microRNA information: hsa-miR-145-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-145-5p | miRbase |
| Accession: | MIMAT0000437 | miRbase |
| Precursor name: | hsa-mir-145 | miRbase |
| Precursor accession: | MI0000461 | miRbase |
| Symbol: | MIR145 | HGNC |
| RefSeq ID: | NR_029686 | GenBank |
| Sequence: | GUCCAGUUUUCCCAGGAAUCCCU |
Reported expression in cancers: hsa-miR-145-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-145-5p | bladder cancer | downregulation | "We identified a subset of 7 miRNAs miR-145 miR-30a ......" | 19378336 | qPCR |
| hsa-miR-145-5p | bladder cancer | downregulation | "We have recently identified down-regulated microRN ......" | 20160723 | |
| hsa-miR-145-5p | bladder cancer | downregulation | "miR-145 was the most down-regulated microRNA of th ......" | 22704449 | |
| hsa-miR-145-5p | bladder cancer | downregulation | "miRNAs downregulated in bladder cancer such as miR ......" | 23712207 | |
| hsa-miR-145-5p | bladder cancer | downregulation | "In many cancers miR-145 acts as a tumor suppressor ......" | 24954107 | qPCR |
| hsa-miR-145-5p | bladder cancer | downregulation | "Analysis of our miRNA expression signature of blad ......" | 27072587 | RNA-Seq |
| hsa-miR-145-5p | breast cancer | downregulation | "In breast cancer miR-145 expression is downregulat ......" | 20818426 | |
| hsa-miR-145-5p | breast cancer | downregulation | "Silencing of microRNA-145 miR-145 may be a definin ......" | 25253741 | RNA-Seq |
| hsa-miR-145-5p | breast cancer | downregulation | "In prostate and breast cancer miR-145 a well-known ......" | 25331590 | |
| hsa-miR-145-5p | breast cancer | downregulation | "MicroRNA-145 miR-145 inhibits growth and increases ......" | 26715279 | qPCR |
| hsa-miR-145-5p | breast cancer | downregulation | "Among such dysregulated miRNAs in cancer miR-145 i ......" | 26733177 | Reverse transcription PCR |
| hsa-miR-145-5p | breast cancer | downregulation | "Although increasing evidence has documented that m ......" | 27364572 | qPCR |
| hsa-miR-145-5p | breast cancer | downregulation | "Loss of microRNA 145 expression is involved in the ......" | 27396353 | qPCR |
| hsa-miR-145-5p | cervical and endocervical cancer | downregulation | "Downregulation of microRNA 145 is associated with ......" | 25560490 | qPCR |
| hsa-miR-145-5p | cervical and endocervical cancer | downregulation | "Down-regulation was reported most consistently for ......" | 25920605 | |
| hsa-miR-145-5p | cervical and endocervical cancer | downregulation | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | qPCR |
| hsa-miR-145-5p | colon cancer | downregulation | "miR-145 is reported to be down-regulated in severa ......" | 20098684 | Microarray |
| hsa-miR-145-5p | colon cancer | downregulation | "Putative tumor suppressor miR 145 inhibits colon c ......" | 20737575 | |
| hsa-miR-145-5p | colon cancer | downregulation | "miR-143 and miR-145 are downregulated in colon can ......" | 26824186 | |
| hsa-miR-145-5p | colon cancer | downregulation | "MiR-145 is a tumor-suppressive microRNA that parti ......" | 27626692 | |
| hsa-miR-145-5p | colorectal cancer | downregulation | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | qPCR |
| hsa-miR-145-5p | colorectal cancer | downregulation | "Recent studies have reported miR-145 dysregulated ......" | 24642628 | qPCR |
| hsa-miR-145-5p | colorectal cancer | downregulation | "To assess the serum expression of 3 microRNA marke ......" | 25736690 | |
| hsa-miR-145-5p | colorectal cancer | downregulation | "Expression of 16 miRNAs miRNA-9 21 30d 31 106a 127 ......" | 25773836 | qPCR |
| hsa-miR-145-5p | endometrial cancer | downregulation | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | Microarray; qPCR |
| hsa-miR-145-5p | esophageal cancer | downregulation | "A comparison of miRNA signatures from ESCC and our ......" | 21351259 | |
| hsa-miR-145-5p | esophageal cancer | downregulation | "Evaluating the miR 302b and miR 145 expression in ......" | 25773691 | |
| hsa-miR-145-5p | gastric cancer | downregulation | "The molecular mechanism of microRNA 145 to suppres ......" | 22370644 | |
| hsa-miR-145-5p | gastric cancer | downregulation | "Here we found that miR-145 miR-133a and miR-133b w ......" | 24613927 | |
| hsa-miR-145-5p | gastric cancer | downregulation | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | |
| hsa-miR-145-5p | gastric cancer | downregulation | "Previous studies have found that miR-145 is down-r ......" | 26010149 | |
| hsa-miR-145-5p | gastric cancer | downregulation | "MicroRNA miR-145-5p has been reported to function ......" | 27143926 | qPCR |
| hsa-miR-145-5p | glioblastoma | upregulation | "Specifically miR-181b miR-153 miR-145 miR-137 and ......" | 22722712 | |
| hsa-miR-145-5p | glioblastoma | downregulation | "Here we found that miR-145 is strongly down-regula ......" | 22869051 | Microarray |
| hsa-miR-145-5p | glioblastoma | deregulation | "Hypoxic signature of microRNAs in glioblastoma: in ......" | 25129238 | RNA-Seq |
| hsa-miR-145-5p | kidney renal cell cancer | downregulation | "The expression levels of miR-143 and miR-145 were ......" | 24033605 | |
| hsa-miR-145-5p | kidney renal cell cancer | downregulation | "The expression of miR-145 in 45 RCC and adjacent n ......" | 24384875 | qPCR |
| hsa-miR-145-5p | liver cancer | downregulation | "Because understanding the pathogenesis of viral-as ......" | 18307259 | qPCR |
| hsa-miR-145-5p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
| hsa-miR-145-5p | liver cancer | downregulation | "MiR 145 modulates multiple components of the insul ......" | 22431718 | Reverse transcription PCR |
| hsa-miR-145-5p | liver cancer | downregulation | "It has been demonstrated that microRNA-145 miR-145 ......" | 24630966 | |
| hsa-miR-145-5p | liver cancer | downregulation | "In this study we performed real-time PCR in tumor ......" | 26512974 | qPCR |
| hsa-miR-145-5p | liver cancer | downregulation | "In the present study we investigated the role of m ......" | 26615424 | qPCR |
| hsa-miR-145-5p | liver cancer | downregulation | "The miR-145-5p which induces TP53-dependent apopto ......" | 27120784 | |
| hsa-miR-145-5p | lung cancer | downregulation | "MiR-145 is downregulated in several human malignan ......" | 21289483 | |
| hsa-miR-145-5p | lung cancer | downregulation | "MiR-145 functions as a protective miRNA identified ......" | 21496429 | Microarray; qPCR |
| hsa-miR-145-5p | lung cancer | downregulation | "MicroRNA-145 MiR-145 is an important regulator of ......" | 24903381 | |
| hsa-miR-145-5p | lung cancer | downregulation | "MiR-145 has been reported to be downregulated in m ......" | 25428378 | |
| hsa-miR-145-5p | lung cancer | downregulation | "Evidence in other cell systems has implicated the ......" | 26309531 | |
| hsa-miR-145-5p | lung squamous cell cancer | downregulation | "However the biological function of miR-145 in non- ......" | 21092188 | Reverse transcription PCR |
| hsa-miR-145-5p | lung squamous cell cancer | downregulation | "Low miR 145 expression level is associated with po ......" | 25661374 | qPCR; in situ hybridization |
| hsa-miR-145-5p | lymphoma | downregulation | "Histone deacetylase inhibitor prevents cell growth ......" | 24577510 | Microarray |
| hsa-miR-145-5p | lymphoma | downregulation | "Prognostic impact of microRNA 145 down regulation ......" | 24745613 | |
| hsa-miR-145-5p | melanoma | downregulation | "Comparative study of anti oncogenic microRNA 145 i ......" | 21836381 | |
| hsa-miR-145-5p | ovarian cancer | downregulation | "The aim of this study was to find specific profile ......" | 23542579 | Microarray; qPCR |
| hsa-miR-145-5p | ovarian cancer | downregulation | "MiR-145 is reported to be significantly down-regul ......" | 23919393 | |
| hsa-miR-145-5p | ovarian cancer | downregulation | "Previous studies have shown that miR-145 is downre ......" | 24157791 | Northern blot; qPCR |
| hsa-miR-145-5p | ovarian cancer | downregulation | "miR 145 targeting high mobility group A2 is a powe ......" | 25444913 | |
| hsa-miR-145-5p | ovarian cancer | downregulation | "Serum microRNA 145 as a novel biomarker in human o ......" | 25722112 | |
| hsa-miR-145-5p | ovarian cancer | downregulation | "The present study aims to investigate the dysregul ......" | 26472353 | |
| hsa-miR-145-5p | pancreatic cancer | downregulation | "Eighty-eight samples of ductal pancreatic adenocar ......" | 22850622 | qPCR |
| hsa-miR-145-5p | prostate cancer | downregulation | "The functional significance of microRNA 145 in pro ......" | 20588276 | Microarray |
| hsa-miR-145-5p | prostate cancer | downregulation | "The down-regulation of miR-145 has been reported i ......" | 21258769 | |
| hsa-miR-145-5p | prostate cancer | downregulation | "MiR-145 is downregulated in various cancers includ ......" | 21349819 | |
| hsa-miR-145-5p | prostate cancer | downregulation | "MiR-145 is down-regulated in various human cancers ......" | 21360565 | |
| hsa-miR-145-5p | prostate cancer | downregulation | "The loss of the tumour suppressor miR 145 results ......" | 23703249 | |
| hsa-miR-145-5p | sarcoma | deregulation | "MicroRNA expression was profiled in samples of nor ......" | 21693658 | Microarray; RNA-Seq |
| hsa-miR-145-5p | sarcoma | deregulation | "Expression profiles of 741 miRNAs were evaluated u ......" | 26299703 | qPCR |
| hsa-miR-145-5p | thyroid cancer | downregulation | "The expression and function of miR-145 in thyroid ......" | 24781864 |
Reported cancer pathway affected by hsa-miR-145-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-145-5p | acute myeloid leukemia | Apoptosis pathway | "We integrated miRNA and mRNA expression profiles o ......" | 21455993 | |
| hsa-miR-145-5p | bladder cancer | Apoptosis pathway | "socs7 a target gene of microRNA 145 regulates inte ......" | 23392170 | Luciferase |
| hsa-miR-145-5p | bladder cancer | Apoptosis pathway | "MicroRNA 145 directly targets the insulin like gro ......" | 24999188 | |
| hsa-miR-145-5p | bladder cancer | Apoptosis pathway | "Intravesical administration of exogenous microRNA ......" | 26036261 | Western blot; Wound Healing Assay |
| hsa-miR-145-5p | bladder cancer | Apoptosis pathway | "Identification of a hypoxia regulated miRNA signat ......" | 26196183 | Flow cytometry |
| hsa-miR-145-5p | bladder cancer | Apoptosis pathway | "Regulation of UHRF1 by dual strand tumor suppresso ......" | 27072587 | |
| hsa-miR-145-5p | breast cancer | Apoptosis pathway | "miR 145 inhibits breast cancer cell growth through ......" | 19360360 | |
| hsa-miR-145-5p | breast cancer | Apoptosis pathway | "miR 145 participates with TP53 in a death promotin ......" | 19730444 | |
| hsa-miR-145-5p | breast cancer | Wnt signaling pathway | "Development of microRNA 145 for therapeutic applic ......" | 21723890 | |
