microRNA information: hsa-miR-143-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-143-3p | miRbase |
| Accession: | MIMAT0000435 | miRbase |
| Precursor name: | hsa-mir-143 | miRbase |
| Precursor accession: | MI0000459 | miRbase |
| Symbol: | MIR143 | HGNC |
| RefSeq ID: | NR_029684 | GenBank |
| Sequence: | UGAGAUGAAGCACUGUAGCUC |
Reported expression in cancers: hsa-miR-143-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-143-3p | T cell leukemia | upregulation | "The expression of miR-143 was up-regulated during ......" | 19464056 | |
| hsa-miR-143-3p | bladder cancer | downregulation | "MicroRNA expression signatures of bladder cancer r ......" | 21464941 | RNA-Seq; qPCR |
| hsa-miR-143-3p | bladder cancer | downregulation | "This study has provided novel important evidence w ......" | 23104321 | |
| hsa-miR-143-3p | breast cancer | downregulation | "MiRNA expression profiles in 11 PMBCs were analyze ......" | 23691441 | qPCR; Microarray |
| hsa-miR-143-3p | breast cancer | downregulation | "Here we investigate the role of miR-143 in breast ......" | 24218337 | |
| hsa-miR-143-3p | cervical and endocervical cancer | downregulation | "Down-regulation was reported most consistently for ......" | 25920605 | |
| hsa-miR-143-3p | cervical and endocervical cancer | downregulation | "The expression pattern of miR-143 was also evaluat ......" | 26854447 | Northern blot |
| hsa-miR-143-3p | colon cancer | downregulation | "miR 143 overexpression impairs growth of human col ......" | 21901135 | qPCR |
| hsa-miR-143-3p | colon cancer | downregulation | "miR-143 is located at a fragile site on chromosome ......" | 22691140 | Microarray |
| hsa-miR-143-3p | colon cancer | downregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
| hsa-miR-143-3p | colon cancer | downregulation | "miR-143 and miR-145 are downregulated in colon can ......" | 26824186 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | qPCR |
| hsa-miR-143-3p | colorectal cancer | downregulation | "MicroRNA 143 targets DNA methyltransferases 3A in ......" | 19638978 | qPCR |
| hsa-miR-143-3p | colorectal cancer | downregulation | "MicroRNAs are aberrantly expressed in cancer; micr ......" | 19843160 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "Role of anti oncomirs miR 143 and 145 in human col ......" | 20094072 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "Elevated expression of miR-31 p = 0.004 and mi ......" | 21739196 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "MicroRNA-143 miRNA-143 is frequently down-regulate ......" | 22549179 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "We previously reported that miR-143 and -145 are f ......" | 23397547 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "MicroRNA 143 inhibits tumor growth and angiogenesi ......" | 23574723 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "The expression levels of miR-143 -145 and -34a wer ......" | 25584614 | |
| hsa-miR-143-3p | colorectal cancer | downregulation | "Expression of 16 miRNAs miRNA-9 21 30d 31 106a 127 ......" | 25773836 | qPCR |
| hsa-miR-143-3p | colorectal cancer | downregulation | "Secondly validation of the results was carried out ......" | 27365381 | qPCR |
| hsa-miR-143-3p | endometrial cancer | downregulation | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | Microarray; qPCR |
| hsa-miR-143-3p | esophageal cancer | deregulation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
| hsa-miR-143-3p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
| hsa-miR-143-3p | esophageal cancer | deregulation | "The relative expression levels of the following mi ......" | 25667498 | qPCR |
| hsa-miR-143-3p | esophageal cancer | deregulation | "MiR-143-3p has been identified to function as a tu ......" | 27358073 | |
| hsa-miR-143-3p | gastric cancer | downregulation | "miR-143 was detected by quantitative real-time PCR ......" | 25492481 | qPCR |
| hsa-miR-143-3p | gastric cancer | downregulation | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | |
| hsa-miR-143-3p | gastric cancer | downregulation | "Results indicated that the expression of miR-143 w ......" | 26349981 | |
| hsa-miR-143-3p | glioblastoma | downregulation | "The results showed that the expression of miR-143 ......" | 26541455 | |
| hsa-miR-143-3p | kidney renal cell cancer | downregulation | "The expression levels of miR-143 and miR-145 were ......" | 24033605 | |
| hsa-miR-143-3p | liver cancer | upregulation | "Serum microRNA 143 and microRNA 215 as potential b ......" | 24993656 | qPCR |
| hsa-miR-143-3p | liver cancer | upregulation | "Real-time quantitative PCR was utilized to detect ......" | 25270212 | qPCR |
| hsa-miR-143-3p | lung cancer | downregulation | "Targeting PKCε by miR 143 regulates cell apoptosi ......" | 24070896 | |
| hsa-miR-143-3p | lung squamous cell cancer | downregulation | "The levels of two mature miRNAs miR-143 and miR-15 ......" | 24286416 | qPCR |
| hsa-miR-143-3p | lymphoma | downregulation | "Histone deacetylase inhibitor prevents cell growth ......" | 24577510 | Microarray |
| hsa-miR-143-3p | melanoma | downregulation | "We found that miR-143 expression was significantly ......" | 24722758 | |
| hsa-miR-143-3p | ovarian cancer | downregulation | "The aim of this study was to find specific profile ......" | 23542579 | Microarray; qPCR |
| hsa-miR-143-3p | pancreatic cancer | upregulation | "Changes in miR 143 and miR 21 expression and clini ......" | 22836856 | |
| hsa-miR-143-3p | prostate cancer | downregulation | "Down-regulation of miR-143 has been reported in a ......" | 26269764 | |
| hsa-miR-143-3p | prostate cancer | downregulation | "In prior work miR-143 was markedly downregulated i ......" | 26721309 | |
| hsa-miR-143-3p | sarcoma | downregulation | "miR-143 was the most downregulated miRNA P < 0.01 ......" | 21427707 | Microarray |
| hsa-miR-143-3p | sarcoma | downregulation | "Real-time PCR was used to measure miR-143 levels. ......" | 25576341 | qPCR |
Reported cancer pathway affected by hsa-miR-143-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-143-3p | T cell leukemia | Apoptosis pathway | "Role of microRNA 143 in Fas mediated apoptosis in ......" | 19464056 | |
