGA KIRP -0.054; TCGA LUAD -0.068; TCGA LUSC -0.124; TCGA PRAD -0.15; TCGA STAD -0.151
hsa-miR-143-3p
FAM111A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.133; TCGA BRCA -0.108; TCGA CESC -0.105; TCGA COAD -0.18; TCGA ESCA -0.179; TCGA HNSC -0.1; TCGA KIRP -0.148; TCGA LIHC -0.057; TCGA PRAD -0.269; TCGA THCA -0.165; TCGA STAD -0.192; TCGA UCEC -0.052
hsa-miR-143-3p
ZNF182
10 cancers: BLCA; BRCA; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.11; TCGA BRCA -0.078; TCGA ESCA -0.112; TCGA KIRP -0.117; TCGA LGG -0.055; TCGA LUAD -0.113; TCGA LUSC -0.15; TCGA PAAD -0.117; TCGA PRAD -0.101; TCGA STAD -0.078
hsa-miR-143-3p
DCAKD
9 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA
MirTarget
TCGA BLCA -0.093; TCGA KIRC -0.153; TCGA KIRP -0.113; TCGA LGG -0.077; TCGA LIHC -0.115; TCGA LUAD -0.052; TCGA LUSC -0.189; TCGA PAAD -0.199; TCGA THCA -0.056
hsa-miR-143-3p
EME1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.237; TCGA BRCA -0.415; TCGA CESC -0.138; TCGA COAD -0.285; TCGA ESCA -0.225; TCGA HNSC -0.222; TCGA KIRP -0.238; TCGA LGG -0.077; TCGA LIHC -0.239; TCGA LUAD -0.364; TCGA LUSC -0.783; TCGA PRAD -0.65; TCGA SARC -0.074; TCGA THCA -0.222; TCGA STAD -0.35; TCGA UCEC -0.318
hsa-miR-143-3p
ZWILCH
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.092; TCGA BRCA -0.187; TCGA COAD -0.175; TCGA ESCA -0.244; TCGA KIRC -0.065; TCGA KIRP -0.093; TCGA LUSC -0.342; TCGA PRAD -0.218; TCGA SARC -0.136; TCGA THCA -0.062; TCGA STAD -0.319; TCGA UCEC -0.076
hsa-miR-143-3p
ATG10
11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; PRAD; UCEC
MirTarget
TCGA BLCA -0.06; TCGA COAD -0.124; TCGA HNSC -0.096; TCGA KIRC -0.079; TCGA KIRP -0.07; TCGA LIHC -0.11; TCGA LUSC -0.129; TCGA OV -0.107; TCGA PAAD -0.1; TCGA PRAD -0.08; TCGA UCEC -0.058
hsa-miR-143-3p
TP53RK
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; OV; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.082; TCGA BRCA -0.122; TCGA ESCA -0.081; TCGA HNSC -0.058; TCGA LIHC -0.072; TCGA LUSC -0.056; TCGA OV -0.064; TCGA PRAD -0.087; TCGA SARC -0.098; TCGA STAD -0.071
hsa-miR-143-3p
TMEM69
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.108; TCGA BRCA -0.102; TCGA COAD -0.113; TCGA HNSC -0.079; TCGA KIRC -0.066; TCGA LIHC -0.104; TCGA LUAD -0.058; TCGA LUSC -0.266; TCGA OV -0.059; TCGA PRAD -0.2; TCGA THCA -0.05; TCGA STAD -0.127; TCGA UCEC -0.059
hsa-miR-143-3p
SLC25A15
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.081; TCGA BRCA -0.192; TCGA CESC -0.082; TCGA COAD -0.141; TCGA ESCA -0.234; TCGA KIRC -0.255; TCGA LUSC -0.197; TCGA OV -0.099; TCGA PRAD -0.121; TCGA SARC -0.108; TCGA STAD -0.274; TCGA UCEC -0.101
hsa-miR-143-3p
DMTF1
9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD
MirTarget
