microRNA information: hsa-miR-143-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-143-5p | miRbase |
| Accession: | MIMAT0004599 | miRbase |
| Precursor name: | hsa-mir-143 | miRbase |
| Precursor accession: | MI0000459 | miRbase |
| Symbol: | MIR143 | HGNC |
| RefSeq ID: | NR_029684 | GenBank |
| Sequence: | GGUGCAGUGCUGCAUCUCUGGU |
Reported expression in cancers: hsa-miR-143-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-143-5p | T cell leukemia | upregulation | "The expression of miR-143 was up-regulated during ......" | 19464056 | |
| hsa-miR-143-5p | bladder cancer | downregulation | "MicroRNA expression signatures of bladder cancer r ......" | 21464941 | RNA-Seq; qPCR |
| hsa-miR-143-5p | bladder cancer | downregulation | "This study has provided novel important evidence w ......" | 23104321 | |
| hsa-miR-143-5p | breast cancer | downregulation | "MiRNA expression profiles in 11 PMBCs were analyze ......" | 23691441 | qPCR; Microarray |
| hsa-miR-143-5p | breast cancer | downregulation | "Here we investigate the role of miR-143 in breast ......" | 24218337 | |
| hsa-miR-143-5p | cervical and endocervical cancer | downregulation | "Down-regulation was reported most consistently for ......" | 25920605 | |
| hsa-miR-143-5p | cervical and endocervical cancer | downregulation | "The expression pattern of miR-143 was also evaluat ......" | 26854447 | Northern blot |
| hsa-miR-143-5p | colon cancer | downregulation | "miR 143 overexpression impairs growth of human col ......" | 21901135 | qPCR |
| hsa-miR-143-5p | colon cancer | downregulation | "miR-143 is located at a fragile site on chromosome ......" | 22691140 | Microarray |
| hsa-miR-143-5p | colon cancer | downregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
| hsa-miR-143-5p | colon cancer | downregulation | "miR-143 and miR-145 are downregulated in colon can ......" | 26824186 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | qPCR |
| hsa-miR-143-5p | colorectal cancer | downregulation | "MicroRNA 143 targets DNA methyltransferases 3A in ......" | 19638978 | qPCR |
| hsa-miR-143-5p | colorectal cancer | downregulation | "MicroRNAs are aberrantly expressed in cancer; micr ......" | 19843160 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "Role of anti oncomirs miR 143 and 145 in human col ......" | 20094072 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "Elevated expression of miR-31 p = 0.004 and mi ......" | 21739196 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "MicroRNA-143 miRNA-143 is frequently down-regulate ......" | 22549179 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "We previously reported that miR-143 and -145 are f ......" | 23397547 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "MicroRNA 143 inhibits tumor growth and angiogenesi ......" | 23574723 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "The expression levels of miR-143 -145 and -34a wer ......" | 25584614 | |
| hsa-miR-143-5p | colorectal cancer | downregulation | "Expression of 16 miRNAs miRNA-9 21 30d 31 106a 127 ......" | 25773836 | qPCR |
| hsa-miR-143-5p | colorectal cancer | downregulation | "Secondly validation of the results was carried out ......" | 27365381 | qPCR |
| hsa-miR-143-5p | endometrial cancer | downregulation | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | Microarray; qPCR |
| hsa-miR-143-5p | esophageal cancer | deregulation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
| hsa-miR-143-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
| hsa-miR-143-5p | esophageal cancer | deregulation | "The relative expression levels of the following mi ......" | 25667498 | qPCR |
| hsa-miR-143-5p | gastric cancer | downregulation | "miR-143 was detected by quantitative real-time PCR ......" | 25492481 | qPCR |
| hsa-miR-143-5p | gastric cancer | downregulation | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | |
| hsa-miR-143-5p | gastric cancer | downregulation | "Results indicated that the expression of miR-143 w ......" | 26349981 | |
| hsa-miR-143-5p | glioblastoma | downregulation | "The results showed that the expression of miR-143 ......" | 26541455 | |