| hsa-miR-143-3p | bladder cancer | MAPK signaling pathway | "Replacement treatment with microRNA 143 and 145 in ......" | 23104321 | Luciferase |
| hsa-miR-143-3p | breast cancer | Apoptosis pathway; cell cycle pathway | "Long noncoding RNA UCA1 modulates breast cancer ce ......" | 26439035 | Luciferase; Flow cytometry; MTT assay |
| hsa-miR-143-3p | breast cancer | Epithelial mesenchymal transition pathway | "miR 143 suppresses epithelial mesenchymal transiti ......" | 26618772 | |
| hsa-miR-143-3p | cervical and endocervical cancer | Apoptosis pathway | "miR 143 is downregulated in cervical cancer and pr ......" | 22160209 | Luciferase |
| hsa-miR-143-3p | cervical and endocervical cancer | Apoptosis pathway | "E3 ubiquitin ligase isolated by differential displ ......" | 27446260 | Western blot; Colony formation |
| hsa-miR-143-3p | colon cancer | Apoptosis pathway | "miR 143 overexpression impairs growth of human col ......" | 21901135 | |
| hsa-miR-143-3p | colorectal cancer | Apoptosis pathway | "Characterized mechanism of alpha mangostin induced ......" | 17553685 | Western blot |
| hsa-miR-143-3p | colorectal cancer | Apoptosis pathway | "MicroRNA-143 miRNA-143 is frequently down-regulate ......" | 22549179 | |
| hsa-miR-143-3p | colorectal cancer | p53 signaling pathway | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-143-3p | colorectal cancer | Apoptosis pathway | "MicroRNA 143 replenishment re sensitizes colorecta ......" | 26581910 | |
| hsa-miR-143-3p | colorectal cancer | Apoptosis pathway | "miR 143 regulates proliferation and apoptosis of c ......" | 26629019 | |
| hsa-miR-143-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA miR-143 and miR-145 have been identified ......" | 27444415 | Luciferase |
| hsa-miR-143-3p | esophageal cancer | Apoptosis pathway | "MicroRNA 143 functions as a tumor suppressor in hu ......" | 23276710 | |
| hsa-miR-143-3p | esophageal cancer | Apoptosis pathway | "miR 143 inhibits tumor progression by targeting FA ......" | 26758433 | |
| hsa-miR-143-3p | esophageal cancer | cell cycle pathway; Epithelial mesenchymal transition pathway | "MiR 143 inhibits tumor cell proliferation and inva ......" | 26806810 | Luciferase |
| hsa-miR-143-3p | esophageal cancer | Epithelial mesenchymal transition pathway; Apoptosis pathway | "MiR 143 3p functions as a tumor suppressor by regu ......" | 27358073 | |
| hsa-miR-143-3p | gastric cancer | Apoptosis pathway | "MicroRNA 143 suppresses gastric cancer cell growth ......" | 24616567 | Western blot; Luciferase |
| hsa-miR-143-3p | gastric cancer | Apoptosis pathway | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 | MTT assay; Luciferase; Western blot |
| hsa-miR-143-3p | glioblastoma | Apoptosis pathway | "MiR 143 enhances the antitumor activity of shikoni ......" | 26541455 | |
| hsa-miR-143-3p | liver cancer | Apoptosis pathway | "miR 143 inhibits proliferation and invasion of hep ......" | 25270212 | Flow cytometry; MTT assay; Western blot |
| hsa-miR-143-3p | lung cancer | Apoptosis pathway | "Targeting PKCε by miR 143 regulates cell apoptosi ......" | 24070896 | |
| hsa-miR-143-3p | melanoma | Apoptosis pathway | "MicroRNA 143 targets Syndecan 1 to repress cell gr ......" | 24722758 | |
| hsa-miR-143-3p | prostate cancer | cell cycle pathway | "miR 143 decreases prostate cancer cells proliferat ......" | 21197560 | Western blot; Colony formation; MTT assay |
| hsa-miR-143-3p | prostate cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 143 acts as a tumor suppressor by targeti ......" | 26269764 | |
| hsa-miR-143-3p | prostate cancer | Apoptosis pathway | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-143-3p | sarcoma | Apoptosis pathway | "microRNA 143 down regulated in osteosarcoma promot ......" | 20878132 | |
| hsa-miR-143-3p | sarcoma | Apoptosis pathway | "Small RNA sequencing and functional characterizati ......" | 21693658 | |
| hsa-miR-143-3p | sarcoma | Apoptosis pathway | "Propofol inhibits proliferation and invasion of os ......" | 24762226 | |
| hsa-miR-143-3p | sarcoma | MAPK signaling pathway | "MiR 143 inhibits EGFR signaling dependent osteosar ......" | 25227664 | |
| hsa-miR-143-3p | sarcoma | Apoptosis pathway | "Effect of miR 143 on the apoptosis of osteosarcoma ......" | 26823739 | Western blot |
| hsa-miR-143-3p | sarcoma | Apoptosis pathway | "MicroRNA 143 promotes apoptosis of osteosarcoma ce ......" | 27133034 | Western blot; Flow cytometry |
Reported cancer prognosis affected by hsa-miR-143-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-143-3p | bladder cancer | progression; poor survival; recurrence | "miR 143 miR 222 and miR 452 are useful as tumor st ......" | 22426337 | |
| hsa-miR-143-3p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
| hsa-miR-143-3p | bladder cancer | motility | "A profile of miRNA expression was determined using ......" | 24966896 | |
| hsa-miR-143-3p | bladder cancer | poor survival | "Uncovering the clinical utility of miR 143 miR 145 ......" | 25804644 | |
| hsa-miR-143-3p | bladder cancer | worse prognosis | "Circulating microRNAs miR 92a miR 100 and miR 143 ......" | 26916216 | |
| hsa-miR-143-3p | breast cancer | staging | "Global miRNA analysis was performed on serum from ......" | 24694649 | |
| hsa-miR-143-3p | breast cancer | metastasis; progression | "In order to investigate the regulation of CD44 by ......" | 27121210 | Flow cytometry; Luciferase |
| hsa-miR-143-3p | breast cancer | malignant trasformation | "The expression levels of miR-143 miR-663a miR-668 ......" | 27236032 | |
| hsa-miR-143-3p | breast cancer | drug resistance | "18F FDG PET/CT for Monitoring the Response of Brea ......" | 27574783 | |
| hsa-miR-143-3p | cervical and endocervical cancer | tumorigenesis | "All cell lines examined contained no detectable mi ......" | 18596939 | |
| hsa-miR-143-3p | cervical and endocervical cancer | metastasis; tumor size; staging; differentiation; progression | "Clinical significance of miR 143 expression in wom ......" | 24517947 | |
| hsa-miR-143-3p | cervical and endocervical cancer | staging | "In this study we assessed the expression of transl ......" | 26854447 | Western blot |