| hsa-miR-145-5p | breast cancer | Apoptosis pathway | "MiR 145 regulates epithelial to mesenchymal transi ......" | 23049906 | |
| hsa-miR-145-5p | breast cancer | Apoptosis pathway | "lincRNA RoR and miR 145 regulate invasion in tripl ......" | 25253741 | |
| hsa-miR-145-5p | breast cancer | Apoptosis pathway | "MiR 145 promotes TNF α induced apoptosis by facil ......" | 26733177 | |
| hsa-miR-145-5p | breast cancer | Epithelial mesenchymal transition pathway | "miR 145 suppresses breast cancer cell migration by ......" | 27508031 | Cell migration assay; Wound Healing Assay |
| hsa-miR-145-5p | cervical and endocervical cancer | Apoptosis pathway | "Glucocorticoid regulation of a novel HPV E6 p53 mi ......" | 22287315 | |
| hsa-miR-145-5p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "Long non coding RNA MALAT1 modulates radiosensitiv ......" | 26311052 | Flow cytometry; Colony formation; RNA pull-down |
| hsa-miR-145-5p | colon cancer | Apoptosis pathway | "Putative tumor suppressor miR 145 inhibits colon c ......" | 20737575 | Luciferase |
| hsa-miR-145-5p | colon cancer | Apoptosis pathway | "MicroRNA replacement therapy for miR 145 and miR 3 ......" | 21690566 | |
| hsa-miR-145-5p | colon cancer | Apoptosis pathway | "Downregulation of microRNA 1 and microRNA 145 cont ......" | 26459459 | MTT assay |
| hsa-miR-145-5p | colon cancer | cell cycle pathway; Apoptosis pathway | "The miR-145 is dysregulated in many cancers includ ......" | 27482839 | |
| hsa-miR-145-5p | colon cancer | Apoptosis pathway | "Epigenetically regulated miR 145 suppresses colon ......" | 27626692 | |
| hsa-miR-145-5p | colorectal cancer | cell cycle pathway | "Characterization of global microRNA expression rev ......" | 19843336 | |
| hsa-miR-145-5p | colorectal cancer | p53 signaling pathway | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-145-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "The analysis of microRNAs miR 200C and miR 145 exp ......" | 26335822 | |
| hsa-miR-145-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA miR-143 and miR-145 have been identified ......" | 27444415 | Luciferase |
| hsa-miR-145-5p | esophageal cancer | Apoptosis pathway | "Evaluating the miR 302b and miR 145 expression in ......" | 25773691 | |
| hsa-miR-145-5p | esophageal cancer | cell cycle pathway; Apoptosis pathway | "The effect of recombinant lentiviral vector encodi ......" | 26156802 | Flow cytometry |
| hsa-miR-145-5p | gastric cancer | cell cycle pathway | "MiR 145 miR 133a and miR 133b inhibit proliferatio ......" | 24613927 | |
| hsa-miR-145-5p | gastric cancer | Apoptosis pathway | "MiR-145-5p transfection into gastric cancer cells ......" | 24616567 | Luciferase |
| hsa-miR-145-5p | gastric cancer | Epithelial mesenchymal transition pathway | "MicroRNA 145 5p inhibits gastric cancer invasivene ......" | 27143926 | Western blot |
| hsa-miR-145-5p | glioblastoma | PI3K/Akt signaling pathway | "MicroRNA screening predicted that microRNA-145 miR ......" | 26374689 | |
| hsa-miR-145-5p | kidney renal cell cancer | Apoptosis pathway | "miR 145 functions as tumor suppressor and targets ......" | 24384875 | Luciferase |
| hsa-miR-145-5p | kidney renal cell cancer | Apoptosis pathway | "Herein we sought to investigate the impact of gemc ......" | 25833690 | Western blot; MTT assay |
| hsa-miR-145-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "MiR 145 modulates multiple components of the insul ......" | 22431718 | Luciferase |
| hsa-miR-145-5p | liver cancer | PI3K/Akt signaling pathway | "MicroRNA 145 suppresses hepatocellular carcinoma b ......" | 24690171 | Western blot; Luciferase |
| hsa-miR-145-5p | liver cancer | Epithelial mesenchymal transition pathway | "miR 145 regulates chemoresistance in hepatocellula ......" | 26068913 | Luciferase |
| hsa-miR-145-5p | liver cancer | Apoptosis pathway | "MicroRNA 145 and MicroRNA 133a Inhibited Prolifera ......" | 26173501 | Western blot; Luciferase |
| hsa-miR-145-5p | liver cancer | Apoptosis pathway | "The miR-145-5p which induces TP53-dependent apopto ......" | 27120784 | |
| hsa-miR-145-5p | lung cancer | Apoptosis pathway | "MiR 145 inhibits cell proliferation of human lung ......" | 21289483 | |
| hsa-miR-145-5p | lung cancer | Epithelial mesenchymal transition pathway | "MiR 145 regulates cancer stem like properties and ......" | 24903381 | |
| hsa-miR-145-5p | lung squamous cell cancer | cell cycle pathway | "Increasing evidence indicates that miR-145 is a tu ......" | 21092188 | |
| hsa-miR-145-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MiR 145 and miR 203 represses TGF β induced epith ......" | 27237033 | Western blot; RNAi; Luciferase |
| hsa-miR-145-5p | melanoma | cell cycle pathway; Apoptosis pathway | "MicroRNA 145 may play an important role in uveal m ......" | 24762580 | Flow cytometry; MTT assay; Luciferase; Western blot |
| hsa-miR-145-5p | ovarian cancer | Apoptosis pathway; cell cycle pathway | "MicroRNA 145 function as a cell growth repressor b ......" | 23919393 | |
| hsa-miR-145-5p | ovarian cancer | Apoptosis pathway | "MiR 145 is downregulated in human ovarian cancer a ......" | 24157791 | Colony formation |
| hsa-miR-145-5p | ovarian cancer | Apoptosis pathway | "miR 145 targeting high mobility group A2 is a powe ......" | 25444913 | Cell migration assay; Western blot; Luciferase |
| hsa-miR-145-5p | ovarian cancer | Apoptosis pathway | "Quercetin induces the apoptosis of human ovarian c ......" | 25937243 | |
| hsa-miR-145-5p | pancreatic cancer | Apoptosis pathway | "ROR functions as a ceRNA to regulate Nanog express ......" | 26636540 | RNAi; Luciferase |
| hsa-miR-145-5p | prostate cancer | cell cycle pathway | "Interestingly 5 of the 7 differentially expressed ......" | 19996289 | |
| hsa-miR-145-5p | prostate cancer | Apoptosis pathway | "The functional significance of microRNA 145 in pro ......" | 20588276 | Flow cytometry |
| hsa-miR-145-5p | prostate cancer | Epithelial mesenchymal transition pathway | "HEF1 promotes epithelial mesenchymal transition an ......" | 23355420 | Luciferase |
| hsa-miR-145-5p | prostate cancer | Apoptosis pathway | "Reciprocal regulation of PCGEM1 and miR 145 promot ......" | 25200485 | Luciferase; Flow cytometry; MTT assay; Transwell assay |
| hsa-miR-145-5p | prostate cancer | Epithelial mesenchymal transition pathway | "Double negative feedback loop between ZEB2 and miR ......" | 25296715 | |
| hsa-miR-145-5p | prostate cancer | cell cycle pathway | "Tumor suppressive microRNA 145 induces growth arre ......" | 25645686 | |
| hsa-miR-145-5p | prostate cancer | Apoptosis pathway | "microRNA 145 Mediates the Inhibitory Effect of Adi ......" | 27465939 | |
| hsa-miR-145-5p | sarcoma | cell cycle pathway; Apoptosis pathway | "MicroRNA expression profiles distinguish liposarco ......" | 24375455 |
Reported cancer prognosis affected by hsa-miR-145-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-145-5p | bladder cancer | progression | "We investigate microRNAs miRNAs regulating PAI-1 i ......" | 22108519 | Luciferase |
| hsa-miR-145-5p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
| hsa-miR-145-5p | bladder cancer | staging; recurrence; tumorigenesis | "Expression profile of microrna 145 in urothelial b ......" | 23489501 | |
| hsa-miR-145-5p | bladder cancer | motility | "miR 1 and miR 145 act as tumor suppressor microRNA ......" | 24966896 | Colony formation |
| hsa-miR-145-5p | bladder cancer | poor survival | "Uncovering the clinical utility of miR 143 miR 145 ......" | 25804644 | |
| hsa-miR-145-5p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
| hsa-miR-145-5p | bladder cancer | cell migration; poor survival; motility | "Intravesical administration of exogenous microRNA ......" | 26036261 | Western blot; Wound Healing Assay |
| hsa-miR-145-5p | bladder cancer | drug resistance | "Identification of a hypoxia regulated miRNA signat ......" | 26196183 | Flow cytometry |
| hsa-miR-145-5p | bladder cancer | drug resistance | "Double negative feedback loop between long non cod ......" | 26318860 | |
| hsa-miR-145-5p | bladder cancer | cell migration | "Long non coding RNA urothelial cancer associated 1 ......" | 26544536 | |
| hsa-miR-145-5p | bladder cancer | drug resistance; worse prognosis | "miR 145 sensitizes gallbladder cancer to cisplatin ......" | 26852750 | |
| hsa-miR-145-5p | breast cancer | motility | "miR 145 dependent targeting of junctional adhesion ......" | 20818426 | Luciferase |
| hsa-miR-145-5p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-145-5p | breast cancer | motility; poor survival | "Development of microRNA 145 for therapeutic applic ......" | 21723890 | |
| hsa-miR-145-5p | breast cancer | staging | "MiR 145 regulates epithelial to mesenchymal transi ......" | 23049906 | |
| hsa-miR-145-5p | breast cancer | staging | "Global miRNA analysis was performed on serum from ......" | 24694649 | |
| hsa-miR-145-5p | breast cancer | metastasis; tumor size | "Stem-loop real-time RT-PCR was used to detect the ......" | 25047098 | |
| hsa-miR-145-5p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
| hsa-miR-145-5p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
| hsa-miR-145-5p | breast cancer | progression; cell migration | "MicroRNA 145 inhibits growth and migration of brea ......" | 26715279 | Transwell assay; Western blot |
| hsa-miR-145-5p | breast cancer | worse prognosis; staging; metastasis; tumor size | "Loss of microRNA 145 expression is involved in the ......" | 27396353 | |
| hsa-miR-145-5p | breast cancer | staging | "We report for the first time an extremely high pre ......" | 27404381 | |
| hsa-miR-145-5p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
| hsa-miR-145-5p | breast cancer | drug resistance | "miR 145 sensitizes breast cancer to doxorubicin by ......" | 27487127 | |
| hsa-miR-145-5p | breast cancer | cell migration | "miR 145 suppresses breast cancer cell migration by ......" | 27508031 | Cell migration assay; Wound Healing Assay |
| hsa-miR-145-5p | cervical and endocervical cancer | tumorigenesis | "All cell lines examined contained no detectable mi ......" | 18596939 | |
| hsa-miR-145-5p | cervical and endocervical cancer | drug resistance; motility | "Glucocorticoid regulation of a novel HPV E6 p53 mi ......" | 22287315 | |
| hsa-miR-145-5p | cervical and endocervical cancer | progression; worse prognosis; metastasis; poor survival | "Downregulation of microRNA 145 is associated with ......" | 25560490 | |
| hsa-miR-145-5p | cervical and endocervical cancer | staging; differentiation; tumor size; drug resistance | "MicroRNA 145 contributes to enhancing radiosensiti ......" | 25666710 | |
| hsa-miR-145-5p | cervical and endocervical cancer | drug resistance | "Long non coding RNA MALAT1 modulates radiosensitiv ......" | 26311052 | Flow cytometry; Colony formation; RNA pull-down |