| hsa-miR-143-5p | kidney renal cell cancer | downregulation | "The expression levels of miR-143 and miR-145 were ......" | 24033605 | |
| hsa-miR-143-5p | liver cancer | upregulation | "Serum microRNA 143 and microRNA 215 as potential b ......" | 24993656 | qPCR |
| hsa-miR-143-5p | liver cancer | upregulation | "Real-time quantitative PCR was utilized to detect ......" | 25270212 | qPCR |
| hsa-miR-143-5p | lung cancer | downregulation | "Targeting PKCε by miR 143 regulates cell apoptosi ......" | 24070896 | |
| hsa-miR-143-5p | lung squamous cell cancer | downregulation | "The levels of two mature miRNAs miR-143 and miR-15 ......" | 24286416 | qPCR |
| hsa-miR-143-5p | lymphoma | downregulation | "Histone deacetylase inhibitor prevents cell growth ......" | 24577510 | Microarray |
| hsa-miR-143-5p | melanoma | downregulation | "We found that miR-143 expression was significantly ......" | 24722758 | |
| hsa-miR-143-5p | ovarian cancer | downregulation | "The aim of this study was to find specific profile ......" | 23542579 | Microarray; qPCR |
| hsa-miR-143-5p | pancreatic cancer | upregulation | "Changes in miR 143 and miR 21 expression and clini ......" | 22836856 | |
| hsa-miR-143-5p | prostate cancer | downregulation | "Down-regulation of miR-143 has been reported in a ......" | 26269764 | |
| hsa-miR-143-5p | prostate cancer | downregulation | "In prior work miR-143 was markedly downregulated i ......" | 26721309 | |
| hsa-miR-143-5p | sarcoma | downregulation | "miR-143 was the most downregulated miRNA P < 0.01 ......" | 21427707 | Microarray |
| hsa-miR-143-5p | sarcoma | downregulation | "Real-time PCR was used to measure miR-143 levels. ......" | 25576341 | qPCR |
Reported cancer pathway affected by hsa-miR-143-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-143-5p | T cell leukemia | Apoptosis pathway | "Role of microRNA 143 in Fas mediated apoptosis in ......" | 19464056 | |
| hsa-miR-143-5p | bladder cancer | MAPK signaling pathway | "Replacement treatment with microRNA 143 and 145 in ......" | 23104321 | Luciferase |
| hsa-miR-143-5p | breast cancer | Apoptosis pathway; cell cycle pathway | "Long noncoding RNA UCA1 modulates breast cancer ce ......" | 26439035 | Luciferase; Flow cytometry; MTT assay |
| hsa-miR-143-5p | breast cancer | Epithelial mesenchymal transition pathway | "miR 143 suppresses epithelial mesenchymal transiti ......" | 26618772 | |
| hsa-miR-143-5p | cervical and endocervical cancer | Apoptosis pathway | "miR 143 is downregulated in cervical cancer and pr ......" | 22160209 | Luciferase |
| hsa-miR-143-5p | cervical and endocervical cancer | Apoptosis pathway | "E3 ubiquitin ligase isolated by differential displ ......" | 27446260 | Western blot; Colony formation |
| hsa-miR-143-5p | colon cancer | Apoptosis pathway | "miR 143 overexpression impairs growth of human col ......" | 21901135 | |
| hsa-miR-143-5p | colorectal cancer | Apoptosis pathway | "Characterized mechanism of alpha mangostin induced ......" | 17553685 | Western blot |
| hsa-miR-143-5p | colorectal cancer | Apoptosis pathway | "MicroRNA-143 miRNA-143 is frequently down-regulate ......" | 22549179 | |
| hsa-miR-143-5p | colorectal cancer | p53 signaling pathway | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-143-5p | colorectal cancer | Apoptosis pathway | "MicroRNA 143 replenishment re sensitizes colorecta ......" | 26581910 | |
| hsa-miR-143-5p | colorectal cancer | Apoptosis pathway | "miR 143 regulates proliferation and apoptosis of c ......" | 26629019 | |
| hsa-miR-143-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA miR-143 and miR-145 have been identified ......" | 27444415 | Luciferase |
| hsa-miR-143-5p | esophageal cancer | Apoptosis pathway | "MicroRNA 143 functions as a tumor suppressor in hu ......" | 23276710 | |
| hsa-miR-143-5p | esophageal cancer | Apoptosis pathway | "miR 143 inhibits tumor progression by targeting FA ......" | 26758433 | |
| hsa-miR-143-5p | esophageal cancer | cell cycle pathway; Epithelial mesenchymal transition pathway | "MiR 143 inhibits tumor cell proliferation and inva ......" | 26806810 | Luciferase |