| hsa-miR-143-3p | colon cancer | tumorigenesis | "To further investigate the in vivo biological sign ......" | 18172508 | |
| hsa-miR-143-3p | colon cancer | progression | "miR 143 overexpression impairs growth of human col ......" | 21901135 | |
| hsa-miR-143-3p | colon cancer | tumorigenesis | "Both miR-143 and miR-145 have been shown to posses ......" | 22897626 | |
| hsa-miR-143-3p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
| hsa-miR-143-3p | colorectal cancer | tumorigenesis | "Role of miR 143 targeting KRAS in colorectal tumor ......" | 19137007 | Luciferase |
| hsa-miR-143-3p | colorectal cancer | progression | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | |
| hsa-miR-143-3p | colorectal cancer | drug resistance | "MicroRNA 143 reduces viability and increases sensi ......" | 19843160 | |
| hsa-miR-143-3p | colorectal cancer | differentiation | "SW620 CRC cells were stably transduced with miR-14 ......" | 19843336 | |
| hsa-miR-143-3p | colorectal cancer | staging; progression; tumorigenesis | "Role of anti oncomirs miR 143 and 145 in human col ......" | 20094072 | |
| hsa-miR-143-3p | colorectal cancer | metastasis; tumorigenesis | "Relevance of miR 21 and miR 143 expression in tiss ......" | 20620599 | |
| hsa-miR-143-3p | colorectal cancer | drug resistance; differentiation | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-143-3p | colorectal cancer | metastasis | "In turn the level of miR-143 in CRC cells decreasi ......" | 23173124 | |
| hsa-miR-143-3p | colorectal cancer | staging; metastasis; drug resistance | "MicroRNA 143 inhibits tumor growth and angiogenesi ......" | 23574723 | |
| hsa-miR-143-3p | colorectal cancer | drug resistance | "MicroRNA 143 is a putative predictive factor for t ......" | 26392389 | |
| hsa-miR-143-3p | colorectal cancer | metastasis | "Secondly validation of the results was carried out ......" | 27365381 | |
| hsa-miR-143-3p | endometrial cancer | worse prognosis; poor survival | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | |
| hsa-miR-143-3p | esophageal cancer | metastasis; worse prognosis | "The cluster of miR 143 and miR 145 affects the ris ......" | 22457808 | Luciferase; Western blot |
| hsa-miR-143-3p | esophageal cancer | staging; metastasis; poor survival; recurrence; worse prognosis; drug resistance | "There are several microRNAs that have been consist ......" | 23092342 | |
| hsa-miR-143-3p | esophageal cancer | metastasis | "MicroRNA 143 functions as a tumor suppressor in hu ......" | 23276710 | |
| hsa-miR-143-3p | esophageal cancer | drug resistance | "Esophageal cancer selective expression of TRAIL me ......" | 24659424 | |
| hsa-miR-143-3p | esophageal cancer | poor survival; metastasis | "TaqMan human miRNA arrays and bioinformatics were ......" | 25030863 | |
| hsa-miR-143-3p | esophageal cancer | staging | "Deregulation of miR 93 and miR 143 in human esopha ......" | 26427659 | |
| hsa-miR-143-3p | esophageal cancer | progression | "miR 143 inhibits tumor progression by targeting FA ......" | 26758433 | |
| hsa-miR-143-3p | esophageal cancer | staging; metastasis; cell migration | "MiR 143 inhibits tumor cell proliferation and inva ......" | 26806810 | Luciferase |
| hsa-miR-143-3p | esophageal cancer | progression; worse prognosis; motility | "MiR 143 3p functions as a tumor suppressor by regu ......" | 27358073 | |
| hsa-miR-143-3p | gastric cancer | staging | "miR-32 miR-182 and miR-143 dysregulated expression ......" | 21874264 | |
| hsa-miR-143-3p | gastric cancer | metastasis | "Conversely the expression of miR-143 and -195 in c ......" | 24649051 | |
| hsa-miR-143-3p | gastric cancer | drug resistance | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 | MTT assay; Luciferase; Western blot |
| hsa-miR-143-3p | gastric cancer | metastasis; cell migration; progression | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | Transwell assay |
| hsa-miR-143-3p | gastric cancer | drug resistance | "MicroRNA 143 enhances chemosensitivity of Querceti ......" | 26349981 | Western blot |
| hsa-miR-143-3p | glioblastoma | drug resistance; staging | "The SOX2 response program in glioblastoma multifor ......" | 21211035 | Colony formation |
| hsa-miR-143-3p | glioblastoma | differentiation | "miR 143 inhibits glycolysis and depletes stemness ......" | 23376635 | |
| hsa-miR-143-3p | lung squamous cell cancer | worse prognosis; staging; poor survival | "Deregulated expression of miR 21 miR 143 and miR 1 ......" | 20363096 | |
| hsa-miR-143-3p | lung squamous cell cancer | metastasis; cell migration | "MicroRNA 143 inhibits migration and invasion of hu ......" | 23904792 | |
| hsa-miR-143-3p | melanoma | staging; malignant trasformation | "MicroRNA 143 targets Syndecan 1 to repress cell gr ......" | 24722758 | |
| hsa-miR-143-3p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
| hsa-miR-143-3p | ovarian cancer | drug resistance | "MiRNAs sequencing data from 487 SEOC patients were ......" | 25485872 | |
| hsa-miR-143-3p | ovarian cancer | poor survival | "The authors used quantitative polymerase chain rea ......" | 25556270 | Western blot |
| hsa-miR-143-3p | ovarian cancer | metastasis; tumorigenesis; staging | "MiR 143 targets CTGF and exerts tumor suppressing ......" | 27398154 | Luciferase |
| hsa-miR-143-3p | pancreatic cancer | metastasis | "miR 143 inhibits the metastasis of pancreatic canc ......" | 23070684 | Western blot |
| hsa-miR-143-3p | pancreatic cancer | staging | "Using Affymetrix microarrays we established a glob ......" | 26807325 | |
| hsa-miR-143-3p | prostate cancer | progression; staging | "miR 143 interferes with ERK5 signaling and abrogat ......" | 19855844 | Luciferase |
| hsa-miR-143-3p | prostate cancer | tumorigenesis | "miR 143 decreases prostate cancer cells proliferat ......" | 21197560 | Western blot; Colony formation; MTT assay |
| hsa-miR-143-3p | prostate cancer | metastasis; progression | "miR 143 and miR 145 inhibit stem cell characterist ......" | 22948942 | Colony formation |
| hsa-miR-143-3p | prostate cancer | metastasis; differentiation; progression; motility | "Up regulated microRNA 143 in cancer stem cells dif ......" | 23383988 | Transwell assay; Luciferase |