TCGA BLCA -0.097; TCGA COAD -0.084; TCGA HNSC -0.077; TCGA KIRP -0.294; TCGA LGG -0.07; TCGA LUAD -0.13; TCGA LUSC -0.173; TCGA PAAD -0.184; TCGA PRAD -0.159
hsa-miR-143-3p
XPO5
12 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.077; TCGA BRCA -0.141; TCGA ESCA -0.151; TCGA KIRC -0.079; TCGA KIRP -0.072; TCGA LIHC -0.121; TCGA LUAD -0.052; TCGA LUSC -0.242; TCGA PRAD -0.135; TCGA SARC -0.085; TCGA STAD -0.213; TCGA UCEC -0.096
hsa-miR-143-3p
ABHD14A
10 cancers: BLCA; COAD; KIRC; KIRP; LIHC; OV; PAAD; PRAD; SARC; UCEC
MirTarget
TCGA BLCA -0.146; TCGA COAD -0.117; TCGA KIRC -0.161; TCGA KIRP -0.129; TCGA LIHC -0.169; TCGA OV -0.184; TCGA PAAD -0.495; TCGA PRAD -0.162; TCGA SARC -0.117; TCGA UCEC -0.069
hsa-miR-143-3p
EAPP
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; OV; PAAD; PRAD
MirTarget
TCGA BLCA -0.061; TCGA BRCA -0.074; TCGA COAD -0.077; TCGA HNSC -0.094; TCGA LGG -0.054; TCGA LIHC -0.058; TCGA OV -0.14; TCGA PAAD -0.06; TCGA PRAD -0.082
hsa-miR-143-3p
RAB11FIP4
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.209; TCGA BRCA -0.271; TCGA CESC -0.214; TCGA ESCA -0.249; TCGA KIRC -0.389; TCGA LUAD -0.057; TCGA PRAD -0.16; TCGA SARC -0.221; TCGA THCA -0.059; TCGA STAD -0.311; TCGA UCEC -0.31
hsa-miR-143-3p
ZDHHC23
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.196; TCGA BRCA -0.179; TCGA CESC -0.115; TCGA COAD -0.16; TCGA ESCA -0.283; TCGA KIRC -0.365; TCGA KIRP -0.206; TCGA LUAD -0.111; TCGA LUSC -0.277; TCGA PAAD -0.143; TCGA PRAD -0.238; TCGA STAD -0.409; TCGA UCEC -0.223
hsa-miR-143-3p
SFXN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.099; TCGA BRCA -0.224; TCGA CESC -0.069; TCGA COAD -0.158; TCGA ESCA -0.093; TCGA KIRC -0.094; TCGA LIHC -0.1; TCGA LUAD -0.093; TCGA LUSC -0.39; TCGA OV -0.073; TCGA PAAD -0.114; TCGA PRAD -0.077; TCGA STAD -0.243; TCGA UCEC -0.081
hsa-miR-143-3p
SRCIN1
11 cancers: BLCA; BRCA; CESC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.448; TCGA BRCA -0.21; TCGA CESC -0.269; TCGA KIRP -0.486; TCGA LUAD -0.363; TCGA LUSC -0.2; TCGA PAAD -0.696; TCGA PRAD -0.6; TCGA THCA -0.461; TCGA STAD -0.192; TCGA UCEC -0.15
hsa-miR-143-3p
SCAMP4
9 cancers: BLCA; BRCA; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.127; TCGA KIRC -0.13; TCGA LUAD -0.051; TCGA PAAD -0.264; TCGA PRAD -0.115; TCGA SARC -0.104; TCGA THCA -0.053; TCGA STAD -0.096
hsa-miR-143-3p
CCDC58
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.127; TCGA BRCA -0.155; TCGA COAD -0.196; TCGA ESCA -0.196; TCGA HNSC -0.186; TCGA KIRC -0.09; TCGA KIRP -0.084; TCGA LGG -0.05; TCGA LIHC -0.137; TCGA LUAD -0.062; TCGA LUSC -0.494; TCGA OV -0.097; TCGA PRAD -0.291; TCGA SARC -0.11; TCGA STAD -0.232; TCGA UCEC -0.076
hsa-miR-143-3p
CREBZF
9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; STAD
MirTarget