| hsa-miR-143-5p | esophageal cancer | Epithelial mesenchymal transition pathway | "MiR 143 3p functions as a tumor suppressor by regu ......" | 27358073 | |
| hsa-miR-143-5p | gastric cancer | Apoptosis pathway | "MicroRNA 143 suppresses gastric cancer cell growth ......" | 24616567 | Western blot; Luciferase |
| hsa-miR-143-5p | gastric cancer | Apoptosis pathway | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 | MTT assay; Luciferase; Western blot |
| hsa-miR-143-5p | glioblastoma | Apoptosis pathway | "MiR 143 enhances the antitumor activity of shikoni ......" | 26541455 | |
| hsa-miR-143-5p | liver cancer | Apoptosis pathway | "miR 143 inhibits proliferation and invasion of hep ......" | 25270212 | Flow cytometry; MTT assay; Western blot |
| hsa-miR-143-5p | lung cancer | Apoptosis pathway | "Targeting PKCε by miR 143 regulates cell apoptosi ......" | 24070896 | |
| hsa-miR-143-5p | melanoma | Apoptosis pathway | "MicroRNA 143 targets Syndecan 1 to repress cell gr ......" | 24722758 | |
| hsa-miR-143-5p | prostate cancer | cell cycle pathway | "miR 143 decreases prostate cancer cells proliferat ......" | 21197560 | Western blot; Colony formation; MTT assay |
| hsa-miR-143-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 143 acts as a tumor suppressor by targeti ......" | 26269764 | |
| hsa-miR-143-5p | prostate cancer | Apoptosis pathway | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-143-5p | sarcoma | Apoptosis pathway | "microRNA 143 down regulated in osteosarcoma promot ......" | 20878132 | |
| hsa-miR-143-5p | sarcoma | Apoptosis pathway | "Small RNA sequencing and functional characterizati ......" | 21693658 | |
| hsa-miR-143-5p | sarcoma | Apoptosis pathway | "Propofol inhibits proliferation and invasion of os ......" | 24762226 | |
| hsa-miR-143-5p | sarcoma | MAPK signaling pathway | "MiR 143 inhibits EGFR signaling dependent osteosar ......" | 25227664 | |
| hsa-miR-143-5p | sarcoma | Apoptosis pathway | "Effect of miR 143 on the apoptosis of osteosarcoma ......" | 26823739 | Western blot |
| hsa-miR-143-5p | sarcoma | Apoptosis pathway | "MicroRNA 143 promotes apoptosis of osteosarcoma ce ......" | 27133034 | Western blot; Flow cytometry |
Reported cancer prognosis affected by hsa-miR-143-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-143-5p | bladder cancer | progression; poor survival; recurrence | "miR 143 miR 222 and miR 452 are useful as tumor st ......" | 22426337 | |
| hsa-miR-143-5p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
| hsa-miR-143-5p | bladder cancer | motility | "A profile of miRNA expression was determined using ......" | 24966896 | |
| hsa-miR-143-5p | bladder cancer | poor survival | "Uncovering the clinical utility of miR 143 miR 145 ......" | 25804644 | |
| hsa-miR-143-5p | bladder cancer | worse prognosis | "Circulating microRNAs miR 92a miR 100 and miR 143 ......" | 26916216 | |
| hsa-miR-143-5p | breast cancer | staging | "Global miRNA analysis was performed on serum from ......" | 24694649 | |
| hsa-miR-143-5p | breast cancer | metastasis; progression | "In order to investigate the regulation of CD44 by ......" | 27121210 | Flow cytometry; Luciferase |
| hsa-miR-143-5p | breast cancer | malignant trasformation | "The expression levels of miR-143 miR-663a miR-668 ......" | 27236032 | |
| hsa-miR-143-5p | breast cancer | drug resistance | "18F FDG PET/CT for Monitoring the Response of Brea ......" | 27574783 | |
| hsa-miR-143-5p | cervical and endocervical cancer | tumorigenesis | "All cell lines examined contained no detectable mi ......" | 18596939 | |
| hsa-miR-143-5p | cervical and endocervical cancer | metastasis; tumor size; staging; differentiation; progression | "Clinical significance of miR 143 expression in wom ......" | 24517947 | |
| hsa-miR-143-5p | cervical and endocervical cancer | staging | "In this study we assessed the expression of transl ......" | 26854447 | Western blot |
| hsa-miR-143-5p | colon cancer | tumorigenesis | "To further investigate the in vivo biological sign ......" | 18172508 | |