| hsa-miR-143-3p | prostate cancer | cell migration; metastasis | "MicroRNA 143 inhibits cell migration and invasion ......" | 23732700 | Western blot; Luciferase |
| hsa-miR-143-3p | prostate cancer | cell migration | "Restoration of miR-143 or miR-145 in PCa cell line ......" | 24284362 | Luciferase |
| hsa-miR-143-3p | prostate cancer | drug resistance | "To solve this problem we inserted miRNA response e ......" | 24292881 | Luciferase |
| hsa-miR-143-3p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
| hsa-miR-143-3p | prostate cancer | metastasis | "We identify that TGFβ1-related miR-143 miR-145 mi ......" | 24763824 | |
| hsa-miR-143-3p | prostate cancer | malignant trasformation; drug resistance | "Mitigation of arsenic induced acquired cancer phen ......" | 26721309 | |
| hsa-miR-143-3p | prostate cancer | drug resistance | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-143-3p | sarcoma | metastasis | "MicroRNA 143 regulates human osteosarcoma metastas ......" | 21427707 | Western blot |
| hsa-miR-143-3p | sarcoma | metastasis | "Levels of six candidate miRNAs miR-21 miR-199a-3p ......" | 23269581 | |
| hsa-miR-143-3p | sarcoma | cell migration | "TGF β1 promotes osteosarcoma cell migration and i ......" | 25562163 | Western blot; Luciferase |
| hsa-miR-143-3p | sarcoma | poor survival; drug resistance; worse prognosis | "microRNA 143 is associated with the survival of AL ......" | 25576341 | Western blot; Colony formation; MTT assay |
| hsa-miR-143-3p | sarcoma | metastasis | "PAI 1 a target gene of miR 143 regulates invasion ......" | 26817521 | |
| hsa-miR-143-3p | sarcoma | progression; cell migration | "MicroRNA 143 promotes apoptosis of osteosarcoma ce ......" | 27133034 | Western blot; Flow cytometry |
Reported gene related to hsa-miR-143-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-143-3p | cervical and endocervical cancer | BCL2 | "miR 143 is downregulated in cervical cancer and pr ......" | 22160209 |
| hsa-miR-143-3p | colorectal cancer | BCL2 | "In addition extracellular-regulated protein kinase ......" | 19843160 |
| hsa-miR-143-3p | gastric cancer | BCL2 | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 |
| hsa-miR-143-3p | sarcoma | BCL2 | "In chemoresistant SAOS-2 and U2OS osteosarcomas ce ......" | 25576341 |
| hsa-miR-143-3p | sarcoma | BCL2 | "microRNA 143 down regulated in osteosarcoma promot ......" | 20878132 |
| hsa-miR-143-3p | sarcoma | BCL2 | "To our knowledge it was the first time to target B ......" | 27133034 |
| hsa-miR-143-3p | sarcoma | BCL2 | "Real-time fluorescent RT-PCR was used to quantify ......" | 26823739 |
| hsa-miR-143-3p | colon cancer | KRAS | "Stable miR-143 or miR-145 overexpression increased ......" | 26824186 |
| hsa-miR-143-3p | colorectal cancer | KRAS | "In KRAS mutated tumours increased miR-200b and dec ......" | 22804917 |
| hsa-miR-143-3p | colorectal cancer | KRAS | "The expression of miR-143 is often down-regulated ......" | 27725862 |
| hsa-miR-143-3p | colorectal cancer | KRAS | "Role of miR 143 targeting KRAS in colorectal tumor ......" | 19137007 |
| hsa-miR-143-3p | colorectal cancer | KRAS | "MicroRNA 143 replenishment re sensitizes colorecta ......" | 26581910 |
| hsa-miR-143-3p | colorectal cancer | KRAS | "In turn the level of miR-143 in CRC cells decreasi ......" | 23173124 |
| hsa-miR-143-3p | prostate cancer | KRAS | "miR 143 decreases prostate cancer cells proliferat ......" | 21197560 |
| hsa-miR-143-3p | breast cancer | HK2 | "We previously identified hexokinase 2 the major gl ......" | 27574783 |
| hsa-miR-143-3p | colon cancer | HK2 | "MicroRNA 143 down regulates Hexokinase 2 in colon ......" | 22691140 |
| hsa-miR-143-3p | glioblastoma | HK2 | "We show that miR-143 is significantly down-regulat ......" | 23376635 |
| hsa-miR-143-3p | kidney renal cell cancer | HK2 | "Luciferase reporter assays showed that both miR-14 ......" | 24033605 |
| hsa-miR-143-3p | lung squamous cell cancer | HK2 | "Furthermore knockdown of ATG2B and hexokinase 2 a ......" | 25322940 |
| hsa-miR-143-3p | prostate cancer | HK2 | "MicroRNA 143 acts as a tumor suppressor by targeti ......" | 26269764 |
| hsa-miR-143-3p | T cell leukemia | MAPK7 | "On the contrary an extracellular signal-regulated ......" | 19464056 |
| hsa-miR-143-3p | bladder cancer | MAPK7 | "We recently reported that both microRNA miR-143 an ......" | 23104321 |
| hsa-miR-143-3p | bladder cancer | MAPK7 | "These findings suggest that the chemically-modifie ......" | 21550168 |
| hsa-miR-143-3p | breast cancer | MAPK7 | "miR 143 suppresses epithelial mesenchymal transiti ......" | 26618772 |
| hsa-miR-143-3p | colorectal cancer | MAPK7 | "Interestingly the level of microRNA-143 which nega ......" | 17553685 |
| hsa-miR-143-3p | prostate cancer | MAPK7 | "miR 143 interferes with ERK5 signaling and abrogat ......" | 19855844 |
| hsa-miR-143-3p | prostate cancer | MMP13 | "MicroRNA 143 inhibits cell migration and invasion ......" | 23732700 |
| hsa-miR-143-3p | sarcoma | MMP13 | "Western blot analyses revealed that MMP-13 was mos ......" | 21427707 |
| hsa-miR-143-3p | sarcoma | MMP13 | "Moreover the overexpression of miR-143 decreased M ......" | 24762226 |
| hsa-miR-143-3p | lung squamous cell cancer | ATG2B | "miR 143 inhibits cell proliferation by targeting a ......" | 25322940 |
| hsa-miR-143-3p | sarcoma | ATG2B | "In chemoresistant SAOS-2 and U2OS osteosarcomas ce ......" | 25576341 |
| hsa-miR-143-3p | breast cancer | DNMT3A | "Ectopic expression of miR-143 inhibited proliferat ......" | 24218337 |
| hsa-miR-143-3p | colorectal cancer | DNMT3A | "Using in silico predictions DNA methyltranferase 3 ......" | 19638978 |
| hsa-miR-143-3p | colon cancer | EGFR | "EGFR signals downregulate tumor suppressors miR 14 ......" | 21653642 |
| hsa-miR-143-3p | sarcoma | EGFR | "MiR 143 inhibits EGFR signaling dependent osteosar ......" | 25227664 |
| hsa-miR-143-3p | colorectal cancer | IGF1R | "MiR 143 and MiR 145 regulate IGF1R to suppress cel ......" | 25474488 |
| hsa-miR-143-3p | gastric cancer | IGF1R | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 |
| hsa-miR-143-3p | colorectal cancer | MACC1 | "MicroRNA 143 targets MACC1 to inhibit cell invasio ......" | 22533346 |