TCGA BLCA -0.105; TCGA COAD -0.126; TCGA HNSC -0.118; TCGA KIRP -0.153; TCGA LGG -0.078; TCGA LUAD -0.159; TCGA LUSC -0.24; TCGA PRAD -0.206; TCGA STAD -0.152
hsa-miR-143-3p
FAM60A
9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; OV; STAD
MirTarget; miRNATAP
TCGA BLCA -0.129; TCGA COAD -0.141; TCGA ESCA -0.206; TCGA KIRC -0.238; TCGA KIRP -0.065; TCGA LGG -0.124; TCGA LUSC -0.261; TCGA OV -0.136; TCGA STAD -0.284
hsa-miR-143-3p
LASP1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.062; TCGA BRCA -0.117; TCGA CESC -0.078; TCGA COAD -0.071; TCGA ESCA -0.147; TCGA KIRP -0.081; TCGA SARC -0.19; TCGA THCA -0.089; TCGA STAD -0.204
hsa-miR-143-3p
VHL
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PRAD; STAD
MirTarget
TCGA BLCA -0.075; TCGA BRCA -0.068; TCGA CESC -0.105; TCGA COAD -0.161; TCGA ESCA -0.115; TCGA KIRC -0.104; TCGA LUSC -0.094; TCGA PRAD -0.106; TCGA STAD -0.125
hsa-miR-143-3p
GALNT7
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.077; TCGA BRCA -0.298; TCGA COAD -0.185; TCGA ESCA -0.18; TCGA KIRC -0.094; TCGA KIRP -0.085; TCGA LUSC -0.166; TCGA PRAD -0.266; TCGA SARC -0.108; TCGA THCA -0.255; TCGA STAD -0.202; TCGA UCEC -0.107
hsa-miR-143-3p
CHKA
13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.091; TCGA BRCA -0.082; TCGA CESC -0.125; TCGA COAD -0.147; TCGA KIRC -0.094; TCGA KIRP -0.164; TCGA LIHC -0.193; TCGA LUAD -0.14; TCGA PAAD -0.176; TCGA PRAD -0.297; TCGA SARC -0.07; TCGA STAD -0.201; TCGA UCEC -0.161
hsa-miR-143-3p
HMBS
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.08; TCGA BRCA -0.126; TCGA COAD -0.201; TCGA ESCA -0.107; TCGA HNSC -0.103; TCGA KIRC -0.161; TCGA KIRP -0.135; TCGA LIHC -0.104; TCGA LUAD -0.113; TCGA LUSC -0.235; TCGA OV -0.091; TCGA PRAD -0.302; TCGA SARC -0.142; TCGA STAD -0.214; TCGA UCEC -0.123
hsa-miR-143-3p
PHF6
9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LUSC; OV; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.082; TCGA BRCA -0.114; TCGA ESCA -0.137; TCGA KIRC -0.152; TCGA LGG -0.085; TCGA LUSC -0.224; TCGA OV -0.067; TCGA PRAD -0.081; TCGA STAD -0.216
hsa-miR-143-3p
CASP8
10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.092; TCGA COAD -0.109; TCGA ESCA -0.193; TCGA HNSC -0.051; TCGA KIRP -0.062; TCGA LIHC -0.054; TCGA PRAD -0.083; TCGA SARC -0.079; TCGA STAD -0.214; TCGA UCEC -0.071
hsa-miR-143-3p
MOGS
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.139; TCGA BRCA -0.157; TCGA CESC -0.085; TCGA COAD -0.121; TCGA ESCA -0.129; TCGA KIRP -0.067; TCGA LIHC -0.124; TCGA LUAD -0.165; TCGA LUSC -0.182; TCGA PAAD -0.098; TCGA PRAD -0.222; TCGA SARC -0.144; TCGA THCA -0.094; TCGA STAD -0.195; TCGA UCEC -0.138
hsa-miR-143-3p
TIGD5