| hsa-miR-143-5p | colon cancer | progression | "miR 143 overexpression impairs growth of human col ......" | 21901135 | |
| hsa-miR-143-5p | colon cancer | tumorigenesis | "Both miR-143 and miR-145 have been shown to posses ......" | 22897626 | |
| hsa-miR-143-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
| hsa-miR-143-5p | colon cancer | staging | "Using miRNA microarrays we analysed 40 paired stag ......" | 24239208 | |
| hsa-miR-143-5p | colon cancer | staging | "Six miRNAs previously identified as prognostic mar ......" | 27247088 | |
| hsa-miR-143-5p | colorectal cancer | tumorigenesis | "Role of miR 143 targeting KRAS in colorectal tumor ......" | 19137007 | Luciferase |
| hsa-miR-143-5p | colorectal cancer | progression | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | |
| hsa-miR-143-5p | colorectal cancer | drug resistance | "MicroRNA 143 reduces viability and increases sensi ......" | 19843160 | |
| hsa-miR-143-5p | colorectal cancer | differentiation | "SW620 CRC cells were stably transduced with miR-14 ......" | 19843336 | |
| hsa-miR-143-5p | colorectal cancer | staging; progression; tumorigenesis | "Role of anti oncomirs miR 143 and 145 in human col ......" | 20094072 | |
| hsa-miR-143-5p | colorectal cancer | metastasis; tumorigenesis | "Relevance of miR 21 and miR 143 expression in tiss ......" | 20620599 | |
| hsa-miR-143-5p | colorectal cancer | drug resistance; differentiation | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-143-5p | colorectal cancer | metastasis | "In turn the level of miR-143 in CRC cells decreasi ......" | 23173124 | |
| hsa-miR-143-5p | colorectal cancer | staging; metastasis; drug resistance | "MicroRNA 143 inhibits tumor growth and angiogenesi ......" | 23574723 | |
| hsa-miR-143-5p | colorectal cancer | drug resistance | "MicroRNA 143 is a putative predictive factor for t ......" | 26392389 | |
| hsa-miR-143-5p | colorectal cancer | metastasis | "Secondly validation of the results was carried out ......" | 27365381 | |
| hsa-miR-143-5p | endometrial cancer | worse prognosis; poor survival | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | |
| hsa-miR-143-5p | esophageal cancer | metastasis; worse prognosis | "The cluster of miR 143 and miR 145 affects the ris ......" | 22457808 | Luciferase; Western blot |
| hsa-miR-143-5p | esophageal cancer | staging; metastasis; poor survival; recurrence; worse prognosis; drug resistance | "There are several microRNAs that have been consist ......" | 23092342 | |
| hsa-miR-143-5p | esophageal cancer | metastasis | "MicroRNA 143 functions as a tumor suppressor in hu ......" | 23276710 | |
| hsa-miR-143-5p | esophageal cancer | drug resistance | "Esophageal cancer selective expression of TRAIL me ......" | 24659424 | |
| hsa-miR-143-5p | esophageal cancer | poor survival; metastasis | "TaqMan human miRNA arrays and bioinformatics were ......" | 25030863 | |
| hsa-miR-143-5p | esophageal cancer | staging | "Deregulation of miR 93 and miR 143 in human esopha ......" | 26427659 | |
| hsa-miR-143-5p | esophageal cancer | progression | "miR 143 inhibits tumor progression by targeting FA ......" | 26758433 | |
| hsa-miR-143-5p | esophageal cancer | staging; metastasis; cell migration | "MiR 143 inhibits tumor cell proliferation and inva ......" | 26806810 | Luciferase |
| hsa-miR-143-5p | gastric cancer | staging | "miR-32 miR-182 and miR-143 dysregulated expression ......" | 21874264 | |
| hsa-miR-143-5p | gastric cancer | metastasis | "Conversely the expression of miR-143 and -195 in c ......" | 24649051 | |
| hsa-miR-143-5p | gastric cancer | drug resistance | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 | MTT assay; Luciferase; Western blot |
| hsa-miR-143-5p | gastric cancer | metastasis; cell migration; progression | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | Transwell assay |
| hsa-miR-143-5p | gastric cancer | drug resistance | "MicroRNA 143 enhances chemosensitivity of Querceti ......" | 26349981 | Western blot |
| hsa-miR-143-5p | glioblastoma | drug resistance; staging | "The SOX2 response program in glioblastoma multifor ......" | 21211035 | Colony formation |