| hsa-miR-143-3p | colorectal cancer | MACC1 | "In turn the level of miR-143 in CRC cells decreasi ......" | 23173124 |
| hsa-miR-143-3p | prostate cancer | MMP9 | "Secreted matrix metalloproteinase MMP activity was ......" | 26721309 |
| hsa-miR-143-3p | sarcoma | MMP9 | "Here we reported significant lower level of miR-14 ......" | 25227664 |
| hsa-miR-143-3p | gastric cancer | PTGS2 | "MicroRNA 143 suppresses gastric cancer cell growth ......" | 24616567 |
| hsa-miR-143-3p | pancreatic cancer | PTGS2 | "miR 143 decreases COX 2 mRNA stability and express ......" | 23973710 |
| hsa-miR-143-3p | bladder cancer | SERPINE1 | "Mature miR-143 and miR-145 are coordinately expres ......" | 22108519 |
| hsa-miR-143-3p | sarcoma | SERPINE1 | "Immunohistochemical analysis using clinical sample ......" | 26817521 |
| hsa-miR-143-3p | colorectal cancer | TLR2 | "We also found that miR-143 a putative tumour suppr ......" | 23866094 |
| hsa-miR-143-3p | liver cancer | TLR2 | "miR 143 inhibits proliferation and invasion of hep ......" | 25270212 |
| hsa-miR-143-3p | colorectal cancer | TP53 | "Major mediators of the oncosuppression by miR-143 ......" | 23128394 |
| hsa-miR-143-3p | lung squamous cell cancer | TP53 | "p53 regulates the maturation process of miR-16 and ......" | 21400525 |
| hsa-miR-143-3p | prostate cancer | ABCG2 | "miR-143 restoration dysregulated the expression of ......" | 26721309 |
| hsa-miR-143-3p | melanoma | AGO2 | "miR-143 directly targeted the 3'-untranslated regi ......" | 24722758 |
| hsa-miR-143-3p | colorectal cancer | APC | "Our data clearly indicated that the decreased expr ......" | 23397547 |
| hsa-miR-143-3p | glioblastoma | BAG3 | "MiR 143 enhances the antitumor activity of shikoni ......" | 26541455 |
| hsa-miR-143-3p | cervical and endocervical cancer | CARD8 | "We measured the expression of mir-21 and mir-143 i ......" | 22194833 |
| hsa-miR-143-3p | T cell leukemia | CASP3 | "The increased expression of miR-143 emerged from 1 ......" | 19464056 |
| hsa-miR-143-3p | colorectal cancer | CD276 | "Consequently the direct target genes of miR-143 B7 ......" | 27626488 |
| hsa-miR-143-3p | breast cancer | CD44 | "A luciferase reporter assay demonstrated that miR- ......" | 27121210 |
| hsa-miR-143-3p | colorectal cancer | CEBPB | "The upregulated miR-155 attenuated miR-143 by inhi ......" | 27626488 |
| hsa-miR-143-3p | ovarian cancer | CTGF | "MiR 143 targets CTGF and exerts tumor suppressing ......" | 27398154 |
| hsa-miR-143-3p | colorectal cancer | DLD | "Characterized mechanism of alpha mangostin induced ......" | 17553685 |
| hsa-miR-143-3p | endometrial cancer | DNMT3B | "In univariate analysis the combination of DNMT3B o ......" | 24071015 |
| hsa-miR-143-3p | colorectal cancer | ENDOG | "Characterized mechanism of alpha mangostin induced ......" | 17553685 |
| hsa-miR-143-3p | breast cancer | ERBB3 | "miR 143 and miR 145 synergistically regulate ERBB3 ......" | 25248370 |
| hsa-miR-143-3p | esophageal cancer | FAM83F | "miR 143 inhibits tumor progression by targeting FA ......" | 26758433 |
| hsa-miR-143-3p | T cell leukemia | FAS | "Role of microRNA 143 in Fas mediated apoptosis in ......" | 19464056 |
| hsa-miR-143-3p | prostate cancer | FNDC3B | "Up regulated microRNA 143 in cancer stem cells dif ......" | 23383988 |
| hsa-miR-143-3p | esophageal cancer | FSCN1 | "The protein level of FSCN1 showed no significant l ......" | 22457808 |
| hsa-miR-143-3p | colorectal cancer | FXYD3 | "Furthermore FXYD3 an ion transport regulator and a ......" | 26392389 |
| hsa-miR-143-3p | gastric cancer | GABARAPL1 | "MicroRNA 143 enhances chemosensitivity of Querceti ......" | 26349981 |
| hsa-miR-143-3p | breast cancer | HK1 | "We previously identified hexokinase 2 the major gl ......" | 27574783 |
| hsa-miR-143-3p | colon cancer | HRAS | "The Evi1 microRNA 143 K Ras axis in colon cancer ......" | 21276449 |
| hsa-miR-143-3p | colorectal cancer | IGF1 | "Furthermore insulin-like growth factor-I receptor ......" | 23574723 |
| hsa-miR-143-3p | bladder cancer | ILK | "We newly elucidated that miR-143 targeted akt and ......" | 23104321 |
| hsa-miR-143-3p | prostate cancer | LIMK1 | "The anticancer effects of miR-143 overexpression a ......" | 26721309 |
| hsa-miR-143-3p | pancreatic cancer | MAP2K6 | "miR-143 were detected at fold levels of 0.41 ± 0. ......" | 23973710 |
| hsa-miR-143-3p | pancreatic cancer | MIA | "miR-143 were detected at fold levels of 0.41 ± 0. ......" | 23973710 |
| hsa-miR-143-3p | prostate cancer | MMP2 | "Secreted matrix metalloproteinase MMP activity was ......" | 26721309 |
| hsa-miR-143-3p | prostate cancer | MYO6 | "A computational search indicated the 3'-untranslat ......" | 20353999 |
| hsa-miR-143-3p | prostate cancer | NOTCH1 | "miR-143 restoration dysregulated the expression of ......" | 26721309 |
| hsa-miR-143-3p | glioblastoma | NUAK2 | "miR 143 inhibits oncogenic traits by degrading NUA ......" | 27081712 |
| hsa-miR-143-3p | pancreatic cancer | PCS | "Expression levels of miR-143 and miR-21 and correl ......" | 22836856 |
| hsa-miR-143-3p | sarcoma | PLK1 | "The downregulation of PRC1 and its docking partner ......" | 21693658 |
| hsa-miR-143-3p | sarcoma | PRC1 | "The downregulation of PRC1 and its docking partner ......" | 21693658 |
| hsa-miR-143-3p | breast cancer | PTEN | "Restoration of miR-143 expression in breast cancer ......" | 24218337 |
| hsa-miR-143-3p | esophageal cancer | QKI | "MiR 143 3p functions as a tumor suppressor by regu ......" | 27358073 |
| hsa-miR-143-3p | breast cancer | SCPEP1 | "UCA1 is present in Ago2-containing RNA-induced sil ......" | 26439035 |
| hsa-miR-143-3p | melanoma | SDC1 | "MicroRNA 143 targets Syndecan 1 to repress cell gr ......" | 24722758 |
| hsa-miR-143-3p | breast cancer | SMUG1 | "18F FDG PET/CT for Monitoring the Response of Brea ......" | 27574783 |
| hsa-miR-143-3p | glioblastoma | SOX2 | "Using next generation sequencing we identified 105 ......" | 21211035 |
| hsa-miR-143-3p | esophageal cancer | STAT3 | "MiR 143 inhibits tumor cell proliferation and inva ......" | 26806810 |
| hsa-miR-143-3p | melanoma | TCL1B | "In this study we investigated whether microRNA-143 ......" | 24722758 |