| hsa-miR-145-5p | cervical and endocervical cancer | staging; metastasis; poor survival | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | |
| hsa-miR-145-5p | colon cancer | tumorigenesis | "To further investigate the in vivo biological sign ......" | 18172508 | |
| hsa-miR-145-5p | colon cancer | staging; recurrence | "Here we used microarrays to profile the expression ......" | 18676867 | |
| hsa-miR-145-5p | colon cancer | tumorigenesis | "Both miR-143 and miR-145 have been shown to posses ......" | 22897626 | |
| hsa-miR-145-5p | colon cancer | metastasis | "Differential expression of microRNAs in twenty pai ......" | 25421775 | |
| hsa-miR-145-5p | colon cancer | differentiation; progression; drug resistance | "miR 21 and miR 145 cooperation in regulation of co ......" | 25928322 | Western blot |
| hsa-miR-145-5p | colon cancer | poor survival | "Downregulation of microRNA 1 and microRNA 145 cont ......" | 26459459 | MTT assay |
| hsa-miR-145-5p | colon cancer | staging | "The aim of this study was to examine the expressio ......" | 26465597 | |
| hsa-miR-145-5p | colon cancer | cell migration | "To investigate the targeted inhibition of prolifer ......" | 26973415 | Western blot; Wound Healing Assay |
| hsa-miR-145-5p | colon cancer | progression; metastasis; tumorigenesis; worse prognosis | "Long Non Coding RNA lincRNA ROR Promotes the Progr ......" | 27071407 | |
| hsa-miR-145-5p | colon cancer | cell migration; staging | "The miR-145 is dysregulated in many cancers includ ......" | 27482839 | |
| hsa-miR-145-5p | colon cancer | metastasis; malignant trasformation; progression | "Epigenetically regulated miR 145 suppresses colon ......" | 27626692 | |
| hsa-miR-145-5p | colorectal cancer | progression | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | |
| hsa-miR-145-5p | colorectal cancer | differentiation | "Characterization of global microRNA expression rev ......" | 19843336 | |
| hsa-miR-145-5p | colorectal cancer | drug resistance; differentiation | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-145-5p | colorectal cancer | drug resistance; differentiation | "Peroxisome proliferator activated receptor γ medi ......" | 24631504 | |
| hsa-miR-145-5p | colorectal cancer | metastasis; motility | "MicroRNA 145 inhibits tumour growth and metastasis ......" | 24642628 | Luciferase |
| hsa-miR-145-5p | colorectal cancer | metastasis | "Up regulation of microRNA 145 associates with lymp ......" | 25019299 | |
| hsa-miR-145-5p | colorectal cancer | staging | "The Agilent Human miRNA Microarray V19.0 was used ......" | 25484364 | |
| hsa-miR-145-5p | colorectal cancer | malignant trasformation | "To assess the serum expression of 3 microRNA marke ......" | 25736690 | |
| hsa-miR-145-5p | colorectal cancer | drug resistance | "Tumor suppressor miR 145 reverses drug resistance ......" | 25913620 | Western blot; Luciferase |
| hsa-miR-145-5p | colorectal cancer | cell migration | "MicroRNA 145 suppresses cell migration and invasio ......" | 25973017 | Luciferase |
| hsa-miR-145-5p | colorectal cancer | staging | "Using individual RT-qPCR verification in 175 stage ......" | 26250939 | |
| hsa-miR-145-5p | colorectal cancer | staging | "In addition the qRT-PCR validation demonstrated th ......" | 26462034 | |
| hsa-miR-145-5p | colorectal cancer | progression | "To identify the sequential alterations of miRNAs a ......" | 26692142 | |
| hsa-miR-145-5p | colorectal cancer | cell migration | "miR 145 suppresses colorectal cancer cell migratio ......" | 27572146 | Luciferase |
| hsa-miR-145-5p | endometrial cancer | worse prognosis; poor survival | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | |
| hsa-miR-145-5p | endometrial cancer | differentiation | "Linc RNA RoR acts as a "sponge" against mediation ......" | 24589415 | Flow cytometry; Colony formation |
| hsa-miR-145-5p | esophageal cancer | poor survival | "Using 98 formalin-fixed paraffin-embedded samples ......" | 21248297 | |
| hsa-miR-145-5p | esophageal cancer | metastasis; worse prognosis | "The cluster of miR 143 and miR 145 affects the ris ......" | 22457808 | Luciferase; Western blot |
| hsa-miR-145-5p | esophageal cancer | poor survival | "miRNAs were labeled and hybridized to the Illumina ......" | 22939244 | |
| hsa-miR-145-5p | esophageal cancer | poor survival | "A large number of miRNAs were differentially expre ......" | 23477513 | |
| hsa-miR-145-5p | esophageal cancer | progression; worse prognosis; poor survival | "We measured the serum levels of miR-21 miR-145 miR ......" | 23838916 | |
| hsa-miR-145-5p | esophageal cancer | differentiation | "Evaluating the miR 302b and miR 145 expression in ......" | 25773691 | |
| hsa-miR-145-5p | esophageal cancer | progression | "The effect of recombinant lentiviral vector encodi ......" | 26156802 | Flow cytometry |
| hsa-miR-145-5p | esophageal cancer | drug resistance | "Differentially expressed miRNAs between ESCC patho ......" | 26445467 | |
| hsa-miR-145-5p | esophageal cancer | metastasis | "Targeting oncogenic PLCE1 by miR 145 impairs tumor ......" | 26657507 | |
| hsa-miR-145-5p | gastric cancer | metastasis | "Differential expression of miRNAs was studied usin ......" | 20726036 | |
| hsa-miR-145-5p | gastric cancer | metastasis | "The molecular mechanism of microRNA 145 to suppres ......" | 22370644 | Western blot; Luciferase |
| hsa-miR-145-5p | gastric cancer | metastasis | "In gastric cancer specimens and cell lines miRNA-1 ......" | 23233482 | Luciferase |
| hsa-miR-145-5p | gastric cancer | progression | "MiR 145 miR 133a and miR 133b inhibit proliferatio ......" | 24613927 | |
| hsa-miR-145-5p | gastric cancer | staging; worse prognosis; progression | "MicroRNA 145 is a potential prognostic factor of s ......" | 25051317 | |
| hsa-miR-145-5p | gastric cancer | metastasis; cell migration; progression | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | Transwell assay |
| hsa-miR-145-5p | gastric cancer | worse prognosis | "miR 145 mediates the antiproliferative and gene re ......" | 25762621 | Colony formation |
| hsa-miR-145-5p | gastric cancer | cell migration | "Reverse Correlation between MicroRNA 145 and FSCN1 ......" | 26010149 | |
| hsa-miR-145-5p | gastric cancer | staging; metastasis | "MicroRNA 145 5p inhibits gastric cancer invasivene ......" | 27143926 | Western blot |
| hsa-miR-145-5p | gastric cancer | poor survival | "Then we further investigated these GC specific miR ......" | 27173517 | |
| hsa-miR-145-5p | gastric cancer | worse prognosis; staging; metastasis; poor survival | "Downregulation of miR 145 5p correlates with poor ......" | 27460730 | |
| hsa-miR-145-5p | glioblastoma | drug resistance; staging | "The SOX2 response program in glioblastoma multifor ......" | 21211035 | Colony formation |
| hsa-miR-145-5p | glioblastoma | malignant trasformation; tumorigenesis; differentiation | "In this study our miRNA/mRNA-microarray and RT-PCR ......" | 22098779 | |
| hsa-miR-145-5p | glioblastoma | progression; poor survival | "NEDD9 a novel target of miR 145 increases the inva ......" | 22869051 | |
| hsa-miR-145-5p | glioblastoma | poor survival | "MicroRNA screening predicted that microRNA-145 miR ......" | 26374689 | |
| hsa-miR-145-5p | kidney renal cell cancer | poor survival | "Global miRNA expression profiles were obtained by ......" | 22492545 | |
| hsa-miR-145-5p | kidney renal cell cancer | progression | "MiR-145 mimic in preclinical RCC orthotopic xenogr ......" | 26304926 | |
| hsa-miR-145-5p | liver cancer | malignant trasformation; worse prognosis | "Because understanding the pathogenesis of viral-as ......" | 18307259 | |
| hsa-miR-145-5p | liver cancer | tumorigenesis; poor survival | "MiR 145 modulates multiple components of the insul ......" | 22431718 | Luciferase |
| hsa-miR-145-5p | liver cancer | tumorigenesis | "MiR 145 functions as a tumor suppressor by directl ......" | 23499894 | |
| hsa-miR-145-5p | liver cancer | drug resistance | "miR 145 regulates chemoresistance in hepatocellula ......" | 26068913 | Luciferase |
| hsa-miR-145-5p | liver cancer | malignant trasformation; progression | "MicroRNA 145 and MicroRNA 133a Inhibited Prolifera ......" | 26173501 | Western blot; Luciferase |
| hsa-miR-145-5p | liver cancer | motility; progression; cell migration; metastasis | "MiR 145 suppresses cell proliferation and motility ......" | 26615424 | Transwell assay; Western blot |
| hsa-miR-145-5p | liver cancer | staging | "We first evaluated a training cohort of 192 HCC pa ......" | 26657296 | |
| hsa-miR-145-5p | liver cancer | drug resistance | "The miR-145-5p which induces TP53-dependent apopto ......" | 27120784 | |
| hsa-miR-145-5p | lung cancer | malignant trasformation | "Using quantitative reverse transcriptase PCR analy ......" | 23462458 | |
| hsa-miR-145-5p | lung cancer | metastasis | "Downregulation of miR 145 contributes to lung aden ......" | 24026105 | |
| hsa-miR-145-5p | lung cancer | tumorigenesis; metastasis | "MiR 145 regulates cancer stem like properties and ......" | 24903381 | |
| hsa-miR-145-5p | lung cancer | metastasis; staging | "MiR 145 acts as a metastasis suppressor by targeti ......" | 25428378 | |
| hsa-miR-145-5p | lung cancer | metastasis | "MicroRNA 145 inhibits lung cancer cell metastasis; ......" | 25483817 | Western blot; Luciferase |
| hsa-miR-145-5p | lung cancer | motility; malignant trasformation | "MicroRNA 145 inhibits migration and invasion by do ......" | 26309531 | |
| hsa-miR-145-5p | lung cancer | progression | "DNA methylation mediated silencing of microRNA 145 ......" | 26582602 | |
| hsa-miR-145-5p | lung squamous cell cancer | malignant trasformation | "Increasing evidence indicates that miR-145 is a tu ......" | 21092188 | |
| hsa-miR-145-5p | lung squamous cell cancer | worse prognosis | "Low miR 145 and high miR 367 are associated with u ......" | 22835608 | |
| hsa-miR-145-5p | lung squamous cell cancer | staging | "In order to find novel noninvasive biomarkers with ......" | 25421010 | |
| hsa-miR-145-5p | lung squamous cell cancer | worse prognosis; differentiation; staging; poor survival; drug resistance | "Low miR 145 expression level is associated with po ......" | 25661374 | |
| hsa-miR-145-5p | lung squamous cell cancer | metastasis | "Expression levels of microRNA 145 and microRNA 10b ......" | 26909466 | |
| hsa-miR-145-5p | lung squamous cell cancer | cell migration | "MiR 145 and miR 203 represses TGF β induced epith ......" | 27237033 | Western blot; RNAi; Luciferase |
| hsa-miR-145-5p | lymphoma | poor survival; worse prognosis | "Prognostic impact of microRNA 145 down regulation ......" | 24745613 | |
| hsa-miR-145-5p | melanoma | malignant trasformation; progression; tumorigenesis | "Comparative study of anti oncogenic microRNA 145 i ......" | 21836381 | |