| hsa-miR-143-5p | glioblastoma | differentiation | "miR 143 inhibits glycolysis and depletes stemness ......" | 23376635 | |
| hsa-miR-143-5p | lung squamous cell cancer | worse prognosis; staging; poor survival | "Deregulated expression of miR 21 miR 143 and miR 1 ......" | 20363096 | |
| hsa-miR-143-5p | lung squamous cell cancer | metastasis; cell migration | "MicroRNA 143 inhibits migration and invasion of hu ......" | 23904792 | |
| hsa-miR-143-5p | melanoma | staging; malignant trasformation | "MicroRNA 143 targets Syndecan 1 to repress cell gr ......" | 24722758 | |
| hsa-miR-143-5p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
| hsa-miR-143-5p | ovarian cancer | drug resistance | "MiRNAs sequencing data from 487 SEOC patients were ......" | 25485872 | |
| hsa-miR-143-5p | ovarian cancer | poor survival | "The authors used quantitative polymerase chain rea ......" | 25556270 | Western blot |
| hsa-miR-143-5p | ovarian cancer | metastasis; tumorigenesis; staging | "MiR 143 targets CTGF and exerts tumor suppressing ......" | 27398154 | Luciferase |
| hsa-miR-143-5p | pancreatic cancer | metastasis | "miR 143 inhibits the metastasis of pancreatic canc ......" | 23070684 | Western blot |
| hsa-miR-143-5p | pancreatic cancer | staging | "Using Affymetrix microarrays we established a glob ......" | 26807325 | |
| hsa-miR-143-5p | prostate cancer | progression; staging | "miR 143 interferes with ERK5 signaling and abrogat ......" | 19855844 | Luciferase |
| hsa-miR-143-5p | prostate cancer | tumorigenesis | "miR 143 decreases prostate cancer cells proliferat ......" | 21197560 | Western blot; Colony formation; MTT assay |
| hsa-miR-143-5p | prostate cancer | metastasis; progression | "miR 143 and miR 145 inhibit stem cell characterist ......" | 22948942 | Colony formation |
| hsa-miR-143-5p | prostate cancer | metastasis; differentiation; progression; motility | "Up regulated microRNA 143 in cancer stem cells dif ......" | 23383988 | Transwell assay; Luciferase |
| hsa-miR-143-5p | prostate cancer | cell migration; metastasis | "MicroRNA 143 inhibits cell migration and invasion ......" | 23732700 | Western blot; Luciferase |
| hsa-miR-143-5p | prostate cancer | cell migration | "Restoration of miR-143 or miR-145 in PCa cell line ......" | 24284362 | Luciferase |
| hsa-miR-143-5p | prostate cancer | drug resistance | "To solve this problem we inserted miRNA response e ......" | 24292881 | Luciferase |
| hsa-miR-143-5p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
| hsa-miR-143-5p | prostate cancer | metastasis | "We identify that TGFβ1-related miR-143 miR-145 mi ......" | 24763824 | |
| hsa-miR-143-5p | prostate cancer | malignant trasformation; drug resistance | "Mitigation of arsenic induced acquired cancer phen ......" | 26721309 | |
| hsa-miR-143-5p | prostate cancer | drug resistance | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-143-5p | sarcoma | metastasis | "MicroRNA 143 regulates human osteosarcoma metastas ......" | 21427707 | Western blot |
| hsa-miR-143-5p | sarcoma | metastasis | "Levels of six candidate miRNAs miR-21 miR-199a-3p ......" | 23269581 | |
| hsa-miR-143-5p | sarcoma | cell migration | "TGF β1 promotes osteosarcoma cell migration and i ......" | 25562163 | Western blot; Luciferase |
| hsa-miR-143-5p | sarcoma | poor survival; drug resistance; worse prognosis | "microRNA 143 is associated with the survival of AL ......" | 25576341 | Western blot; Colony formation; MTT assay |
| hsa-miR-143-5p | sarcoma | metastasis | "PAI 1 a target gene of miR 143 regulates invasion ......" | 26817521 | |
| hsa-miR-143-5p | sarcoma | progression; cell migration | "MicroRNA 143 promotes apoptosis of osteosarcoma ce ......" | 27133034 | Western blot; Flow cytometry |
Reported gene related to hsa-miR-143-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-143-5p | cervical and endocervical cancer | BCL2 | "miR 143 is downregulated in cervical cancer and pr ......" | 22160209 |
| hsa-miR-143-5p | colorectal cancer | BCL2 | "In addition extracellular-regulated protein kinase ......" | 19843160 |