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.168; TCGA BRCA -0.217; TCGA CESC -0.075; TCGA COAD -0.105; TCGA HNSC -0.095; TCGA LGG -0.105; TCGA LIHC -0.13; TCGA LUAD -0.242; TCGA LUSC -0.356; TCGA PAAD -0.226; TCGA PRAD -0.357; TCGA SARC -0.122; TCGA THCA -0.1; TCGA STAD -0.177; TCGA UCEC -0.073
hsa-miR-143-3p
GNL3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.142; TCGA BRCA -0.119; TCGA COAD -0.163; TCGA ESCA -0.124; TCGA HNSC -0.063; TCGA LIHC -0.091; TCGA LUAD -0.08; TCGA LUSC -0.196; TCGA OV -0.087; TCGA PRAD -0.389; TCGA SARC -0.076; TCGA STAD -0.279; TCGA UCEC -0.055
hsa-miR-143-3p
TMEM33
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.092; TCGA BRCA -0.096; TCGA CESC -0.075; TCGA COAD -0.127; TCGA ESCA -0.195; TCGA KIRC -0.193; TCGA PAAD -0.103; TCGA SARC -0.098; TCGA STAD -0.254; TCGA UCEC -0.059
hsa-miR-143-3p
GRHL2
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUSC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.374; TCGA CESC -0.106; TCGA COAD -0.174; TCGA KIRC -0.675; TCGA LUSC -0.335; TCGA PRAD -0.125; TCGA STAD -0.294; TCGA UCEC -0.363
hsa-miR-143-3p
DYRK1B
11 cancers: BLCA; BRCA; CESC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.162; TCGA CESC -0.069; TCGA KIRP -0.114; TCGA LUAD -0.076; TCGA LUSC -0.138; TCGA PAAD -0.278; TCGA PRAD -0.229; TCGA SARC -0.058; TCGA THCA -0.067; TCGA UCEC -0.109
hsa-miR-143-3p
NFXL1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.107; TCGA BRCA -0.063; TCGA COAD -0.158; TCGA ESCA -0.124; TCGA KIRC -0.076; TCGA LUAD -0.058; TCGA LUSC -0.166; TCGA PRAD -0.098; TCGA STAD -0.243; TCGA UCEC -0.083
hsa-miR-143-3p
C1GALT1
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.061; TCGA CESC -0.099; TCGA COAD -0.09; TCGA ESCA -0.271; TCGA KIRC -0.147; TCGA KIRP -0.081; TCGA LIHC -0.091; TCGA SARC -0.109; TCGA STAD -0.234; TCGA UCEC -0.136
hsa-miR-143-3p
HEMK1
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.089; TCGA BRCA -0.069; TCGA COAD -0.13; TCGA HNSC -0.108; TCGA KIRC -0.098; TCGA KIRP -0.201; TCGA LIHC -0.136; TCGA LUAD -0.103; TCGA PAAD -0.133; TCGA PRAD -0.237; TCGA THCA -0.059
hsa-miR-143-3p
ONECUT2
13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.338; TCGA CESC -0.428; TCGA COAD -0.307; TCGA ESCA -0.675; TCGA KIRC -0.439; TCGA KIRP -0.554; TCGA LGG -0.106; TCGA LIHC -0.29; TCGA LUAD -0.275; TCGA LUSC -0.656; TCGA PRAD -0.723; TCGA SARC -0.146; TCGA UCEC -0.281
hsa-miR-143-3p
RALGPS1
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.104; TCGA BRCA -0.163; TCGA COAD -0.137; TCGA KIRC -0.456; TCGA KIRP -0.122; TCGA LUAD -0.083; TCGA PAAD -0.326; TCGA STAD -0.123; TCGA UCEC -0.115
hsa-miR-143-3p
TOR2A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.123; TCGA BRCA -0.207; TCGA CESC -0.086; TCGA COAD -0.193; TCGA ESCA -0.16; TCGA HNSC -0.151; TCGA LGG -0.074; TCGA LIHC -0.067; TCGA LUAD -0.154; TCGA LUSC -0.109; TCGA PAAD -0.212; TCGA PRAD -0.321; TCGA SARC -0.26; TCGA STAD -0.224; TCGA UCEC -0.124