| hsa-miR-145-5p | melanoma | cell migration | "miR 145 overexpression suppresses the migration an ......" | 23404256 | |
| hsa-miR-145-5p | melanoma | metastasis | "Six microRNAs miR-9 miR-145 miR-150 miR-155 miR-20 ......" | 23863473 | |
| hsa-miR-145-5p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
| hsa-miR-145-5p | ovarian cancer | drug resistance | "miR 145 sensitizes ovarian cancer cells to paclita ......" | 24510775 | |
| hsa-miR-145-5p | ovarian cancer | metastasis | "miR 145 inhibits tumor growth and metastasis by ta ......" | 25333261 | |
| hsa-miR-145-5p | ovarian cancer | staging; metastasis; poor survival; recurrence; cell migration; worse prognosis | "miR 145 targeting high mobility group A2 is a powe ......" | 25444913 | Cell migration assay; Western blot; Luciferase |
| hsa-miR-145-5p | ovarian cancer | poor survival | "The authors used quantitative polymerase chain rea ......" | 25556270 | Western blot |
| hsa-miR-145-5p | ovarian cancer | worse prognosis; malignant trasformation; poor survival | "Serum microRNA 145 as a novel biomarker in human o ......" | 25722112 | |
| hsa-miR-145-5p | ovarian cancer | staging | "Small RNA sequencing reveals a comprehensive miRNA ......" | 27048682 | |
| hsa-miR-145-5p | ovarian cancer | metastasis | "We show that p70S6K phosphorylates and inhibits th ......" | 27191261 | |
| hsa-miR-145-5p | pancreatic cancer | staging; progression | "MicroRNA 145 targets MUC13 and suppresses growth a ......" | 25277192 | |
| hsa-miR-145-5p | pancreatic cancer | worse prognosis | "ROR functions as a ceRNA to regulate Nanog express ......" | 26636540 | RNAi; Luciferase |
| hsa-miR-145-5p | pancreatic cancer | cell migration | "Restitution of Tumor Suppressor MicroRNA 145 Using ......" | 27507554 | Colony formation |
| hsa-miR-145-5p | prostate cancer | progression | "The putative tumor suppressor miR145 is transcript ......" | 20332243 | |
| hsa-miR-145-5p | prostate cancer | recurrence | "Using the Cox regression test the risk of recurren ......" | 21255804 | |
| hsa-miR-145-5p | prostate cancer | drug resistance | "MicroRNA 145 is regulated by DNA methylation and p ......" | 21349819 | |
| hsa-miR-145-5p | prostate cancer | metastasis | "Next generation sequencing technology was applied ......" | 21980368 | |
| hsa-miR-145-5p | prostate cancer | metastasis; progression | "miR 143 and miR 145 inhibit stem cell characterist ......" | 22948942 | Colony formation |
| hsa-miR-145-5p | prostate cancer | metastasis | "HEF1 promotes epithelial mesenchymal transition an ......" | 23355420 | Luciferase |
| hsa-miR-145-5p | prostate cancer | poor survival; staging; recurrence; progression | "The loss of the tumour suppressor miR 145 results ......" | 23703249 | |
| hsa-miR-145-5p | prostate cancer | cell migration | "Restoration of miR-143 or miR-145 in PCa cell line ......" | 24284362 | Luciferase |
| hsa-miR-145-5p | prostate cancer | drug resistance | "To solve this problem we inserted miRNA response e ......" | 24292881 | Luciferase |
| hsa-miR-145-5p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
| hsa-miR-145-5p | prostate cancer | metastasis | "We identify that TGFβ1-related miR-143 miR-145 mi ......" | 24763824 | |
| hsa-miR-145-5p | prostate cancer | metastasis | "Effects of miR 145 on the migration and invasion o ......" | 24846918 | |
| hsa-miR-145-5p | prostate cancer | cell migration | "Reciprocal regulation of PCGEM1 and miR 145 promot ......" | 25200485 | Luciferase; Flow cytometry; MTT assay; Transwell assay |
| hsa-miR-145-5p | prostate cancer | metastasis; progression | "Double negative feedback loop between ZEB2 and miR ......" | 25296715 | |
| hsa-miR-145-5p | prostate cancer | tumorigenesis | "Tumor suppressive microRNA 145 induces growth arre ......" | 25645686 | |
| hsa-miR-145-5p | prostate cancer | drug resistance | "A feedback regulation between miR 145 and DNA meth ......" | 25749421 | |
| hsa-miR-145-5p | prostate cancer | tumorigenesis | "Overexpression of miR 145 5p inhibits proliferatio ......" | 25951106 | |
| hsa-miR-145-5p | prostate cancer | worse prognosis; progression; metastasis; poor survival; drug resistance | "miR 145 suppress the androgen receptor in prostate ......" | 25969144 | |
| hsa-miR-145-5p | prostate cancer | poor survival | "Here we report the polyarginine peptide R11-labele ......" | 26054847 | |
| hsa-miR-145-5p | prostate cancer | poor survival; worse prognosis | "Prognostic role of microRNA 145 in prostate cancer ......" | 26473147 | |
| hsa-miR-145-5p | prostate cancer | drug resistance; poor survival | "MicroRNA 145 Modulates Tumor Sensitivity to Radiat ......" | 26632856 | |
| hsa-miR-145-5p | retinoblastoma | progression | "MiR 145 suppressed human retinoblastoma cell proli ......" | 26823772 | |
| hsa-miR-145-5p | sarcoma | differentiation | "EWS FLI 1 modulates miRNA145 and SOX2 expression t ......" | 20382729 | |
| hsa-miR-145-5p | sarcoma | malignant trasformation | "Hsa mir 145 is the top EWS FLI1 repressed microRNA ......" | 21217773 | RNAi |
| hsa-miR-145-5p | sarcoma | metastasis; tumorigenesis | "MicroRNA 145 targets vascular endothelial growth f ......" | 22472569 | Luciferase |
| hsa-miR-145-5p | sarcoma | progression | "MicroRNA expression profiles distinguish liposarco ......" | 24375455 | |
| hsa-miR-145-5p | sarcoma | progression | "MiR 145 inhibits osteosarcoma cells proliferation ......" | 24801908 | |
| hsa-miR-145-5p | thyroid cancer | metastasis; differentiation; malignant trasformation | "miR 145 suppresses thyroid cancer growth and metas ......" | 24781864 |
Reported gene related to hsa-miR-145-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-145-5p | bladder cancer | FSCN1 | "miR 145 and miR 133a function as tumour suppressor ......" | 20160723 |
| hsa-miR-145-5p | bladder cancer | FSCN1 | "Long non coding RNA urothelial cancer associated 1 ......" | 26544536 |
| hsa-miR-145-5p | breast cancer | FSCN1 | "miR 145 dependent targeting of junctional adhesion ......" | 20818426 |
| hsa-miR-145-5p | colorectal cancer | FSCN1 | "MicroRNA 145 inhibits tumour growth and metastasis ......" | 24642628 |
| hsa-miR-145-5p | esophageal cancer | FSCN1 | "miR 145 miR 133a and miR 133b: Tumor suppressive m ......" | 21351259 |
| hsa-miR-145-5p | esophageal cancer | FSCN1 | "The protein level of FSCN1 showed no significant l ......" | 22457808 |
| hsa-miR-145-5p | gastric cancer | FSCN1 | "Reverse Correlation between MicroRNA 145 and FSCN1 ......" | 26010149 |
| hsa-miR-145-5p | liver cancer | FSCN1 | "MicroRNA 145 and MicroRNA 133a Inhibited Prolifera ......" | 26173501 |
| hsa-miR-145-5p | lung cancer | FSCN1 | "MicroRNA 145 inhibits migration and invasion by do ......" | 26309531 |
| hsa-miR-145-5p | lung squamous cell cancer | FSCN1 | "MicroRNA 145 inhibits migration and invasion via i ......" | 26238532 |
| hsa-miR-145-5p | melanoma | FSCN1 | "Surprisingly we discovered that miR-145 in melanom ......" | 23404256 |
| hsa-miR-145-5p | prostate cancer | FSCN1 | "Restoration of miR 145 expression suppresses cell ......" | 21258769 |
| hsa-miR-145-5p | breast cancer | TP53 | "miR 145 participates with TP53 in a death promotin ......" | 19730444 |
| hsa-miR-145-5p | cervical and endocervical cancer | TP53 | "Glucocorticoid regulation of a novel HPV E6 p53 mi ......" | 22287315 |
| hsa-miR-145-5p | colorectal cancer | TP53 | "Major mediators of the oncosuppression by miR-143 ......" | 23128394 |
| hsa-miR-145-5p | liver cancer | TP53 | "Here we demonstrate that in HCC cells carrying wil ......" | 27120784 |
| hsa-miR-145-5p | lung squamous cell cancer | TP53 | "miR-145 regulates SOX2 and OCT4 translation and p5 ......" | 22835608 |
| hsa-miR-145-5p | ovarian cancer | TP53 | "Using miRNA profiling analysis we found that miR-1 ......" | 25333261 |
| hsa-miR-145-5p | prostate cancer | TP53 | "MicroRNA 145 is regulated by DNA methylation and p ......" | 21349819 |
| hsa-miR-145-5p | prostate cancer | TP53 | "miR-145 is a well-documented tumour suppressor and ......" | 23703249 |
| hsa-miR-145-5p | prostate cancer | TP53 | "The putative tumor suppressor miR145 is transcript ......" | 20332243 |
| hsa-miR-145-5p | breast cancer | MYC | "We found a reverse-correlation between the express ......" | 21723890 |
| hsa-miR-145-5p | colon cancer | MYC | "The ectopic expression of miR-145 inhibited the gr ......" | 23499891 |
| hsa-miR-145-5p | colon cancer | MYC | "miR-145 delivery reduced tumor proliferation and i ......" | 21690566 |
| hsa-miR-145-5p | colon cancer | MYC | "Consequently the increased miR-145 induced G1 cell ......" | 27482839 |
| hsa-miR-145-5p | esophageal cancer | MYC | "miR 145 inhibits proliferation and invasion of eso ......" | 24356567 |
| hsa-miR-145-5p | lung squamous cell cancer | MYC | "In colon cancer cells c-Myc is a confirmed direct ......" | 21092188 |
| hsa-miR-145-5p | melanoma | MYC | "The ectopic expression of miR-145 showed a signifi ......" | 21836381 |
| hsa-miR-145-5p | ovarian cancer | MYC | "MicroRNA 145 function as a cell growth repressor b ......" | 23919393 |
| hsa-miR-145-5p | glioblastoma | SOX2 | "We also show that miR-145 and SOX2 form a double n ......" | 21211035 |
| hsa-miR-145-5p | glioblastoma | SOX2 | "In this study our miRNA/mRNA-microarray and RT-PCR ......" | 22098779 |
| hsa-miR-145-5p | lung squamous cell cancer | SOX2 | "miR-145 regulates SOX2 and OCT4 translation and p5 ......" | 22835608 |
| hsa-miR-145-5p | prostate cancer | SOX2 | "Overexpression of miR 145 5p inhibits proliferatio ......" | 25951106 |
| hsa-miR-145-5p | sarcoma | SOX2 | "Finally we provide evidence that EWS-FLI-1 and miR ......" | 20382729 |
| hsa-miR-145-5p | glioblastoma | NEDD9 | "NEDD9 a novel target of miR 145 increases the inva ......" | 22869051 |
| hsa-miR-145-5p | kidney renal cell cancer | NEDD9 | "miR 145 functions as tumor suppressor and targets ......" | 24384875 |
| hsa-miR-145-5p | pancreatic cancer | NEDD9 | "MicroRNA 145 suppresses cell proliferation invasio ......" | 25646678 |
| hsa-miR-145-5p | prostate cancer | NEDD9 | "HEF1 promotes epithelial mesenchymal transition an ......" | 23355420 |
| hsa-miR-145-5p | breast cancer | ROCK1 | "MicroRNA 145 inhibits growth and migration of brea ......" | 26715279 |
| hsa-miR-145-5p | liver cancer | ROCK1 | "MiR 145 suppresses cell proliferation and motility ......" | 26615424 |
| hsa-miR-145-5p | sarcoma | ROCK1 | "microRNA 145 inhibits osteosarcoma cell proliferat ......" | 24789502 |
| hsa-miR-145-5p | sarcoma | ROCK1 | "MiR 145 inhibits osteosarcoma cells proliferation ......" | 24801908 |
| hsa-miR-145-5p | breast cancer | CDH1 | "Over-expression of miR-145 mimics enhanced protein ......" | 23049906 |
| hsa-miR-145-5p | lung cancer | CDH1 | "Over-expression of miR-145 mimics enhanced protein ......" | 26309531 |
| hsa-miR-145-5p | thyroid cancer | CDH1 | "Overexpression of miR-145 in thyroid cancer cell l ......" | 24781864 |