| hsa-miR-143-3p | colorectal cancer | TLR4 | "The regulation of Toll like receptor 2 by miR 143 ......" | 23866094 |
| hsa-miR-143-3p | breast cancer | TNFRSF10C | "Restoration of miR-143 expression in breast cancer ......" | 24218337 |
| hsa-miR-143-3p | prostate cancer | TWIST1 | "In the present study we investigated whether loss ......" | 26721309 |
| hsa-miR-143-3p | cervical and endocervical cancer | UBR5 | "Furthermore microRNA miR-143 expression levels wer ......" | 27446260 |
| hsa-miR-143-3p | breast cancer | UCA1 | "Long noncoding RNA UCA1 modulates breast cancer ce ......" | 26439035 |
| hsa-miR-143-3p | sarcoma | VCAN | "TGF β1 promotes osteosarcoma cell migration and i ......" | 25562163 |
| hsa-miR-143-3p | colorectal cancer | VTCN1 | "Consequently the direct target genes of miR-143 B7 ......" | 27626488 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-143-3p | HK2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.158; TCGA BRCA -0.087; TCGA CESC -0.138; TCGA COAD -0.285; TCGA ESCA -0.331; TCGA KIRP -0.251; TCGA LUSC -0.194; TCGA PRAD -0.194; TCGA SARC -0.307; TCGA STAD -0.535; TCGA UCEC -0.257 |
hsa-miR-143-3p | HRAS | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.163; TCGA BRCA -0.132; TCGA COAD -0.106; TCGA HNSC -0.25; TCGA KIRP -0.086; TCGA LIHC -0.141; TCGA LUAD -0.125; TCGA LUSC -0.234; TCGA PAAD -0.206; TCGA PRAD -0.331; TCGA THCA -0.101; TCGA STAD -0.085 |
hsa-miR-143-3p | MYO6 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.105; TCGA BRCA -0.186; TCGA COAD -0.128; TCGA ESCA -0.155; TCGA KIRC -0.158; TCGA KIRP -0.07; TCGA PRAD -0.283; TCGA THCA -0.081; TCGA STAD -0.214; TCGA UCEC -0.181 |
hsa-miR-143-3p | DLG3 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.085; TCGA BRCA -0.243; TCGA COAD -0.254; TCGA ESCA -0.104; TCGA KIRC -0.095; TCGA KIRP -0.054; TCGA LUAD -0.068; TCGA LUSC -0.124; TCGA PRAD -0.15; TCGA STAD -0.151 |
hsa-miR-143-3p | FAM111A | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.133; TCGA BRCA -0.108; TCGA CESC -0.105; TCGA COAD -0.18; TCGA ESCA -0.179; TCGA HNSC -0.1; TCGA KIRP -0.148; TCGA LIHC -0.057; TCGA PRAD -0.269; TCGA THCA -0.165; TCGA STAD -0.192; TCGA UCEC -0.052 |
hsa-miR-143-3p | ZNF182 | 10 cancers: BLCA; BRCA; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.11; TCGA BRCA -0.078; TCGA ESCA -0.112; TCGA KIRP -0.117; TCGA LGG -0.055; TCGA LUAD -0.113; TCGA LUSC -0.15; TCGA PAAD -0.117; TCGA PRAD -0.101; TCGA STAD -0.078 |
hsa-miR-143-3p | DCAKD | 9 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA | MirTarget | TCGA BLCA -0.093; TCGA KIRC -0.153; TCGA KIRP -0.113; TCGA LGG -0.077; TCGA LIHC -0.115; TCGA LUAD -0.052; TCGA LUSC -0.189; TCGA PAAD -0.199; TCGA THCA -0.056 |
hsa-miR-143-3p | EME1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.237; TCGA BRCA -0.415; TCGA CESC -0.138; TCGA COAD -0.285; TCGA ESCA -0.225; TCGA HNSC -0.222; TCGA KIRP -0.238; TCGA LGG -0.077; TCGA LIHC -0.239; TCGA LUAD -0.364; TCGA LUSC -0.783; TCGA PRAD -0.65; TCGA SARC -0.074; TCGA THCA -0.222; TCGA STAD -0.35; TCGA UCEC -0.318 |
hsa-miR-143-3p | ZWILCH | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.092; TCGA BRCA -0.187; TCGA COAD -0.175; TCGA ESCA -0.244; TCGA KIRC -0.065; TCGA KIRP -0.093; TCGA LUSC -0.342; TCGA PRAD -0.218; TCGA SARC -0.136; TCGA THCA -0.062; TCGA STAD -0.319; TCGA UCEC -0.076 |
hsa-miR-143-3p | ATG10 | 11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; PRAD; UCEC | MirTarget | TCGA BLCA -0.06; TCGA COAD -0.124; TCGA HNSC -0.096; TCGA KIRC -0.079; TCGA KIRP -0.07; TCGA LIHC -0.11; TCGA LUSC -0.129; TCGA OV -0.107; TCGA PAAD -0.1; TCGA PRAD -0.08; TCGA UCEC -0.058 |
hsa-miR-143-3p | TP53RK | 10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; OV; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.082; TCGA BRCA -0.122; TCGA ESCA -0.081; TCGA HNSC -0.058; TCGA LIHC -0.072; TCGA LUSC -0.056; TCGA OV -0.064; TCGA PRAD -0.087; TCGA SARC -0.098; TCGA STAD -0.071 |
hsa-miR-143-3p | TMEM69 | 13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.108; TCGA BRCA -0.102; TCGA COAD -0.113; TCGA HNSC -0.079; TCGA KIRC -0.066; TCGA LIHC -0.104; TCGA LUAD -0.058; TCGA LUSC -0.266; TCGA OV -0.059; TCGA PRAD -0.2; TCGA THCA -0.05; TCGA STAD -0.127; TCGA UCEC -0.059 |
hsa-miR-143-3p | SLC25A15 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.081; TCGA BRCA -0.192; TCGA CESC -0.082; TCGA COAD -0.141; TCGA ESCA -0.234; TCGA KIRC -0.255; TCGA LUSC -0.197; TCGA OV -0.099; TCGA PRAD -0.121; TCGA SARC -0.108; TCGA STAD -0.274; TCGA UCEC -0.101 |
hsa-miR-143-3p | DMTF1 | 9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD | MirTarget | TCGA BLCA -0.097; TCGA COAD -0.084; TCGA HNSC -0.077; TCGA KIRP -0.294; TCGA LGG -0.07; TCGA LUAD -0.13; TCGA LUSC -0.173; TCGA PAAD -0.184; TCGA PRAD -0.159 |
hsa-miR-143-3p | XPO5 | 12 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.077; TCGA BRCA -0.141; TCGA ESCA -0.151; TCGA KIRC -0.079; TCGA KIRP -0.072; TCGA LIHC -0.121; TCGA LUAD -0.052; TCGA LUSC -0.242; TCGA PRAD -0.135; TCGA SARC -0.085; TCGA STAD -0.213; TCGA UCEC -0.096 |
hsa-miR-143-3p | ABHD14A | 10 cancers: BLCA; COAD; KIRC; KIRP; LIHC; OV; PAAD; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.146; TCGA COAD -0.117; TCGA KIRC -0.161; TCGA KIRP -0.129; TCGA LIHC -0.169; TCGA OV -0.184; TCGA PAAD -0.495; TCGA PRAD -0.162; TCGA SARC -0.117; TCGA UCEC -0.069 |
hsa-miR-143-3p | EAPP | 9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; OV; PAAD; PRAD | MirTarget | TCGA BLCA -0.061; TCGA BRCA -0.074; TCGA COAD -0.077; TCGA HNSC -0.094; TCGA LGG -0.054; TCGA LIHC -0.058; TCGA OV -0.14; TCGA PAAD -0.06; TCGA PRAD -0.082 |
hsa-miR-143-3p | RAB11FIP4 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.209; TCGA BRCA -0.271; TCGA CESC -0.214; TCGA ESCA -0.249; TCGA KIRC -0.389; TCGA LUAD -0.057; TCGA PRAD -0.16; TCGA SARC -0.221; TCGA THCA -0.059; TCGA STAD -0.311; TCGA UCEC -0.31 |
hsa-miR-143-3p | ZDHHC23 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.196; TCGA BRCA -0.179; TCGA CESC -0.115; TCGA COAD -0.16; TCGA ESCA -0.283; TCGA KIRC -0.365; TCGA KIRP -0.206; TCGA LUAD -0.111; TCGA LUSC -0.277; TCGA PAAD -0.143; TCGA PRAD -0.238; TCGA STAD -0.409; TCGA UCEC -0.223 |