| hsa-miR-143-5p | gastric cancer | BCL2 | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 |
| hsa-miR-143-5p | sarcoma | BCL2 | "In chemoresistant SAOS-2 and U2OS osteosarcomas ce ......" | 25576341 |
| hsa-miR-143-5p | sarcoma | BCL2 | "microRNA 143 down regulated in osteosarcoma promot ......" | 20878132 |
| hsa-miR-143-5p | sarcoma | BCL2 | "To our knowledge it was the first time to target B ......" | 27133034 |
| hsa-miR-143-5p | sarcoma | BCL2 | "Real-time fluorescent RT-PCR was used to quantify ......" | 26823739 |
| hsa-miR-143-5p | colon cancer | KRAS | "Stable miR-143 or miR-145 overexpression increased ......" | 26824186 |
| hsa-miR-143-5p | colorectal cancer | KRAS | "In KRAS mutated tumours increased miR-200b and dec ......" | 22804917 |
| hsa-miR-143-5p | colorectal cancer | KRAS | "The expression of miR-143 is often down-regulated ......" | 27725862 |
| hsa-miR-143-5p | colorectal cancer | KRAS | "Role of miR 143 targeting KRAS in colorectal tumor ......" | 19137007 |
| hsa-miR-143-5p | colorectal cancer | KRAS | "MicroRNA 143 replenishment re sensitizes colorecta ......" | 26581910 |
| hsa-miR-143-5p | colorectal cancer | KRAS | "In turn the level of miR-143 in CRC cells decreasi ......" | 23173124 |
| hsa-miR-143-5p | prostate cancer | KRAS | "miR 143 decreases prostate cancer cells proliferat ......" | 21197560 |
| hsa-miR-143-5p | breast cancer | HK2 | "We previously identified hexokinase 2 the major gl ......" | 27574783 |
| hsa-miR-143-5p | colon cancer | HK2 | "MicroRNA 143 down regulates Hexokinase 2 in colon ......" | 22691140 |
| hsa-miR-143-5p | glioblastoma | HK2 | "We show that miR-143 is significantly down-regulat ......" | 23376635 |
| hsa-miR-143-5p | kidney renal cell cancer | HK2 | "Luciferase reporter assays showed that both miR-14 ......" | 24033605 |
| hsa-miR-143-5p | lung squamous cell cancer | HK2 | "Furthermore knockdown of ATG2B and hexokinase 2 a ......" | 25322940 |
| hsa-miR-143-5p | prostate cancer | HK2 | "MicroRNA 143 acts as a tumor suppressor by targeti ......" | 26269764 |
| hsa-miR-143-5p | T cell leukemia | MAPK7 | "On the contrary an extracellular signal-regulated ......" | 19464056 |
| hsa-miR-143-5p | bladder cancer | MAPK7 | "We recently reported that both microRNA miR-143 an ......" | 23104321 |
| hsa-miR-143-5p | bladder cancer | MAPK7 | "These findings suggest that the chemically-modifie ......" | 21550168 |
| hsa-miR-143-5p | breast cancer | MAPK7 | "miR 143 suppresses epithelial mesenchymal transiti ......" | 26618772 |
| hsa-miR-143-5p | colorectal cancer | MAPK7 | "Interestingly the level of microRNA-143 which nega ......" | 17553685 |
| hsa-miR-143-5p | prostate cancer | MAPK7 | "miR 143 interferes with ERK5 signaling and abrogat ......" | 19855844 |
| hsa-miR-143-5p | prostate cancer | MMP13 | "MicroRNA 143 inhibits cell migration and invasion ......" | 23732700 |
| hsa-miR-143-5p | sarcoma | MMP13 | "Western blot analyses revealed that MMP-13 was mos ......" | 21427707 |
| hsa-miR-143-5p | sarcoma | MMP13 | "Moreover the overexpression of miR-143 decreased M ......" | 24762226 |
| hsa-miR-143-5p | lung squamous cell cancer | ATG2B | "miR 143 inhibits cell proliferation by targeting a ......" | 25322940 |
| hsa-miR-143-5p | sarcoma | ATG2B | "In chemoresistant SAOS-2 and U2OS osteosarcomas ce ......" | 25576341 |
| hsa-miR-143-5p | breast cancer | DNMT3A | "Ectopic expression of miR-143 inhibited proliferat ......" | 24218337 |
| hsa-miR-143-5p | colorectal cancer | DNMT3A | "Using in silico predictions DNA methyltranferase 3 ......" | 19638978 |
| hsa-miR-143-5p | colon cancer | EGFR | "EGFR signals downregulate tumor suppressors miR 14 ......" | 21653642 |
| hsa-miR-143-5p | sarcoma | EGFR | "MiR 143 inhibits EGFR signaling dependent osteosar ......" | 25227664 |
| hsa-miR-143-5p | colorectal cancer | IGF1R | "MiR 143 and MiR 145 regulate IGF1R to suppress cel ......" | 25474488 |
| hsa-miR-143-5p | gastric cancer | IGF1R | "Involvement of miR 143 in cisplatin resistance of ......" | 25492481 |
| hsa-miR-143-5p | colorectal cancer | MACC1 | "MicroRNA 143 targets MACC1 to inhibit cell invasio ......" | 22533346 |