| hsa-miR-145-5p | colon cancer | EGFR | "EGFR signals downregulate tumor suppressors miR 14 ......" | 21653642 |
| hsa-miR-145-5p | lung cancer | EGFR | "MiR 145 inhibits cell proliferation of human lung ......" | 21289483 |
| hsa-miR-145-5p | lung cancer | EGFR | "Our results also show that restoration of tumour s ......" | 19493678 |
| hsa-miR-145-5p | breast cancer | ERBB2 | "The expression of miR-145 in patients with breast ......" | 27396353 |
| hsa-miR-145-5p | pancreatic cancer | ERBB2 | "Additionally intratumoral injections of miR-145 in ......" | 25277192 |
| hsa-miR-145-5p | pancreatic cancer | ERBB2 | "miR-145 re-expression resulted in downregulation o ......" | 27507554 |
| hsa-miR-145-5p | liver cancer | IRS1 | "Luciferase reporter assay further verified direct ......" | 22431718 |
| hsa-miR-145-5p | liver cancer | IRS1 | "MicroRNA 145 suppresses hepatocellular carcinoma b ......" | 24690171 |
| hsa-miR-145-5p | melanoma | IRS1 | "IRS-1 was identified as a potential target of miR- ......" | 24762580 |
| hsa-miR-145-5p | breast cancer | LINC-ROR | "lincRNA RoR and miR 145 regulate invasion in tripl ......" | 25253741 |
| hsa-miR-145-5p | colon cancer | LINC-ROR | "Long Non Coding RNA lincRNA ROR Promotes the Progr ......" | 27071407 |
| hsa-miR-145-5p | endometrial cancer | LINC-ROR | "After construction of adenovirus vectors carrying ......" | 24589415 |
| hsa-miR-145-5p | bladder cancer | VEGFA | "The ectopic expression of miR-1 and miR-145 in NOZ ......" | 24966896 |
| hsa-miR-145-5p | sarcoma | VEGFA | "Furthermore the results showed that vascular endot ......" | 22472569 |
| hsa-miR-145-5p | thyroid cancer | VEGFA | "Overexpression of miR-145 in thyroid cancer cell l ......" | 24781864 |
| hsa-miR-145-5p | bladder cancer | ZEB2 | "ZEB2 was identified as a down-stream target of miR ......" | 26318860 |
| hsa-miR-145-5p | gastric cancer | ZEB2 | "MicroRNA 145 5p inhibits gastric cancer invasivene ......" | 27143926 |
| hsa-miR-145-5p | prostate cancer | ZEB2 | "Double negative feedback loop between ZEB2 and miR ......" | 25296715 |
| hsa-miR-145-5p | kidney renal cell cancer | ADAM17 | "MicroRNA 145 targets the metalloprotease ADAM17 an ......" | 23441135 |
| hsa-miR-145-5p | liver cancer | ADAM17 | "MicroRNA 145 inhibits cell proliferation by direct ......" | 25174729 |
| hsa-miR-145-5p | kidney renal cell cancer | ANGPT2 | "miR 145 functions as tumor suppressor and targets ......" | 24384875 |
| hsa-miR-145-5p | pancreatic cancer | ANGPT2 | "MiR 145 functions as a tumor suppressor via regula ......" | 27570490 |
| hsa-miR-145-5p | gastric cancer | CDH2 | "N-cadherin CDH2 was proved to be a direct target o ......" | 22370644 |
| hsa-miR-145-5p | gastric cancer | CDH2 | "MicroRNA 145 5p inhibits gastric cancer invasivene ......" | 27143926 |
| hsa-miR-145-5p | endometrial cancer | DICER1 | "After construction of adenovirus vectors carrying ......" | 24589415 |
| hsa-miR-145-5p | ovarian cancer | DICER1 | "We show that p70S6K phosphorylates and inhibits th ......" | 27191261 |
| hsa-miR-145-5p | endometrial cancer | DNMT3B | "In univariate analysis the combination of DNMT3B o ......" | 24071015 |
| hsa-miR-145-5p | prostate cancer | DNMT3B | "It was found that miR-145 upregulates while DNMT3b ......" | 25749421 |
| hsa-miR-145-5p | lung cancer | EGF | "We previously reported that restoration of hsa-miR ......" | 21289483 |
| hsa-miR-145-5p | lung cancer | EGF | "Restoration of tumour suppressor hsa miR 145 inhib ......" | 19493678 |
| hsa-miR-145-5p | colorectal cancer | ERG | "miR 145 suppresses colorectal cancer cell migratio ......" | 27572146 |
| hsa-miR-145-5p | prostate cancer | ERG | "The proto oncogene ERG is a target of microRNA miR ......" | 23480797 |
| hsa-miR-145-5p | breast cancer | ESR1 | "The expression of miR-145 in patients with breast ......" | 27396353 |
| hsa-miR-145-5p | breast cancer | ESR1 | "miR 145 participates with TP53 in a death promotin ......" | 19730444 |
| hsa-miR-145-5p | breast cancer | F11R | "Our data identify JAM-A and fascin as novel target ......" | 20818426 |
| hsa-miR-145-5p | glioblastoma | F11R | "MicroRNA screening predicted that microRNA-145 miR ......" | 26374689 |
| hsa-miR-145-5p | breast cancer | FN1 | "Over-expression of miR-145 mimics enhanced protein ......" | 23049906 |
| hsa-miR-145-5p | lung cancer | FN1 | "Over-expression of miR-145 mimics enhanced protein ......" | 26309531 |
| hsa-miR-145-5p | liver cancer | INSR | "Multiple in silico algorithms predicted that miR-1 ......" | 22431718 |
| hsa-miR-145-5p | melanoma | INSR | "MicroRNA 145 may play an important role in uveal m ......" | 24762580 |
| hsa-miR-145-5p | bladder cancer | MMP9 | "Using the DIANA-mirPath v.2 software miRNAs able t ......" | 27602581 |
| hsa-miR-145-5p | gastric cancer | MMP9 | "Although not a direct target of miR-145 matrix met ......" | 22370644 |
| hsa-miR-145-5p | lung cancer | MTDH | "MiR 145 acts as a metastasis suppressor by targeti ......" | 25428378 |
| hsa-miR-145-5p | ovarian cancer | MTDH | "miR 145 inhibits tumor growth and metastasis by ta ......" | 25333261 |
| hsa-miR-145-5p | pancreatic cancer | MUC13 | "MicroRNA 145 targets MUC13 and suppresses growth a ......" | 25277192 |
| hsa-miR-145-5p | pancreatic cancer | MUC13 | "miR-145 re-expression resulted in downregulation o ......" | 27507554 |
| hsa-miR-145-5p | glioblastoma | NANOG | "Real-time polymerase chain reaction was used to an ......" | 24531649 |
| hsa-miR-145-5p | pancreatic cancer | NANOG | "ROR functions as a ceRNA to regulate Nanog express ......" | 26636540 |
| hsa-miR-145-5p | colorectal cancer | SOX9 | "Ectopic expression of miR-145 in turn regulates SO ......" | 24631504 |
| hsa-miR-145-5p | sarcoma | SOX9 | "The epigenetic regulation of SOX9 by miR 145 in hu ......" | 25145279 |
| hsa-miR-145-5p | retinoblastoma | ADAM19 | "MiR 145 suppressed human retinoblastoma cell proli ......" | 26823772 |
| hsa-miR-145-5p | cervical and endocervical cancer | AGO2 | "By performing RNA-binding protein immunoprecipitat ......" | 26311052 |
| hsa-miR-145-5p | prostate cancer | AIFM1 | "Artificial overexpression of miR145 by using adeno ......" | 20332243 |
| hsa-miR-145-5p | thyroid cancer | AKT3 | "miR 145 suppresses thyroid cancer growth and metas ......" | 24781864 |
| hsa-miR-145-5p | prostate cancer | AR | "miR 145 suppress the androgen receptor in prostate ......" | 25969144 |
| hsa-miR-145-5p | breast cancer | ARF6 | "lincRNA RoR and miR 145 regulate invasion in tripl ......" | 25253741 |
| hsa-miR-145-5p | bladder cancer | AXL | "The ectopic expression of miR-1 and miR-145 in NOZ ......" | 24966896 |
| hsa-miR-145-5p | prostate cancer | BCL2L1 | "ASC miR-145 knockdown CM also reduced the expressi ......" | 27465939 |
| hsa-miR-145-5p | breast cancer | BIRC2 | "The cellular inhibitor of apoptosis cIAP1 which is ......" | 26733177 |
| hsa-miR-145-5p | melanoma | BLM | "Therefore in this study we examined the expression ......" | 23404256 |
| hsa-miR-145-5p | prostate cancer | BNIP3 | "Artificial overexpression of miR145 by using adeno ......" | 20332243 |
| hsa-miR-145-5p | lung cancer | CAMK1D | "Loss of miR-143/145 in vivo led to derepression of ......" | 26586766 |
| hsa-miR-145-5p | ovarian cancer | CASP3 | "The results revealed that the expression levels of ......" | 25937243 |
| hsa-miR-145-5p | colon cancer | CD44 | "This was associated with decreased expression of C ......" | 25928322 |
| hsa-miR-145-5p | lung squamous cell cancer | CDK4 | "Furthermore we found that CDK4 was regulated by mi ......" | 21092188 |
| hsa-miR-145-5p | ovarian cancer | CDK6 | "miR 145 sensitizes ovarian cancer cells to paclita ......" | 24510775 |
| hsa-miR-145-5p | gastric cancer | CTNND1 | "Luciferase assay western blot analysis and in vivo ......" | 25470111 |
| hsa-miR-145-5p | liver cancer | CUL5 | "Downregulation of MicroRNA 145 Caused by Hepatitis ......" | 26512974 |
| hsa-miR-145-5p | prostate cancer | DAB2 | "Effects of miR 145 on the migration and invasion o ......" | 24846918 |
| hsa-miR-145-5p | gastric cancer | E2F3 | "miR 145 mediates the antiproliferative and gene re ......" | 25762621 |
| hsa-miR-145-5p | breast cancer | ERBB3 | "miR 143 and miR 145 synergistically regulate ERBB3 ......" | 25248370 |
| hsa-miR-145-5p | gastric cancer | ETS1 | "In gastric cancer specimens and cell lines miRNA-1 ......" | 23233482 |
| hsa-miR-145-5p | sarcoma | ETV5 | "We hypothesized that the expression of miR-145 is ......" | 25145279 |
| hsa-miR-145-5p | colon cancer | FLI1 | "In this study the authors identified the Friend le ......" | 20737575 |
| hsa-miR-145-5p | colon cancer | GJA1 | "The miR-145 transfer to SW480 up-regulates their C ......" | 27058413 |
| hsa-miR-145-5p | liver cancer | HDAC2 | "MiR 145 functions as a tumor suppressor by directl ......" | 23499894 |
| hsa-miR-145-5p | kidney renal cell cancer | HK2 | "Luciferase reporter assays showed that both miR-14 ......" | 24033605 |
| hsa-miR-145-5p | cervical and endocervical cancer | HLTF | "We show that miR-145 targets the DNA damage repair ......" | 25666710 |
| hsa-miR-145-5p | ovarian cancer | HMGA2 | "This study addressed the hypothesis that miR-145 s ......" | 25444913 |
| hsa-miR-145-5p | acute myeloid leukemia | HOXA9 | "From result it was observed mir-145 has highest af ......" | 26175662 |
| hsa-miR-145-5p | colorectal cancer | IGF1R | "MiR 143 and MiR 145 regulate IGF1R to suppress cel ......" | 25474488 |
| hsa-miR-145-5p | bladder cancer | ILK | "We newly elucidated that miR-143 targeted akt and ......" | 23104321 |
| hsa-miR-145-5p | liver cancer | IRS2 | "Multiple in silico algorithms predicted that miR-1 ......" | 22431718 |
| hsa-miR-145-5p | colon cancer | KRAS | "Stable miR-143 or miR-145 overexpression increased ......" | 26824186 |
| hsa-miR-145-5p | colon cancer | KRT20 | "This was associated with decreased expression of C ......" | 25928322 |
| hsa-miR-145-5p | colon cancer | LASP1 | "Epigenetically regulated miR 145 suppresses colon ......" | 27626692 |
| hsa-miR-145-5p | bladder cancer | LCN2 | "Using the DIANA-mirPath v.2 software miRNAs able t ......" | 27602581 |
| hsa-miR-145-5p | lung cancer | LCT | "The molecular mechanism of down-regulated microRNA ......" | 26582602 |
| hsa-miR-145-5p | cervical and endocervical cancer | MALAT1 | "Long non coding RNA MALAT1 modulates radiosensitiv ......" | 26311052 |
| hsa-miR-145-5p | colon cancer | MAPK7 | "miR-145 delivery reduced tumor proliferation and i ......" | 21690566 |
| hsa-miR-145-5p | breast cancer | MBOAT4 | "To test our RNA extraction efficiency we spiked-in ......" | 19454029 |
| hsa-miR-145-5p | breast cancer | MMP11 | "MicroRNA 145 functions as a tumor suppressor by ta ......" | 27364572 |
| hsa-miR-145-5p | gastric cancer | MMP2 | "Although not a direct target of miR-145 matrix met ......" | 22370644 |