hsa-miR-143-3p | SFXN1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.099; TCGA BRCA -0.224; TCGA CESC -0.069; TCGA COAD -0.158; TCGA ESCA -0.093; TCGA KIRC -0.094; TCGA LIHC -0.1; TCGA LUAD -0.093; TCGA LUSC -0.39; TCGA OV -0.073; TCGA PAAD -0.114; TCGA PRAD -0.077; TCGA STAD -0.243; TCGA UCEC -0.081 |
hsa-miR-143-3p | SRCIN1 | 11 cancers: BLCA; BRCA; CESC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.448; TCGA BRCA -0.21; TCGA CESC -0.269; TCGA KIRP -0.486; TCGA LUAD -0.363; TCGA LUSC -0.2; TCGA PAAD -0.696; TCGA PRAD -0.6; TCGA THCA -0.461; TCGA STAD -0.192; TCGA UCEC -0.15 |
hsa-miR-143-3p | SCAMP4 | 9 cancers: BLCA; BRCA; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.076; TCGA BRCA -0.127; TCGA KIRC -0.13; TCGA LUAD -0.051; TCGA PAAD -0.264; TCGA PRAD -0.115; TCGA SARC -0.104; TCGA THCA -0.053; TCGA STAD -0.096 |
hsa-miR-143-3p | CCDC58 | 16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.127; TCGA BRCA -0.155; TCGA COAD -0.196; TCGA ESCA -0.196; TCGA HNSC -0.186; TCGA KIRC -0.09; TCGA KIRP -0.084; TCGA LGG -0.05; TCGA LIHC -0.137; TCGA LUAD -0.062; TCGA LUSC -0.494; TCGA OV -0.097; TCGA PRAD -0.291; TCGA SARC -0.11; TCGA STAD -0.232; TCGA UCEC -0.076 |
hsa-miR-143-3p | CREBZF | 9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.105; TCGA COAD -0.126; TCGA HNSC -0.118; TCGA KIRP -0.153; TCGA LGG -0.078; TCGA LUAD -0.159; TCGA LUSC -0.24; TCGA PRAD -0.206; TCGA STAD -0.152 |
hsa-miR-143-3p | FAM60A | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; OV; STAD | MirTarget; miRNATAP | TCGA BLCA -0.129; TCGA COAD -0.141; TCGA ESCA -0.206; TCGA KIRC -0.238; TCGA KIRP -0.065; TCGA LGG -0.124; TCGA LUSC -0.261; TCGA OV -0.136; TCGA STAD -0.284 |
hsa-miR-143-3p | LASP1 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.062; TCGA BRCA -0.117; TCGA CESC -0.078; TCGA COAD -0.071; TCGA ESCA -0.147; TCGA KIRP -0.081; TCGA SARC -0.19; TCGA THCA -0.089; TCGA STAD -0.204 |
hsa-miR-143-3p | VHL | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.075; TCGA BRCA -0.068; TCGA CESC -0.105; TCGA COAD -0.161; TCGA ESCA -0.115; TCGA KIRC -0.104; TCGA LUSC -0.094; TCGA PRAD -0.106; TCGA STAD -0.125 |
hsa-miR-143-3p | GALNT7 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.077; TCGA BRCA -0.298; TCGA COAD -0.185; TCGA ESCA -0.18; TCGA KIRC -0.094; TCGA KIRP -0.085; TCGA LUSC -0.166; TCGA PRAD -0.266; TCGA SARC -0.108; TCGA THCA -0.255; TCGA STAD -0.202; TCGA UCEC -0.107 |
hsa-miR-143-3p | CHKA | 13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.082; TCGA CESC -0.125; TCGA COAD -0.147; TCGA KIRC -0.094; TCGA KIRP -0.164; TCGA LIHC -0.193; TCGA LUAD -0.14; TCGA PAAD -0.176; TCGA PRAD -0.297; TCGA SARC -0.07; TCGA STAD -0.201; TCGA UCEC -0.161 |
hsa-miR-143-3p | HMBS | 15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.08; TCGA BRCA -0.126; TCGA COAD -0.201; TCGA ESCA -0.107; TCGA HNSC -0.103; TCGA KIRC -0.161; TCGA KIRP -0.135; TCGA LIHC -0.104; TCGA LUAD -0.113; TCGA LUSC -0.235; TCGA OV -0.091; TCGA PRAD -0.302; TCGA SARC -0.142; TCGA STAD -0.214; TCGA UCEC -0.123 |
hsa-miR-143-3p | PHF6 | 9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LUSC; OV; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.082; TCGA BRCA -0.114; TCGA ESCA -0.137; TCGA KIRC -0.152; TCGA LGG -0.085; TCGA LUSC -0.224; TCGA OV -0.067; TCGA PRAD -0.081; TCGA STAD -0.216 |
hsa-miR-143-3p | CASP8 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.092; TCGA COAD -0.109; TCGA ESCA -0.193; TCGA HNSC -0.051; TCGA KIRP -0.062; TCGA LIHC -0.054; TCGA PRAD -0.083; TCGA SARC -0.079; TCGA STAD -0.214; TCGA UCEC -0.071 |
hsa-miR-143-3p | MOGS | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.139; TCGA BRCA -0.157; TCGA CESC -0.085; TCGA COAD -0.121; TCGA ESCA -0.129; TCGA KIRP -0.067; TCGA LIHC -0.124; TCGA LUAD -0.165; TCGA LUSC -0.182; TCGA PAAD -0.098; TCGA PRAD -0.222; TCGA SARC -0.144; TCGA THCA -0.094; TCGA STAD -0.195; TCGA UCEC -0.138 |
hsa-miR-143-3p | TIGD5 | 15 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.168; TCGA BRCA -0.217; TCGA CESC -0.075; TCGA COAD -0.105; TCGA HNSC -0.095; TCGA LGG -0.105; TCGA LIHC -0.13; TCGA LUAD -0.242; TCGA LUSC -0.356; TCGA PAAD -0.226; TCGA PRAD -0.357; TCGA SARC -0.122; TCGA THCA -0.1; TCGA STAD -0.177; TCGA UCEC -0.073 |
hsa-miR-143-3p | GNL3 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.142; TCGA BRCA -0.119; TCGA COAD -0.163; TCGA ESCA -0.124; TCGA HNSC -0.063; TCGA LIHC -0.091; TCGA LUAD -0.08; TCGA LUSC -0.196; TCGA OV -0.087; TCGA PRAD -0.389; TCGA SARC -0.076; TCGA STAD -0.279; TCGA UCEC -0.055 |
hsa-miR-143-3p | TMEM33 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.092; TCGA BRCA -0.096; TCGA CESC -0.075; TCGA COAD -0.127; TCGA ESCA -0.195; TCGA KIRC -0.193; TCGA PAAD -0.103; TCGA SARC -0.098; TCGA STAD -0.254; TCGA UCEC -0.059 |
hsa-miR-143-3p | GRHL2 | 9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.218; TCGA BRCA -0.374; TCGA CESC -0.106; TCGA COAD -0.174; TCGA KIRC -0.675; TCGA LUSC -0.335; TCGA PRAD -0.125; TCGA STAD -0.294; TCGA UCEC -0.363 |
hsa-miR-143-3p | DYRK1B | 11 cancers: BLCA; BRCA; CESC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.121; TCGA BRCA -0.162; TCGA CESC -0.069; TCGA KIRP -0.114; TCGA LUAD -0.076; TCGA LUSC -0.138; TCGA PAAD -0.278; TCGA PRAD -0.229; TCGA SARC -0.058; TCGA THCA -0.067; TCGA UCEC -0.109 |
hsa-miR-143-3p | NFXL1 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.107; TCGA BRCA -0.063; TCGA COAD -0.158; TCGA ESCA -0.124; TCGA KIRC -0.076; TCGA LUAD -0.058; TCGA LUSC -0.166; TCGA PRAD -0.098; TCGA STAD -0.243; TCGA UCEC -0.083 |
hsa-miR-143-3p | C1GALT1 | 10 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.061; TCGA CESC -0.099; TCGA COAD -0.09; TCGA ESCA -0.271; TCGA KIRC -0.147; TCGA KIRP -0.081; TCGA LIHC -0.091; TCGA SARC -0.109; TCGA STAD -0.234; TCGA UCEC -0.136 |
hsa-miR-143-3p | HEMK1 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.089; TCGA BRCA -0.069; TCGA COAD -0.13; TCGA HNSC -0.108; TCGA KIRC -0.098; TCGA KIRP -0.201; TCGA LIHC -0.136; TCGA LUAD -0.103; TCGA PAAD -0.133; TCGA PRAD -0.237; TCGA THCA -0.059 |