| hsa-miR-143-5p | colorectal cancer | MACC1 | "In turn the level of miR-143 in CRC cells decreasi ......" | 23173124 |
| hsa-miR-143-5p | prostate cancer | MMP9 | "Secreted matrix metalloproteinase MMP activity was ......" | 26721309 |
| hsa-miR-143-5p | sarcoma | MMP9 | "Here we reported significant lower level of miR-14 ......" | 25227664 |
| hsa-miR-143-5p | gastric cancer | PTGS2 | "MicroRNA 143 suppresses gastric cancer cell growth ......" | 24616567 |
| hsa-miR-143-5p | pancreatic cancer | PTGS2 | "miR 143 decreases COX 2 mRNA stability and express ......" | 23973710 |
| hsa-miR-143-5p | bladder cancer | SERPINE1 | "Mature miR-143 and miR-145 are coordinately expres ......" | 22108519 |
| hsa-miR-143-5p | sarcoma | SERPINE1 | "Immunohistochemical analysis using clinical sample ......" | 26817521 |
| hsa-miR-143-5p | colorectal cancer | TLR2 | "We also found that miR-143 a putative tumour suppr ......" | 23866094 |
| hsa-miR-143-5p | liver cancer | TLR2 | "miR 143 inhibits proliferation and invasion of hep ......" | 25270212 |
| hsa-miR-143-5p | colorectal cancer | TP53 | "Major mediators of the oncosuppression by miR-143 ......" | 23128394 |
| hsa-miR-143-5p | lung squamous cell cancer | TP53 | "p53 regulates the maturation process of miR-16 and ......" | 21400525 |
| hsa-miR-143-5p | prostate cancer | ABCG2 | "miR-143 restoration dysregulated the expression of ......" | 26721309 |
| hsa-miR-143-5p | melanoma | AGO2 | "miR-143 directly targeted the 3'-untranslated regi ......" | 24722758 |
| hsa-miR-143-5p | colorectal cancer | APC | "Our data clearly indicated that the decreased expr ......" | 23397547 |
| hsa-miR-143-5p | glioblastoma | BAG3 | "MiR 143 enhances the antitumor activity of shikoni ......" | 26541455 |
| hsa-miR-143-5p | cervical and endocervical cancer | CARD8 | "We measured the expression of mir-21 and mir-143 i ......" | 22194833 |
| hsa-miR-143-5p | T cell leukemia | CASP3 | "The increased expression of miR-143 emerged from 1 ......" | 19464056 |
| hsa-miR-143-5p | colorectal cancer | CD276 | "Consequently the direct target genes of miR-143 B7 ......" | 27626488 |
| hsa-miR-143-5p | breast cancer | CD44 | "A luciferase reporter assay demonstrated that miR- ......" | 27121210 |
| hsa-miR-143-5p | colorectal cancer | CEBPB | "The upregulated miR-155 attenuated miR-143 by inhi ......" | 27626488 |
| hsa-miR-143-5p | ovarian cancer | CTGF | "MiR 143 targets CTGF and exerts tumor suppressing ......" | 27398154 |
| hsa-miR-143-5p | colorectal cancer | DLD | "Characterized mechanism of alpha mangostin induced ......" | 17553685 |
| hsa-miR-143-5p | endometrial cancer | DNMT3B | "In univariate analysis the combination of DNMT3B o ......" | 24071015 |
| hsa-miR-143-5p | colorectal cancer | ENDOG | "Characterized mechanism of alpha mangostin induced ......" | 17553685 |
| hsa-miR-143-5p | breast cancer | ERBB3 | "miR 143 and miR 145 synergistically regulate ERBB3 ......" | 25248370 |
| hsa-miR-143-5p | esophageal cancer | FAM83F | "miR 143 inhibits tumor progression by targeting FA ......" | 26758433 |
| hsa-miR-143-5p | T cell leukemia | FAS | "Role of microRNA 143 in Fas mediated apoptosis in ......" | 19464056 |
| hsa-miR-143-5p | prostate cancer | FNDC3B | "Up regulated microRNA 143 in cancer stem cells dif ......" | 23383988 |
| hsa-miR-143-5p | esophageal cancer | FSCN1 | "The protein level of FSCN1 showed no significant l ......" | 22457808 |
| hsa-miR-143-5p | colorectal cancer | FXYD3 | "Furthermore FXYD3 an ion transport regulator and a ......" | 26392389 |
| hsa-miR-143-5p | gastric cancer | GABARAPL1 | "MicroRNA 143 enhances chemosensitivity of Querceti ......" | 26349981 |
| hsa-miR-143-5p | breast cancer | HK1 | "We previously identified hexokinase 2 the major gl ......" | 27574783 |
| hsa-miR-143-5p | colon cancer | HRAS | "The Evi1 microRNA 143 K Ras axis in colon cancer ......" | 21276449 |
| hsa-miR-143-5p | colorectal cancer | IGF1 | "Furthermore insulin-like growth factor-I receptor ......" | 23574723 |
| hsa-miR-143-5p | bladder cancer | ILK | "We newly elucidated that miR-143 targeted akt and ......" | 23104321 |