| hsa-miR-145-5p | ovarian cancer | MUC1 | "MiR 145 is downregulated in human ovarian cancer a ......" | 24157791 |
| hsa-miR-145-5p | prostate cancer | MYO6 | "A computational search indicated the 3'-untranslat ......" | 20353999 |
| hsa-miR-145-5p | bladder cancer | NMI | "We have shown that miR-145 is a novel robust and d ......" | 26196183 |
| hsa-miR-145-5p | colon cancer | NRAS | "miR-145 expression was significantly downregulated ......" | 26973415 |
| hsa-miR-145-5p | lung cancer | NUDT1 | "MiR 145 inhibits cell proliferation of human lung ......" | 21289483 |
| hsa-miR-145-5p | bladder cancer | PAK1 | "miR 145 inhibits invasion of bladder cancer cells ......" | 24954107 |
| hsa-miR-145-5p | colon cancer | PAK4 | "We further demonstrated that miR-145 directly targ ......" | 23499891 |
| hsa-miR-145-5p | prostate cancer | PCGEM1 | "Reciprocal regulation of PCGEM1 and miR 145 promot ......" | 25200485 |
| hsa-miR-145-5p | colon cancer | PDLIM5 | "We also provided experimental evidences which incl ......" | 27626692 |
| hsa-miR-145-5p | esophageal cancer | PLCE1 | "Targeting oncogenic PLCE1 by miR 145 impairs tumor ......" | 26657507 |
| hsa-miR-145-5p | liver cancer | POU5F1P4 | "Pseudogene OCT4 pg4 functions as a natural micro R ......" | 23615404 |
| hsa-miR-145-5p | endometrial cancer | POU5F1P5 | "OCT4 expression can be modulated by miR-145 and th ......" | 25634023 |
| hsa-miR-145-5p | colorectal cancer | PPARA | "PPARγ regulates the expression of miR-145 by dire ......" | 24631504 |
| hsa-miR-145-5p | pancreatic cancer | PSMA5 | "Physico-chemical characterization dynamic light sc ......" | 27507554 |
| hsa-miR-145-5p | bladder cancer | PTCRA | "miR-145 was under-expressed in 73.3% and 86.7% of ......" | 23489501 |
| hsa-miR-145-5p | gastric cancer | PTGS2 | "A mutation in the miR-145-5p binding site complete ......" | 24616567 |
| hsa-miR-145-5p | colorectal cancer | PXN | "MicroRNA 145 suppresses cell migration and invasio ......" | 25973017 |
| hsa-miR-145-5p | breast cancer | RAB27A | "MiR-145 exhibited an inhibitory role in cell invas ......" | 27364572 |
| hsa-miR-145-5p | breast cancer | RAB6A | "MicroRNA 145 functions as a tumor suppressor by ta ......" | 27364572 |
| hsa-miR-145-5p | colorectal cancer | RAD18 | "Tumor suppressor miR 145 reverses drug resistance ......" | 25913620 |
| hsa-miR-145-5p | ovarian cancer | RPS6KB1 | "MiR 145 is downregulated in human ovarian cancer a ......" | 24157791 |
| hsa-miR-145-5p | breast cancer | RTKN | "miR 145 inhibits breast cancer cell growth through ......" | 19360360 |
| hsa-miR-145-5p | prostate cancer | SENP1 | "Tumor suppressive microRNA 145 induces growth arre ......" | 25645686 |
| hsa-miR-145-5p | bladder cancer | SERPINE1 | "Mature miR-143 and miR-145 are coordinately expres ......" | 22108519 |
| hsa-miR-145-5p | lung squamous cell cancer | SMAD3 | "MiR 145 and miR 203 represses TGF β induced epith ......" | 27237033 |
| hsa-miR-145-5p | prostate cancer | SNORD48 | "Following polyadenylation and reverse transcriptio ......" | 23703249 |
| hsa-miR-145-5p | bladder cancer | SOCS7 | "socs7 a target gene of microRNA 145 regulates inte ......" | 23392170 |
| hsa-miR-145-5p | ovarian cancer | SP1 | "miR 145 sensitizes ovarian cancer cells to paclita ......" | 24510775 |
| hsa-miR-145-5p | glioblastoma | SRGAP1 | "Herein we investigated the correlation between miR ......" | 26026080 |
| hsa-miR-145-5p | glioblastoma | SRY | "Real-time polymerase chain reaction was used to an ......" | 24531649 |
| hsa-miR-145-5p | colon cancer | STAT1 | "MicroRNA 145 targets YES and STAT1 in colon cancer ......" | 20098684 |
| hsa-miR-145-5p | bladder cancer | STAT3 | "socs7 a target gene of microRNA 145 regulates inte ......" | 23392170 |
| hsa-miR-145-5p | prostate cancer | SWAP70 | "SWAP70 actin binding protein function as an oncoge ......" | 21360565 |
| hsa-miR-145-5p | bladder cancer | TLR3 | "The apoptosis did not depend on Toll-like receptor ......" | 23392170 |
| hsa-miR-145-5p | breast cancer | TNF | "MiR 145 promotes TNF α induced apoptosis by facil ......" | 26733177 |
| hsa-miR-145-5p | prostate cancer | TNFSF10 | "One of the genes significantly upregulated by miR- ......" | 20588276 |
| hsa-miR-145-5p | pancreatic cancer | TNMD | "Physico-chemical characterization dynamic light sc ......" | 27507554 |
| hsa-miR-145-5p | pancreatic cancer | TRIB3 | "In particular ROR may act as a ceRNA effectively b ......" | 26636540 |
| hsa-miR-145-5p | ovarian cancer | TRIM2 | "MicroRNA 145 targets TRIM2 and exerts tumor suppre ......" | 26472353 |
| hsa-miR-145-5p | lung squamous cell cancer | TTR | "We analysed the expression of the miR-302-367 clus ......" | 22835608 |
| hsa-miR-145-5p | bladder cancer | TUG1 | "Double negative feedback loop between long non cod ......" | 26318860 |
| hsa-miR-145-5p | bladder cancer | UHRF1 | "Taken together our present data demonstrated that ......" | 27072587 |
| hsa-miR-145-5p | colon cancer | YES1 | "MicroRNA 145 targets YES and STAT1 in colon cancer ......" | 20098684 |
| hsa-miR-145-5p | prostate cancer | ZEB2-AS1 | "Importantly the expression level of ZEB2 as reveal ......" | 25296715 |
| hsa-miR-145-5p | ovarian cancer | ZFP36 | "We show that p70S6K phosphorylates and inhibits th ......" | 27191261 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-145-5p | APH1A | 14 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.056; TCGA BRCA -0.176; TCGA ESCA -0.086; TCGA HNSC -0.056; TCGA LGG -0.065; TCGA LIHC -0.105; TCGA LUAD -0.073; TCGA LUSC -0.154; TCGA OV -0.086; TCGA PRAD -0.133; TCGA SARC -0.207; TCGA THCA -0.114; TCGA STAD -0.066; TCGA UCEC -0.149 |
hsa-miR-145-5p | CBFB | 10 cancers: BLCA; COAD; ESCA; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.076; TCGA COAD -0.063; TCGA ESCA -0.074; TCGA KIRP -0.086; TCGA LGG -0.081; TCGA LUAD -0.069; TCGA PRAD -0.124; TCGA SARC -0.163; TCGA THCA -0.155; TCGA STAD -0.252 |
hsa-miR-145-5p | CCDC43 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.094; TCGA BRCA -0.078; TCGA COAD -0.068; TCGA ESCA -0.102; TCGA KIRP -0.071; TCGA LIHC -0.086; TCGA LUAD -0.172; TCGA LUSC -0.224; TCGA PRAD -0.139; TCGA STAD -0.094; TCGA UCEC -0.093 |
hsa-miR-145-5p | DFFA | 10 cancers: BLCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.061; TCGA COAD -0.09; TCGA HNSC -0.09; TCGA LIHC -0.059; TCGA LUAD -0.087; TCGA LUSC -0.111; TCGA OV -0.141; TCGA PRAD -0.065; TCGA SARC -0.052; TCGA UCEC -0.063 |
hsa-miR-145-5p | DTD1 | 9 cancers: BLCA; ESCA; KIRC; KIRP; LUSC; PAAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.089; TCGA ESCA -0.141; TCGA KIRC -0.142; TCGA KIRP -0.124; TCGA LUSC -0.121; TCGA PAAD -0.209; TCGA SARC -0.243; TCGA THCA -0.067; TCGA UCEC -0.1 |
hsa-miR-145-5p | GMFB | 11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.078; TCGA COAD -0.156; TCGA ESCA -0.066; TCGA HNSC -0.072; TCGA LUAD -0.085; TCGA OV -0.092; TCGA PRAD -0.196; TCGA SARC -0.205; TCGA THCA -0.074; TCGA STAD -0.212; TCGA UCEC -0.121 |
hsa-miR-145-5p | HDAC2 | 11 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.114; TCGA BRCA -0.077; TCGA COAD -0.06; TCGA ESCA -0.124; TCGA LUAD -0.117; TCGA LUSC -0.28; TCGA PAAD -0.073; TCGA PRAD -0.13; TCGA THCA -0.054; TCGA STAD -0.108; TCGA UCEC -0.128 |
hsa-miR-145-5p | HLTF | 9 cancers: BLCA; BRCA; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.065; TCGA BRCA -0.069; TCGA LIHC -0.128; TCGA LUAD -0.214; TCGA LUSC -0.372; TCGA OV -0.086; TCGA PAAD -0.127; TCGA PRAD -0.272; TCGA UCEC -0.132 |
hsa-miR-145-5p | MYO6 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.146; TCGA BRCA -0.117; TCGA ESCA -0.135; TCGA HNSC -0.097; TCGA KIRP -0.079; TCGA LUAD -0.089; TCGA PRAD -0.431; TCGA THCA -0.217; TCGA STAD -0.172; TCGA UCEC -0.133 |
hsa-miR-145-5p | NIPSNAP1 | 12 cancers: BLCA; BRCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.102; TCGA BRCA -0.229; TCGA HNSC -0.072; TCGA LUAD -0.16; TCGA LUSC -0.306; TCGA OV -0.158; TCGA PAAD -0.102; TCGA PRAD -0.12; TCGA SARC -0.127; TCGA THCA -0.056; TCGA STAD -0.102; TCGA UCEC -0.143 |
hsa-miR-145-5p | PAK4 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.064; TCGA BRCA -0.326; TCGA ESCA -0.143; TCGA HNSC -0.086; TCGA KIRC -0.067; TCGA LIHC -0.119; TCGA LUSC -0.134; TCGA PRAD -0.123; TCGA SARC -0.069; TCGA STAD -0.087; TCGA UCEC -0.058 |
hsa-miR-145-5p | PIGF | 11 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.059; TCGA COAD -0.1; TCGA ESCA -0.153; TCGA LGG -0.069; TCGA LIHC -0.122; TCGA LUAD -0.093; TCGA LUSC -0.11; TCGA PAAD -0.104; TCGA PRAD -0.077; TCGA SARC -0.223; TCGA UCEC -0.115 |
hsa-miR-145-5p | VEGFA | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; OV; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.278; TCGA BRCA -0.089; TCGA CESC -0.128; TCGA COAD -0.104; TCGA ESCA -0.22; TCGA LIHC -0.079; TCGA OV -0.098; TCGA STAD -0.2; TCGA UCEC -0.164 |
hsa-miR-145-5p | YES1 | 10 cancers: BLCA; COAD; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.082; TCGA COAD -0.09; TCGA HNSC -0.078; TCGA LGG -0.139; TCGA LUAD -0.128; TCGA LUSC -0.22; TCGA PRAD -0.198; TCGA SARC -0.062; TCGA STAD -0.133; TCGA UCEC -0.098 |
hsa-miR-145-5p | ATF1 | 11 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.055; TCGA COAD -0.115; TCGA ESCA -0.085; TCGA LGG -0.057; TCGA LUAD -0.16; TCGA LUSC -0.077; TCGA PRAD -0.219; TCGA SARC -0.08; TCGA THCA -0.066; TCGA STAD -0.101; TCGA UCEC -0.055 |
hsa-miR-145-5p | RINT1 | 11 cancers: BLCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.075; TCGA COAD -0.095; TCGA KIRC -0.114; TCGA KIRP -0.063; TCGA LIHC -0.076; TCGA LUAD -0.125; TCGA LUSC -0.17; TCGA PRAD -0.21; TCGA SARC -0.087; TCGA STAD -0.136; TCGA UCEC -0.072 |
hsa-miR-145-5p | PLAGL2 | 11 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.078; TCGA BRCA -0.075; TCGA ESCA -0.084; TCGA HNSC -0.096; TCGA LIHC -0.063; TCGA LUAD -0.074; TCGA LUSC -0.15; TCGA PRAD -0.106; TCGA SARC -0.079; TCGA STAD -0.138; TCGA UCEC -0.147 |
hsa-miR-145-5p | ANKRD28 | 10 cancers: BLCA; KIRP; LGG; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.052; TCGA KIRP -0.069; TCGA LGG -0.101; TCGA LUAD -0.058; TCGA OV -0.076; TCGA PRAD -0.189; TCGA SARC -0.144; TCGA THCA -0.063; TCGA STAD -0.134; TCGA UCEC -0.054 |
hsa-miR-145-5p | SPATS2 | 13 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.07; TCGA BRCA -0.159; TCGA COAD -0.059; TCGA KIRC -0.089; TCGA KIRP -0.077; TCGA LIHC -0.251; TCGA LUAD -0.186; TCGA LUSC -0.294; TCGA PAAD -0.076; TCGA PRAD -0.156; TCGA THCA -0.105; TCGA STAD -0.069; TCGA UCEC -0.113 |
hsa-miR-145-5p | UBA6 | 12 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.147; TCGA CESC -0.098; TCGA COAD -0.122; TCGA HNSC -0.147; TCGA KIRC -0.082; TCGA LUAD -0.119; TCGA LUSC -0.201; TCGA OV -0.09; TCGA PRAD -0.172; TCGA THCA -0.077; TCGA STAD -0.209; TCGA UCEC -0.07 |