hsa-miR-143-3p | ONECUT2 | 13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.338; TCGA CESC -0.428; TCGA COAD -0.307; TCGA ESCA -0.675; TCGA KIRC -0.439; TCGA KIRP -0.554; TCGA LGG -0.106; TCGA LIHC -0.29; TCGA LUAD -0.275; TCGA LUSC -0.656; TCGA PRAD -0.723; TCGA SARC -0.146; TCGA UCEC -0.281 |
hsa-miR-143-3p | RALGPS1 | 9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.104; TCGA BRCA -0.163; TCGA COAD -0.137; TCGA KIRC -0.456; TCGA KIRP -0.122; TCGA LUAD -0.083; TCGA PAAD -0.326; TCGA STAD -0.123; TCGA UCEC -0.115 |
hsa-miR-143-3p | TOR2A | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.123; TCGA BRCA -0.207; TCGA CESC -0.086; TCGA COAD -0.193; TCGA ESCA -0.16; TCGA HNSC -0.151; TCGA LGG -0.074; TCGA LIHC -0.067; TCGA LUAD -0.154; TCGA LUSC -0.109; TCGA PAAD -0.212; TCGA PRAD -0.321; TCGA SARC -0.26; TCGA STAD -0.224; TCGA UCEC -0.124 |
hsa-miR-143-3p | IRGQ | 9 cancers: BLCA; BRCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.063; TCGA BRCA -0.068; TCGA KIRP -0.088; TCGA LIHC -0.075; TCGA LUAD -0.077; TCGA LUSC -0.147; TCGA PAAD -0.141; TCGA PRAD -0.155; TCGA THCA -0.052 |
hsa-miR-143-3p | TPM3 | 10 cancers: BLCA; BRCA; COAD; ESCA; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.053; TCGA BRCA -0.193; TCGA COAD -0.128; TCGA ESCA -0.154; TCGA OV -0.052; TCGA PRAD -0.058; TCGA SARC -0.35; TCGA THCA -0.052; TCGA STAD -0.236; TCGA UCEC -0.116 |
hsa-miR-143-3p | LPAR2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.279; TCGA BRCA -0.229; TCGA CESC -0.077; TCGA COAD -0.19; TCGA ESCA -0.133; TCGA HNSC -0.174; TCGA KIRP -0.166; TCGA LGG -0.114; TCGA LUAD -0.15; TCGA LUSC -0.262; TCGA PRAD -0.176; TCGA SARC -0.077; TCGA THCA -0.051; TCGA STAD -0.318; TCGA UCEC -0.207 |
hsa-miR-143-3p | BBC3 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.13; TCGA BRCA -0.217; TCGA COAD -0.122; TCGA HNSC -0.099; TCGA KIRP -0.335; TCGA LUAD -0.259; TCGA LUSC -0.139; TCGA PRAD -0.33; TCGA SARC -0.101; TCGA THCA -0.331; TCGA STAD -0.209 |
hsa-miR-143-3p | SIX4 | 9 cancers: BLCA; BRCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.176; TCGA BRCA -0.281; TCGA KIRC -0.505; TCGA LUAD -0.115; TCGA LUSC -0.324; TCGA PRAD -0.212; TCGA SARC -0.438; TCGA STAD -0.177; TCGA UCEC -0.217 |
hsa-miR-143-3p | SMARCD2 | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.066; TCGA BRCA -0.148; TCGA COAD -0.153; TCGA HNSC -0.072; TCGA KIRP -0.071; TCGA LIHC -0.121; TCGA LUAD -0.09; TCGA LUSC -0.181; TCGA PRAD -0.141; TCGA SARC -0.137; TCGA STAD -0.138; TCGA UCEC -0.063 |
hsa-miR-143-3p | HMGA1 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.135; TCGA BRCA -0.244; TCGA COAD -0.177; TCGA ESCA -0.205; TCGA HNSC -0.126; TCGA KIRC -0.216; TCGA LUAD -0.133; TCGA LUSC -0.48; TCGA PRAD -0.189; TCGA SARC -0.321; TCGA THCA -0.276; TCGA STAD -0.333; TCGA UCEC -0.22 |
hsa-miR-143-3p | DTNB | 12 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.162; TCGA BRCA -0.075; TCGA KIRC -0.219; TCGA KIRP -0.125; TCGA LIHC -0.094; TCGA LUAD -0.061; TCGA LUSC -0.199; TCGA PAAD -0.225; TCGA PRAD -0.221; TCGA SARC -0.203; TCGA STAD -0.152; TCGA UCEC -0.227 |
hsa-miR-143-3p | FBXO46 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.121; TCGA BRCA -0.154; TCGA COAD -0.096; TCGA ESCA -0.091; TCGA HNSC -0.156; TCGA LGG -0.052; TCGA LIHC -0.081; TCGA LUAD -0.17; TCGA LUSC -0.301; TCGA PAAD -0.139; TCGA PRAD -0.266; TCGA STAD -0.101 |
hsa-miR-143-3p | TSPAN13 | 10 cancers: BLCA; BRCA; COAD; ESCA; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.127; TCGA BRCA -0.327; TCGA COAD -0.209; TCGA ESCA -0.342; TCGA PAAD -0.179; TCGA PRAD -0.376; TCGA SARC -0.247; TCGA THCA -0.061; TCGA STAD -0.414; TCGA UCEC -0.097 |
hsa-miR-143-3p | RNF114 | 10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BRCA -0.097; TCGA COAD -0.121; TCGA ESCA -0.14; TCGA HNSC -0.077; TCGA KIRC -0.096; TCGA LIHC -0.069; TCGA OV -0.087; TCGA PRAD -0.059; TCGA STAD -0.118; TCGA UCEC -0.065 |
hsa-miR-143-3p | GOLM1 | 11 cancers: BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.264; TCGA CESC -0.192; TCGA ESCA -0.345; TCGA KIRC -0.284; TCGA LGG -0.113; TCGA LUAD -0.177; TCGA LUSC -0.107; TCGA PRAD -0.298; TCGA SARC -0.494; TCGA STAD -0.299; TCGA UCEC -0.118 |
hsa-miR-143-3p | G3BP1 | 9 cancers: BRCA; COAD; ESCA; LUSC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.094; TCGA COAD -0.137; TCGA ESCA -0.114; TCGA LUSC -0.144; TCGA OV -0.059; TCGA PRAD -0.104; TCGA SARC -0.071; TCGA STAD -0.195; TCGA UCEC -0.054 |
hsa-miR-143-3p | CENPP | 9 cancers: BRCA; COAD; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.226; TCGA COAD -0.136; TCGA HNSC -0.229; TCGA LIHC -0.136; TCGA LUSC -0.342; TCGA PRAD -0.294; TCGA SARC -0.083; TCGA THCA -0.153; TCGA STAD -0.06 |
hsa-miR-143-3p | PRPF19 | 11 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BRCA -0.158; TCGA COAD -0.11; TCGA HNSC -0.066; TCGA LIHC -0.105; TCGA LUAD -0.06; TCGA LUSC -0.239; TCGA PAAD -0.092; TCGA PRAD -0.17; TCGA SARC -0.09; TCGA THCA -0.059; TCGA STAD -0.125 |
hsa-miR-143-3p | AMMECR1 | 9 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.113; TCGA COAD -0.094; TCGA ESCA -0.141; TCGA KIRC -0.13; TCGA KIRP -0.083; TCGA LUSC -0.271; TCGA SARC -0.188; TCGA STAD -0.269; TCGA UCEC -0.114 |
hsa-miR-143-3p | LIMK1 | 9 cancers: BRCA; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.056; TCGA KIRP -0.097; TCGA LUAD -0.117; TCGA LUSC -0.132; TCGA PRAD -0.135; TCGA SARC -0.381; TCGA THCA -0.138; TCGA STAD -0.163; TCGA UCEC -0.07 |
hsa-miR-143-3p | EIF4A3 | 11 cancers: BRCA; CESC; COAD; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD | RAID | TCGA BRCA -0.17; TCGA CESC -0.052; TCGA COAD -0.139; TCGA LGG -0.053; TCGA LIHC -0.091; TCGA LUAD -0.074; TCGA LUSC -0.183; TCGA OV -0.085; TCGA PRAD -0.135; TCGA SARC -0.068; TCGA STAD -0.171 |
hsa-miR-143-3p | APPL2 | 9 cancers: COAD; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA COAD -0.102; TCGA KIRC -0.079; TCGA KIRP -0.061; TCGA LGG -0.074; TCGA LUSC -0.121; TCGA PAAD -0.105; TCGA PRAD -0.104; TCGA SARC -0.114; TCGA STAD -0.121 |
hsa-miR-143-3p | PC | 9 cancers: KIRC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA KIRC -0.194; TCGA LIHC -0.193; TCGA LUAD -0.157; TCGA LUSC -0.33; TCGA PRAD -0.145; TCGA SARC -0.188; TCGA THCA -0.182; TCGA STAD -0.129; TCGA UCEC -0.14 |
Enriched cancer pathways of putative targets