| hsa-miR-143-5p | prostate cancer | LIMK1 | "The anticancer effects of miR-143 overexpression a ......" | 26721309 |
| hsa-miR-143-5p | pancreatic cancer | MAP2K6 | "miR-143 were detected at fold levels of 0.41 ± 0. ......" | 23973710 |
| hsa-miR-143-5p | pancreatic cancer | MIA | "miR-143 were detected at fold levels of 0.41 ± 0. ......" | 23973710 |
| hsa-miR-143-5p | prostate cancer | MMP2 | "Secreted matrix metalloproteinase MMP activity was ......" | 26721309 |
| hsa-miR-143-5p | prostate cancer | MYO6 | "A computational search indicated the 3'-untranslat ......" | 20353999 |
| hsa-miR-143-5p | prostate cancer | NOTCH1 | "miR-143 restoration dysregulated the expression of ......" | 26721309 |
| hsa-miR-143-5p | glioblastoma | NUAK2 | "miR 143 inhibits oncogenic traits by degrading NUA ......" | 27081712 |
| hsa-miR-143-5p | pancreatic cancer | PCS | "Expression levels of miR-143 and miR-21 and correl ......" | 22836856 |
| hsa-miR-143-5p | sarcoma | PLK1 | "The downregulation of PRC1 and its docking partner ......" | 21693658 |
| hsa-miR-143-5p | sarcoma | PRC1 | "The downregulation of PRC1 and its docking partner ......" | 21693658 |
| hsa-miR-143-5p | breast cancer | PTEN | "Restoration of miR-143 expression in breast cancer ......" | 24218337 |
| hsa-miR-143-5p | esophageal cancer | QKI | "MiR 143 3p functions as a tumor suppressor by regu ......" | 27358073 |
| hsa-miR-143-5p | breast cancer | SCPEP1 | "UCA1 is present in Ago2-containing RNA-induced sil ......" | 26439035 |
| hsa-miR-143-5p | melanoma | SDC1 | "MicroRNA 143 targets Syndecan 1 to repress cell gr ......" | 24722758 |
| hsa-miR-143-5p | breast cancer | SMUG1 | "18F FDG PET/CT for Monitoring the Response of Brea ......" | 27574783 |
| hsa-miR-143-5p | glioblastoma | SOX2 | "Using next generation sequencing we identified 105 ......" | 21211035 |
| hsa-miR-143-5p | esophageal cancer | STAT3 | "MiR 143 inhibits tumor cell proliferation and inva ......" | 26806810 |
| hsa-miR-143-5p | melanoma | TCL1B | "In this study we investigated whether microRNA-143 ......" | 24722758 |
| hsa-miR-143-5p | colorectal cancer | TLR4 | "The regulation of Toll like receptor 2 by miR 143 ......" | 23866094 |
| hsa-miR-143-5p | breast cancer | TNFRSF10C | "Restoration of miR-143 expression in breast cancer ......" | 24218337 |
| hsa-miR-143-5p | prostate cancer | TWIST1 | "In the present study we investigated whether loss ......" | 26721309 |
| hsa-miR-143-5p | cervical and endocervical cancer | UBR5 | "Furthermore microRNA miR-143 expression levels wer ......" | 27446260 |
| hsa-miR-143-5p | breast cancer | UCA1 | "Long noncoding RNA UCA1 modulates breast cancer ce ......" | 26439035 |
| hsa-miR-143-5p | sarcoma | VCAN | "TGF β1 promotes osteosarcoma cell migration and i ......" | 25562163 |
| hsa-miR-143-5p | colorectal cancer | VTCN1 | "Consequently the direct target genes of miR-143 B7 ......" | 27626488 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-143-5p | ZNF493 | 9 cancers: BLCA; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.11; TCGA KIRC -0.145; TCGA KIRP -0.105; TCGA LGG -0.053; TCGA LUAD -0.072; TCGA OV -0.09; TCGA PAAD -0.164; TCGA PRAD -0.069; TCGA STAD -0.121 |
hsa-miR-143-5p | PARD6B | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; OV; PRAD; THCA; UCEC | MirTarget | TCGA BRCA -0.138; TCGA CESC -0.094; TCGA ESCA -0.377; TCGA KIRC -0.163; TCGA KIRP -0.062; TCGA LIHC -0.08; TCGA LUAD -0.17; TCGA OV -0.09; TCGA PRAD -0.091; TCGA THCA -0.094; TCGA UCEC -0.109 |
hsa-miR-143-5p | WWC1 | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; THCA; UCEC | mirMAP | TCGA BRCA -0.067; TCGA CESC -0.154; TCGA ESCA -0.277; TCGA KIRC -0.143; TCGA KIRP -0.083; TCGA LUAD -0.135; TCGA LUSC -0.088; TCGA SARC -0.221; TCGA THCA -0.063; TCGA UCEC -0.125 |
hsa-miR-143-5p | ZNF138 | 9 cancers: KIRC; KIRP; LIHC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA KIRC -0.093; TCGA KIRP -0.061; TCGA LIHC -0.112; TCGA OV -0.084; TCGA PAAD -0.114; TCGA PRAD -0.093; TCGA SARC -0.107; TCGA STAD -0.087; TCGA UCEC -0.108 |
Enriched cancer pathways of putative targets