hsa-miR-145-5p | ETNK1 | 10 cancers: BLCA; COAD; ESCA; KIRP; LUAD; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.117; TCGA COAD -0.154; TCGA ESCA -0.153; TCGA KIRP -0.055; TCGA LUAD -0.134; TCGA OV -0.115; TCGA PRAD -0.224; TCGA SARC -0.09; TCGA STAD -0.227; TCGA UCEC -0.067 |
hsa-miR-145-5p | CRKL | 9 cancers: BLCA; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.054; TCGA LGG -0.082; TCGA LIHC -0.095; TCGA LUAD -0.089; TCGA LUSC -0.163; TCGA PAAD -0.093; TCGA PRAD -0.114; TCGA SARC -0.053; TCGA STAD -0.098 |
hsa-miR-145-5p | TM9SF4 | 13 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.064; TCGA BRCA -0.088; TCGA ESCA -0.058; TCGA KIRC -0.095; TCGA LIHC -0.074; TCGA LUAD -0.055; TCGA LUSC -0.12; TCGA PAAD -0.101; TCGA PRAD -0.135; TCGA SARC -0.118; TCGA THCA -0.067; TCGA STAD -0.107; TCGA UCEC -0.075 |
hsa-miR-145-5p | TARS2 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.111; TCGA BRCA -0.216; TCGA CESC -0.099; TCGA ESCA -0.094; TCGA HNSC -0.066; TCGA KIRC -0.124; TCGA LIHC -0.071; TCGA LUAD -0.104; TCGA LUSC -0.281; TCGA OV -0.164; TCGA PRAD -0.127; TCGA STAD -0.154; TCGA UCEC -0.204 |
hsa-miR-145-5p | ACVR1B | 9 cancers: BLCA; ESCA; HNSC; LUAD; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.168; TCGA ESCA -0.085; TCGA HNSC -0.078; TCGA LUAD -0.166; TCGA OV -0.072; TCGA PRAD -0.133; TCGA SARC -0.196; TCGA STAD -0.11; TCGA UCEC -0.105 |
hsa-miR-145-5p | ESCO2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.136; TCGA BRCA -0.471; TCGA CESC -0.103; TCGA COAD -0.23; TCGA ESCA -0.364; TCGA HNSC -0.274; TCGA LIHC -0.351; TCGA LUAD -0.376; TCGA LUSC -0.786; TCGA OV -0.151; TCGA PRAD -0.531; TCGA THCA -0.345; TCGA STAD -0.469; TCGA UCEC -0.462 |
hsa-miR-145-5p | ADPGK | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.056; TCGA BRCA -0.071; TCGA CESC -0.071; TCGA COAD -0.087; TCGA ESCA -0.15; TCGA KIRC -0.116; TCGA SARC -0.32; TCGA THCA -0.071; TCGA STAD -0.152; TCGA UCEC -0.095 |
hsa-miR-145-5p | NSUN4 | 10 cancers: BLCA; COAD; HNSC; KIRP; LIHC; LUAD; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.072; TCGA COAD -0.074; TCGA HNSC -0.069; TCGA KIRP -0.063; TCGA LIHC -0.085; TCGA LUAD -0.051; TCGA OV -0.124; TCGA PRAD -0.074; TCGA STAD -0.099; TCGA UCEC -0.107 |
hsa-miR-145-5p | YTHDF2 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.093; TCGA COAD -0.054; TCGA ESCA -0.058; TCGA HNSC -0.057; TCGA LUAD -0.071; TCGA OV -0.134; TCGA PRAD -0.092; TCGA STAD -0.097; TCGA UCEC -0.077 |
hsa-miR-145-5p | PAN2 | 11 cancers: BLCA; COAD; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.139; TCGA COAD -0.087; TCGA KIRC -0.162; TCGA KIRP -0.212; TCGA LGG -0.132; TCGA LIHC -0.124; TCGA LUSC -0.146; TCGA OV -0.162; TCGA PRAD -0.079; TCGA SARC -0.065; TCGA STAD -0.14 |
hsa-miR-145-5p | FBXO28 | 11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.081; TCGA COAD -0.09; TCGA ESCA -0.053; TCGA HNSC -0.057; TCGA LUAD -0.099; TCGA LUSC -0.131; TCGA OV -0.051; TCGA PRAD -0.234; TCGA THCA -0.07; TCGA STAD -0.1; TCGA UCEC -0.079 |
hsa-miR-145-5p | ABCE1 | 10 cancers: BLCA; COAD; ESCA; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.086; TCGA COAD -0.12; TCGA ESCA -0.151; TCGA LUAD -0.161; TCGA LUSC -0.147; TCGA OV -0.092; TCGA PRAD -0.247; TCGA THCA -0.051; TCGA STAD -0.221; TCGA UCEC -0.107 |
hsa-miR-145-5p | PPIP5K2 | 9 cancers: BLCA; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.08; TCGA COAD -0.1; TCGA ESCA -0.062; TCGA KIRC -0.053; TCGA LUAD -0.075; TCGA LUSC -0.074; TCGA PRAD -0.203; TCGA SARC -0.053; TCGA STAD -0.137 |
hsa-miR-145-5p | ZDHHC9 | 11 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.082; TCGA BRCA -0.081; TCGA ESCA -0.128; TCGA KIRC -0.079; TCGA LIHC -0.11; TCGA LUAD -0.1; TCGA PRAD -0.242; TCGA SARC -0.287; TCGA THCA -0.067; TCGA STAD -0.212; TCGA UCEC -0.106 |
hsa-miR-145-5p | MPP5 | 9 cancers: BLCA; COAD; HNSC; LUAD; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.059; TCGA COAD -0.096; TCGA HNSC -0.068; TCGA LUAD -0.064; TCGA OV -0.106; TCGA PRAD -0.112; TCGA SARC -0.075; TCGA STAD -0.05; TCGA UCEC -0.071 |
hsa-miR-145-5p | MAGOHB | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.073; TCGA BRCA -0.167; TCGA COAD -0.089; TCGA ESCA -0.143; TCGA KIRC -0.17; TCGA KIRP -0.107; TCGA LGG -0.088; TCGA LIHC -0.106; TCGA LUAD -0.159; TCGA LUSC -0.213; TCGA STAD -0.07; TCGA UCEC -0.134 |
hsa-miR-145-5p | RPS6KB1 | 10 cancers: BLCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.063; TCGA COAD -0.076; TCGA HNSC -0.057; TCGA LGG -0.07; TCGA LIHC -0.11; TCGA LUAD -0.157; TCGA LUSC -0.191; TCGA PRAD -0.211; TCGA SARC -0.053; TCGA STAD -0.096 |
hsa-miR-145-5p | ZBTB33 | 13 cancers: BLCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.134; TCGA HNSC -0.093; TCGA LGG -0.098; TCGA LIHC -0.097; TCGA LUAD -0.087; TCGA LUSC -0.232; TCGA OV -0.058; TCGA PAAD -0.117; TCGA PRAD -0.202; TCGA SARC -0.135; TCGA THCA -0.126; TCGA STAD -0.187; TCGA UCEC -0.101 |
hsa-miR-145-5p | MED13 | 10 cancers: BLCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.072; TCGA ESCA -0.056; TCGA HNSC -0.075; TCGA LGG -0.105; TCGA LIHC -0.053; TCGA LUAD -0.156; TCGA LUSC -0.125; TCGA PRAD -0.22; TCGA THCA -0.211; TCGA STAD -0.142 |
hsa-miR-145-5p | SH3BP1 | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.116; TCGA BRCA -0.226; TCGA COAD -0.083; TCGA HNSC -0.121; TCGA LGG -0.14; TCGA LUSC -0.143; TCGA SARC -0.206; TCGA THCA -0.326; TCGA STAD -0.115; TCGA UCEC -0.093 |
hsa-miR-145-5p | CPSF6 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.078; TCGA BRCA -0.059; TCGA COAD -0.084; TCGA ESCA -0.096; TCGA HNSC -0.064; TCGA LGG -0.067; TCGA LIHC -0.075; TCGA LUAD -0.113; TCGA LUSC -0.247; TCGA OV -0.104; TCGA PRAD -0.166; TCGA STAD -0.13; TCGA UCEC -0.066 |
hsa-miR-145-5p | PHRF1 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.092; TCGA BRCA -0.16; TCGA CESC -0.068; TCGA ESCA -0.053; TCGA HNSC -0.085; TCGA KIRC -0.061; TCGA LIHC -0.064; TCGA PRAD -0.055; TCGA STAD -0.068 |
hsa-miR-145-5p | KIF21A | 11 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.139; TCGA BRCA -0.104; TCGA KIRC -0.203; TCGA KIRP -0.087; TCGA LIHC -0.074; TCGA LUAD -0.13; TCGA LUSC -0.216; TCGA PAAD -0.256; TCGA PRAD -0.392; TCGA THCA -0.074; TCGA STAD -0.177 |
hsa-miR-145-5p | RAB11FIP4 | 10 cancers: BLCA; BRCA; CESC; ESCA; LIHC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.148; TCGA BRCA -0.308; TCGA CESC -0.124; TCGA ESCA -0.234; TCGA LIHC -0.187; TCGA PRAD -0.104; TCGA SARC -0.245; TCGA THCA -0.164; TCGA STAD -0.194; TCGA UCEC -0.324 |
hsa-miR-145-5p | ZC3H3 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.084; TCGA BRCA -0.248; TCGA CESC -0.099; TCGA ESCA -0.097; TCGA HNSC -0.108; TCGA KIRC -0.082; TCGA LGG -0.077; TCGA LIHC -0.21; TCGA LUSC -0.153; TCGA PRAD -0.066; TCGA STAD -0.107; TCGA UCEC -0.05 |
hsa-miR-145-5p | DNMT3B | 13 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.116; TCGA BRCA -0.232; TCGA CESC -0.127; TCGA ESCA -0.174; TCGA KIRP -0.204; TCGA LGG -0.07; TCGA LIHC -0.229; TCGA LUAD -0.243; TCGA LUSC -0.71; TCGA PRAD -0.313; TCGA SARC -0.08; TCGA STAD -0.272; TCGA UCEC -0.314 |
hsa-miR-145-5p | H2AFX | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.107; TCGA BRCA -0.386; TCGA COAD -0.125; TCGA ESCA -0.211; TCGA HNSC -0.12; TCGA KIRC -0.091; TCGA LGG -0.063; TCGA LIHC -0.247; TCGA LUAD -0.156; TCGA LUSC -0.334; TCGA SARC -0.1; TCGA STAD -0.154; TCGA UCEC -0.169 |
hsa-miR-145-5p | ARL5B | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.076; TCGA COAD -0.16; TCGA ESCA -0.149; TCGA HNSC -0.127; TCGA LUAD -0.226; TCGA LUSC -0.132; TCGA PRAD -0.383; TCGA STAD -0.236; TCGA UCEC -0.099 |
hsa-miR-145-5p | RLIM | 9 cancers: BLCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.057; TCGA HNSC -0.054; TCGA LUAD -0.084; TCGA LUSC -0.099; TCGA PAAD -0.069; TCGA PRAD -0.145; TCGA SARC -0.051; TCGA THCA -0.053; TCGA STAD -0.147 |
hsa-miR-145-5p | TPR | 10 cancers: BLCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.096; TCGA HNSC -0.079; TCGA LGG -0.074; TCGA LIHC -0.118; TCGA LUAD -0.084; TCGA LUSC -0.17; TCGA OV -0.093; TCGA PRAD -0.155; TCGA THCA -0.05; TCGA STAD -0.139 |
hsa-miR-145-5p | GATC | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.081; TCGA BRCA -0.105; TCGA CESC -0.129; TCGA COAD -0.098; TCGA ESCA -0.084; TCGA HNSC -0.127; TCGA LIHC -0.115; TCGA LUAD -0.159; TCGA LUSC -0.233; TCGA PRAD -0.31; TCGA SARC -0.094; TCGA STAD -0.152; TCGA UCEC -0.103 |
hsa-miR-145-5p | NUFIP2 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.092; TCGA CESC -0.06; TCGA ESCA -0.055; TCGA HNSC -0.053; TCGA KIRP -0.059; TCGA LUAD -0.108; TCGA LUSC -0.128; TCGA PRAD -0.195; TCGA STAD -0.136; TCGA UCEC -0.095 |
hsa-miR-145-5p | CHAC2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.111; TCGA BRCA -0.122; TCGA COAD -0.25; TCGA ESCA -0.215; TCGA HNSC -0.113; TCGA LGG -0.136; TCGA LUAD -0.244; TCGA LUSC -0.35; TCGA PRAD -0.239; TCGA STAD -0.189; TCGA UCEC -0.267 |
hsa-miR-145-5p | UBXN4 | 10 cancers: BLCA; COAD; KIRC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.097; TCGA COAD -0.097; TCGA KIRC -0.067; TCGA LGG -0.053; TCGA LUAD -0.133; TCGA LUSC -0.177; TCGA OV -0.061; TCGA PRAD -0.223; TCGA THCA -0.072; TCGA STAD -0.141 |
hsa-miR-145-5p | CSTF3 | 15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.103; TCGA BRCA -0.131; TCGA COAD -0.091; TCGA ESCA -0.104; TCGA HNSC -0.096; TCGA KIRP -0.061; TCGA LGG -0.062; TCGA LIHC -0.093; TCGA LUAD -0.113; TCGA LUSC -0.242; TCGA OV -0.11; TCGA PAAD -0.124; TCGA PRAD -0.095; TCGA STAD -0.161; TCGA UCEC -0.127 |
hsa-miR-145-5p | FAM104A | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; UCEC | MirTarget | TCGA BLCA -0.066; TCGA BRCA -0.07; TCGA COAD -0.09; TCGA ESCA -0.073; TCGA HNSC -0.053; TCGA LGG -0.058; TCGA LIHC -0.135; TCGA LUAD -0.132; TCGA LUSC -0.18; TCGA PAAD -0.101; TCGA UCEC -0.054 |
hsa-miR-145-5p | SMC1A | 10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD | mirMAP | TCGA BLCA -0.063; TCGA BRCA -0.057; TCGA ESCA -0.06; TCGA HNSC -0.128; TCGA LGG -0.08; TCGA LIHC -0.09; TCGA LUAD -0.111; TCGA LUSC -0.245; TCGA PRAD -0.163; TCGA STAD -0.156 |
hsa-miR-145-5p | ONECUT2 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.326; TCGA BRCA -0.187; TCGA ESCA -0.605; TCGA HNSC -0.354; TCGA KIRP -0.496; TCGA LGG -0.19; TCGA LIHC -0.248; TCGA LUAD -0.213; TCGA LUSC -0.759; TCGA PRAD -0.656; TCGA UCEC -0.334 |
hsa-miR-145-5p | ARFGEF2 | 9 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.087; TCGA ESCA -0.073; TCGA HNSC -0.075; TCGA KIRC -0.079; TCGA LUAD -0.078; TCGA LUSC -0.101; TCGA PRAD -0.235; TCGA THCA -0.073; TCGA STAD -0.181 |
hsa-miR-145-5p | SOX4 | 10 cancers: BLCA; BRCA; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.152; TCGA BRCA -0.124; TCGA KIRP -0.187; TCGA LGG -0.416; TCGA LUAD -0.153; TCGA LUSC -0.355; TCGA PRAD -0.233; TCGA THCA -0.453; TCGA STAD -0.205; TCGA UCEC -0.075 |