hsa-miR-143-3p
IRGQ
9 cancers: BLCA; BRCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.063; TCGA BRCA -0.068; TCGA KIRP -0.088; TCGA LIHC -0.075; TCGA LUAD -0.077; TCGA LUSC -0.147; TCGA PAAD -0.141; TCGA PRAD -0.155; TCGA THCA -0.052
hsa-miR-143-3p
TPM3
10 cancers: BLCA; BRCA; COAD; ESCA; OV; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.053; TCGA BRCA -0.193; TCGA COAD -0.128; TCGA ESCA -0.154; TCGA OV -0.052; TCGA PRAD -0.058; TCGA SARC -0.35; TCGA THCA -0.052; TCGA STAD -0.236; TCGA UCEC -0.116
hsa-miR-143-3p
LPAR2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.279; TCGA BRCA -0.229; TCGA CESC -0.077; TCGA COAD -0.19; TCGA ESCA -0.133; TCGA HNSC -0.174; TCGA KIRP -0.166; TCGA LGG -0.114; TCGA LUAD -0.15; TCGA LUSC -0.262; TCGA PRAD -0.176; TCGA SARC -0.077; TCGA THCA -0.051; TCGA STAD -0.318; TCGA UCEC -0.207
hsa-miR-143-3p
BBC3
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.13; TCGA BRCA -0.217; TCGA COAD -0.122; TCGA HNSC -0.099; TCGA KIRP -0.335; TCGA LUAD -0.259; TCGA LUSC -0.139; TCGA PRAD -0.33; TCGA SARC -0.101; TCGA THCA -0.331; TCGA STAD -0.209
hsa-miR-143-3p
SIX4
9 cancers: BLCA; BRCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.176; TCGA BRCA -0.281; TCGA KIRC -0.505; TCGA LUAD -0.115; TCGA LUSC -0.324; TCGA PRAD -0.212; TCGA SARC -0.438; TCGA STAD -0.177; TCGA UCEC -0.217
hsa-miR-143-3p
SMARCD2
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.066; TCGA BRCA -0.148; TCGA COAD -0.153; TCGA HNSC -0.072; TCGA KIRP -0.071; TCGA LIHC -0.121; TCGA LUAD -0.09; TCGA LUSC -0.181; TCGA PRAD -0.141; TCGA SARC -0.137; TCGA STAD -0.138; TCGA UCEC -0.063
hsa-miR-143-3p
HMGA1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.135; TCGA BRCA -0.244; TCGA COAD -0.177; TCGA ESCA -0.205; TCGA HNSC -0.126; TCGA KIRC -0.216; TCGA LUAD -0.133; TCGA LUSC -0.48; TCGA PRAD -0.189; TCGA SARC -0.321; TCGA THCA -0.276; TCGA STAD -0.333; TCGA UCEC -0.22
hsa-miR-143-3p
DTNB
12 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.075; TCGA KIRC -0.219; TCGA KIRP -0.125; TCGA LIHC -0.094; TCGA LUAD -0.061; TCGA LUSC -0.199; TCGA PAAD -0.225; TCGA PRAD -0.221; TCGA SARC -0.203; TCGA STAD -0.152; TCGA UCEC -0.227
hsa-miR-143-3p
FBXO46
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.154; TCGA COAD -0.096; TCGA ESCA -0.091; TCGA HNSC -0.156; TCGA LGG -0.052; TCGA LIHC -0.081; TCGA LUAD -0.17; TCGA LUSC -0.301; TCGA PAAD -0.139; TCGA PRAD -0.266; TCGA STAD -0.101
hsa-miR-143-3p
TSPAN13
10 cancers: BLCA; BRCA; COAD; ESCA; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.127; TCGA BRCA -0.327; TCGA COAD -0.209; TCGA ESCA -0.342; TCGA PAAD -0.179; TCGA PRAD -0.376; TCGA SARC -0.247; TCGA THCA -0.061; TCGA STAD -0.414; TCGA UCEC -0.097