hsa-miR-145-5p | CEP78 | 11 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.065; TCGA COAD -0.164; TCGA ESCA -0.107; TCGA HNSC -0.138; TCGA LGG -0.149; TCGA LIHC -0.107; TCGA LUAD -0.144; TCGA LUSC -0.312; TCGA PRAD -0.181; TCGA STAD -0.175; TCGA UCEC -0.092 |
hsa-miR-145-5p | SYAP1 | 9 cancers: BLCA; BRCA; ESCA; KIRC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.05; TCGA BRCA -0.144; TCGA ESCA -0.109; TCGA KIRC -0.07; TCGA LUAD -0.109; TCGA LUSC -0.114; TCGA PRAD -0.126; TCGA STAD -0.093; TCGA UCEC -0.137 |
hsa-miR-145-5p | SLC19A1 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.098; TCGA BRCA -0.264; TCGA CESC -0.114; TCGA ESCA -0.237; TCGA HNSC -0.097; TCGA LIHC -0.094; TCGA SARC -0.12; TCGA STAD -0.211; TCGA UCEC -0.16 |
hsa-miR-145-5p | HN1L | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.05; TCGA BRCA -0.201; TCGA CESC -0.052; TCGA COAD -0.081; TCGA ESCA -0.077; TCGA HNSC -0.079; TCGA KIRC -0.083; TCGA KIRP -0.148; TCGA LIHC -0.084; TCGA LUAD -0.103; TCGA LUSC -0.132; TCGA PRAD -0.143; TCGA STAD -0.154; TCGA UCEC -0.124 |
hsa-miR-145-5p | GPD2 | 10 cancers: BLCA; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.132; TCGA COAD -0.076; TCGA HNSC -0.109; TCGA LIHC -0.104; TCGA LUAD -0.133; TCGA LUSC -0.148; TCGA PRAD -0.219; TCGA THCA -0.068; TCGA STAD -0.164; TCGA UCEC -0.061 |
hsa-miR-145-5p | TBPL1 | 9 cancers: BLCA; COAD; ESCA; LUSC; OV; PAAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.054; TCGA COAD -0.149; TCGA ESCA -0.131; TCGA LUSC -0.213; TCGA OV -0.126; TCGA PAAD -0.094; TCGA SARC -0.104; TCGA STAD -0.101; TCGA UCEC -0.097 |
hsa-miR-145-5p | NAA15 | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.069; TCGA COAD -0.098; TCGA ESCA -0.078; TCGA HNSC -0.076; TCGA LUAD -0.157; TCGA LUSC -0.146; TCGA OV -0.09; TCGA PRAD -0.198; TCGA STAD -0.141; TCGA UCEC -0.113 |
hsa-miR-145-5p | LRRC8B | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.098; TCGA COAD -0.078; TCGA ESCA -0.12; TCGA HNSC -0.091; TCGA LUAD -0.097; TCGA OV -0.064; TCGA PRAD -0.309; TCGA STAD -0.266; TCGA UCEC -0.138 |
hsa-miR-145-5p | ATXN7L3 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.108; TCGA BRCA -0.107; TCGA ESCA -0.074; TCGA HNSC -0.072; TCGA KIRP -0.052; TCGA LIHC -0.119; TCGA LUAD -0.071; TCGA LUSC -0.173; TCGA PRAD -0.099; TCGA SARC -0.057; TCGA STAD -0.089 |
hsa-miR-145-5p | XPO7 | 9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; OV; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.095; TCGA ESCA -0.058; TCGA HNSC -0.091; TCGA LUAD -0.082; TCGA LUSC -0.152; TCGA OV -0.081; TCGA PRAD -0.11; TCGA THCA -0.08; TCGA STAD -0.099 |
hsa-miR-145-5p | PCBP2 | 10 cancers: BLCA; COAD; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | miRNATAP | TCGA BLCA -0.058; TCGA COAD -0.098; TCGA LGG -0.066; TCGA LIHC -0.071; TCGA LUAD -0.127; TCGA LUSC -0.093; TCGA OV -0.064; TCGA PAAD -0.119; TCGA PRAD -0.128; TCGA SARC -0.078 |
hsa-miR-145-5p | BRWD3 | 9 cancers: BLCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.176; TCGA LGG -0.158; TCGA LIHC -0.113; TCGA LUAD -0.158; TCGA LUSC -0.267; TCGA OV -0.107; TCGA PRAD -0.427; TCGA STAD -0.113; TCGA UCEC -0.092 |
hsa-miR-145-5p | AIFM1 | 10 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.051; TCGA BRCA -0.134; TCGA ESCA -0.097; TCGA LUAD -0.092; TCGA LUSC -0.193; TCGA OV -0.126; TCGA PAAD -0.079; TCGA PRAD -0.095; TCGA STAD -0.091; TCGA UCEC -0.175 |
hsa-miR-145-5p | NDFIP2 | 10 cancers: BLCA; COAD; ESCA; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.072; TCGA COAD -0.146; TCGA ESCA -0.1; TCGA KIRC -0.106; TCGA LUAD -0.069; TCGA PRAD -0.119; TCGA SARC -0.207; TCGA THCA -0.114; TCGA STAD -0.171; TCGA UCEC -0.063 |
hsa-miR-145-5p | LARP4B | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.073; TCGA BRCA -0.098; TCGA ESCA -0.132; TCGA HNSC -0.056; TCGA KIRC -0.051; TCGA LIHC -0.073; TCGA LUAD -0.061; TCGA OV -0.101; TCGA PRAD -0.073; TCGA STAD -0.152; TCGA UCEC -0.063 |
hsa-miR-145-5p | E2F3 | 11 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.175; TCGA BRCA -0.12; TCGA CESC -0.109; TCGA ESCA -0.143; TCGA LUAD -0.155; TCGA LUSC -0.362; TCGA OV -0.074; TCGA PRAD -0.3; TCGA THCA -0.052; TCGA STAD -0.247; TCGA UCEC -0.202 |
hsa-miR-145-5p | EFNA3 | 13 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.213; TCGA BRCA -0.225; TCGA KIRC -0.141; TCGA KIRP -0.139; TCGA LIHC -0.279; TCGA LUAD -0.166; TCGA LUSC -0.522; TCGA OV -0.155; TCGA PRAD -0.187; TCGA SARC -0.133; TCGA THCA -0.121; TCGA STAD -0.282; TCGA UCEC -0.255 |
hsa-miR-145-5p | BAZ2A | 10 cancers: BLCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.07; TCGA CESC -0.075; TCGA HNSC -0.091; TCGA LGG -0.055; TCGA LIHC -0.076; TCGA LUAD -0.096; TCGA LUSC -0.091; TCGA PRAD -0.249; TCGA THCA -0.068; TCGA STAD -0.069 |
hsa-miR-145-5p | FUS | 11 cancers: BLCA; BRCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | RAID | TCGA BLCA -0.065; TCGA BRCA -0.225; TCGA LGG -0.084; TCGA LIHC -0.108; TCGA LUAD -0.058; TCGA LUSC -0.168; TCGA OV -0.063; TCGA PRAD -0.069; TCGA SARC -0.053; TCGA STAD -0.081; TCGA UCEC -0.067 |
hsa-miR-145-5p | CDK4 | 14 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BRCA -0.134; TCGA COAD -0.092; TCGA ESCA -0.129; TCGA LGG -0.176; TCGA LIHC -0.153; TCGA LUAD -0.151; TCGA LUSC -0.28; TCGA OV -0.082; TCGA PAAD -0.077; TCGA PRAD -0.084; TCGA SARC -0.288; TCGA THCA -0.117; TCGA STAD -0.068; TCGA UCEC -0.073 |
hsa-miR-145-5p | F11R | 10 cancers: BRCA; ESCA; HNSC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.117; TCGA ESCA -0.095; TCGA HNSC -0.084; TCGA LUAD -0.071; TCGA LUSC -0.159; TCGA OV -0.08; TCGA SARC -0.085; TCGA THCA -0.138; TCGA STAD -0.18; TCGA UCEC -0.175 |
hsa-miR-145-5p | MMP12 | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.192; TCGA CESC -0.419; TCGA COAD -0.389; TCGA ESCA -0.401; TCGA HNSC -0.422; TCGA LUAD -0.508; TCGA LUSC -0.326; TCGA PRAD -0.249; TCGA THCA -0.96; TCGA STAD -0.638; TCGA UCEC -0.48 |
hsa-miR-145-5p | RTKN | 10 cancers: BRCA; ESCA; LGG; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BRCA -0.266; TCGA ESCA -0.173; TCGA LGG -0.13; TCGA LUAD -0.092; TCGA LUSC -0.231; TCGA OV -0.097; TCGA SARC -0.36; TCGA THCA -0.212; TCGA STAD -0.174; TCGA UCEC -0.157 |
hsa-miR-145-5p | STAT1 | 10 cancers: BRCA; CESC; HNSC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BRCA -0.19; TCGA CESC -0.301; TCGA HNSC -0.322; TCGA LUAD -0.116; TCGA LUSC -0.156; TCGA OV -0.164; TCGA PRAD -0.17; TCGA THCA -0.405; TCGA STAD -0.149; TCGA UCEC -0.216 |
hsa-miR-145-5p | TPM3 | 13 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.199; TCGA CESC -0.068; TCGA COAD -0.09; TCGA ESCA -0.17; TCGA LIHC -0.093; TCGA LUAD -0.122; TCGA LUSC -0.053; TCGA OV -0.066; TCGA PRAD -0.053; TCGA SARC -0.333; TCGA THCA -0.116; TCGA STAD -0.177; TCGA UCEC -0.172 |
hsa-miR-145-5p | NUDT1 | 12 cancers: BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | miRTarBase | TCGA BRCA -0.257; TCGA ESCA -0.167; TCGA HNSC -0.114; TCGA KIRP -0.147; TCGA LGG -0.083; TCGA LIHC -0.23; TCGA LUAD -0.11; TCGA LUSC -0.378; TCGA SARC -0.141; TCGA THCA -0.168; TCGA STAD -0.084; TCGA UCEC -0.129 |
hsa-miR-145-5p | FAM49B | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.109; TCGA CESC -0.059; TCGA COAD -0.138; TCGA ESCA -0.155; TCGA HNSC -0.097; TCGA KIRC -0.085; TCGA LIHC -0.111; TCGA LUAD -0.157; TCGA LUSC -0.104; TCGA PRAD -0.201; TCGA SARC -0.103; TCGA STAD -0.212; TCGA UCEC -0.25 |
hsa-miR-145-5p | ARF6 | 9 cancers: BRCA; COAD; HNSC; KIRP; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.069; TCGA COAD -0.058; TCGA HNSC -0.102; TCGA KIRP -0.066; TCGA LUAD -0.065; TCGA PRAD -0.172; TCGA THCA -0.183; TCGA STAD -0.056; TCGA UCEC -0.06 |
hsa-miR-145-5p | SCAMP3 | 11 cancers: BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.211; TCGA ESCA -0.136; TCGA KIRC -0.076; TCGA LIHC -0.181; TCGA LUAD -0.075; TCGA LUSC -0.159; TCGA OV -0.085; TCGA PAAD -0.097; TCGA THCA -0.065; TCGA STAD -0.061; TCGA UCEC -0.154 |
hsa-miR-145-5p | AARS | 9 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PAAD; UCEC | MirTarget | TCGA BRCA -0.074; TCGA CESC -0.061; TCGA HNSC -0.053; TCGA LIHC -0.071; TCGA LUAD -0.063; TCGA LUSC -0.146; TCGA OV -0.095; TCGA PAAD -0.112; TCGA UCEC -0.051 |
hsa-miR-145-5p | UBE2Z | 9 cancers: BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.088; TCGA ESCA -0.054; TCGA HNSC -0.094; TCGA LIHC -0.085; TCGA LUAD -0.073; TCGA LUSC -0.157; TCGA THCA -0.086; TCGA STAD -0.052; TCGA UCEC -0.062 |
hsa-miR-145-5p | DNAJB11 | 9 cancers: BRCA; ESCA; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.136; TCGA ESCA -0.134; TCGA LIHC -0.144; TCGA LUAD -0.097; TCGA LUSC -0.259; TCGA OV -0.063; TCGA SARC -0.055; TCGA STAD -0.119; TCGA UCEC -0.211 |
hsa-miR-145-5p | ADAM17 | 9 cancers: CESC; COAD; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.113; TCGA COAD -0.059; TCGA LGG -0.08; TCGA LUAD -0.093; TCGA LUSC -0.101; TCGA PRAD -0.273; TCGA SARC -0.12; TCGA STAD -0.122; TCGA UCEC -0.08 |
hsa-miR-145-5p | BNIP3 | 9 cancers: CESC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | miRNAWalker2 validate; miRTarBase | TCGA CESC -0.148; TCGA KIRC -0.113; TCGA LIHC -0.102; TCGA LUAD -0.233; TCGA LUSC -0.329; TCGA PAAD -0.287; TCGA PRAD -0.119; TCGA THCA -0.084; TCGA UCEC -0.234 |
hsa-miR-145-5p | NRAS | 12 cancers: CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; OV; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA CESC -0.061; TCGA COAD -0.069; TCGA ESCA -0.114; TCGA HNSC -0.128; TCGA LGG -0.059; TCGA LIHC -0.12; TCGA LUAD -0.143; TCGA OV -0.095; TCGA PRAD -0.201; TCGA SARC -0.16; TCGA STAD -0.178; TCGA UCEC -0.175 |
hsa-miR-145-5p | LYN | 10 cancers: CESC; COAD; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA CESC -0.101; TCGA COAD -0.108; TCGA ESCA -0.192; TCGA HNSC -0.189; TCGA LUAD -0.071; TCGA PRAD -0.142; TCGA SARC -0.183; TCGA THCA -0.345; TCGA STAD -0.195; TCGA UCEC -0.071 |
hsa-miR-145-5p | TNFRSF10A | 9 cancers: COAD; ESCA; HNSC; LUAD; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA COAD -0.118; TCGA ESCA -0.15; TCGA HNSC -0.179; TCGA LUAD -0.089; TCGA OV -0.167; TCGA PRAD -0.178; TCGA SARC -0.179; TCGA THCA -0.341; TCGA STAD -0.213 |
hsa-miR-145-5p | ERLIN1 | 9 cancers: COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD | MirTarget | TCGA COAD -0.148; TCGA ESCA -0.086; TCGA HNSC -0.052; TCGA LUAD -0.109; TCGA LUSC -0.097; TCGA PRAD -0.084; TCGA SARC -0.211; TCGA THCA -0.139; TCGA STAD -0.15 |
hsa-miR-145-5p | RPA1 | 9 cancers: COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD | MirTarget | TCGA COAD -0.076; TCGA HNSC -0.077; TCGA KIRP -0.059; TCGA LIHC -0.051; TCGA LUAD -0.056; TCGA LUSC -0.225; TCGA PAAD -0.08; TCGA THCA -0.053; TCGA STAD -0.051 |
hsa-miR-145-5p | TMEM167A | 9 cancers: ESCA; KIRC; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA ESCA -0.119; TCGA KIRC -0.082; TCGA LIHC -0.075; TCGA LUAD -0.072; TCGA PAAD -0.1; TCGA PRAD -0.161; TCGA SARC -0.125; TCGA STAD -0.104; TCGA UCEC -0.093 |
Enriched cancer pathways of putative targets