hsa-miR-143-3p
RNF114
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; OV; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.097; TCGA COAD -0.121; TCGA ESCA -0.14; TCGA HNSC -0.077; TCGA KIRC -0.096; TCGA LIHC -0.069; TCGA OV -0.087; TCGA PRAD -0.059; TCGA STAD -0.118; TCGA UCEC -0.065
hsa-miR-143-3p
GOLM1
11 cancers: BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.264; TCGA CESC -0.192; TCGA ESCA -0.345; TCGA KIRC -0.284; TCGA LGG -0.113; TCGA LUAD -0.177; TCGA LUSC -0.107; TCGA PRAD -0.298; TCGA SARC -0.494; TCGA STAD -0.299; TCGA UCEC -0.118
hsa-miR-143-3p
G3BP1
9 cancers: BRCA; COAD; ESCA; LUSC; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.094; TCGA COAD -0.137; TCGA ESCA -0.114; TCGA LUSC -0.144; TCGA OV -0.059; TCGA PRAD -0.104; TCGA SARC -0.071; TCGA STAD -0.195; TCGA UCEC -0.054
hsa-miR-143-3p
CENPP
9 cancers: BRCA; COAD; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.226; TCGA COAD -0.136; TCGA HNSC -0.229; TCGA LIHC -0.136; TCGA LUSC -0.342; TCGA PRAD -0.294; TCGA SARC -0.083; TCGA THCA -0.153; TCGA STAD -0.06
hsa-miR-143-3p
PRPF19
11 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BRCA -0.158; TCGA COAD -0.11; TCGA HNSC -0.066; TCGA LIHC -0.105; TCGA LUAD -0.06; TCGA LUSC -0.239; TCGA PAAD -0.092; TCGA PRAD -0.17; TCGA SARC -0.09; TCGA THCA -0.059; TCGA STAD -0.125
hsa-miR-143-3p
AMMECR1
9 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LUSC; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.113; TCGA COAD -0.094; TCGA ESCA -0.141; TCGA KIRC -0.13; TCGA KIRP -0.083; TCGA LUSC -0.271; TCGA SARC -0.188; TCGA STAD -0.269; TCGA UCEC -0.114
hsa-miR-143-3p
LIMK1
9 cancers: BRCA; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.056; TCGA KIRP -0.097; TCGA LUAD -0.117; TCGA LUSC -0.132; TCGA PRAD -0.135; TCGA SARC -0.381; TCGA THCA -0.138; TCGA STAD -0.163; TCGA UCEC -0.07
hsa-miR-143-3p
EIF4A3
11 cancers: BRCA; CESC; COAD; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD
RAID
TCGA BRCA -0.17; TCGA CESC -0.052; TCGA COAD -0.139; TCGA LGG -0.053; TCGA LIHC -0.091; TCGA LUAD -0.074; TCGA LUSC -0.183; TCGA OV -0.085; TCGA PRAD -0.135; TCGA SARC -0.068; TCGA STAD -0.171
hsa-miR-143-3p
APPL2
9 cancers: COAD; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA COAD -0.102; TCGA KIRC -0.079; TCGA KIRP -0.061; TCGA LGG -0.074; TCGA LUSC -0.121; TCGA PAAD -0.105; TCGA PRAD -0.104; TCGA SARC -0.114; TCGA STAD -0.121
hsa-miR-143-3p
PC
9 cancers: KIRC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA KIRC -0.194; TCGA LIHC -0.193; TCGA LUAD -0.157; TCGA LUSC -0.33; TCGA PRAD -0.145; TCGA SARC -0.188; TCGA THCA -0.182; TCGA STAD -0.129; TCGA UCEC -0.14





Enriched cancer pathways of putative targets